Publications Database
Research on alpha-gal syndrome (AGS)
With this publications database, we hope to consolidate all the peer-reviewed research on alpha-gal syndrome. Some gray literature and relevant government, industry, and nonprofit documents were included. Please report errors or omissions to [email protected].
Thanks to Lee Ann Kendrick, Matthew von Hendy, and John Bianchi of Revivicor for their assistance with the initial creation of this database.
Key words
Key words were added to help providers find relevant papers. For example:
- Specialties: e.g. “gastroenterology” “rheumatology” “cardiology”
- Regions: e.g. “Africa” “Spain”
- Medical products: e.g. “biologic” “vaccine”
- Special topics: e.g. “perioperative” “vector” “prevalence” “epidemiology” “dairy”
- Hundreds of other key words
Topics
In addition to alpha-gal syndrome, the database includes select publications on related topics, including:
- pork-cat syndrome and other mammalian meat allergies
- other carbohydrate allergies
- cross-reactive carbohydrate determinants
- the role of ecto- and endoparasites in inducing food allergy
- vector management and ecology
- the evolution of the α-gal immune response
- allergy and autoimmune disease
- hypersensitivity reactions to biologics
- co-factors
- idiopathic anaphylaxis
- airborne reactions to food allergens
- carrageenan
- mammalian byproducts
- cross-contamination of meat products, and other relevant food and food industry issues
- viral glycan shields
- drugs and vaccines employing the α-gal immune response
- xenotransplantation and the development of alpha-gal knock-out species
Stars indicate publications flagged as important or of interest in one or more review articles by Commins SP, Hilger C, Platts-Mills TAE, and van Nunen S, and/or deemed as such by the database manager.
* of interest
** of significant interest
† of special relevance to emergency care/perioperative care/hospitalization/pharmacy
‡ of special relevance to diagnosis and management
§ key review articles
Note that these designations were used for older papers and are not up-to-date.
What’s New
Recent highlights:
- Henderson JJ, Saleem D, George E, Still S. Intraoperative anaphylaxis in the setting of undiagnosed alpha-gal syndrome: A heart team clinical conundrum. JACC Case Rep. 2025;(106033):106033. doi:10.1016/j.jaccas.2025.106033
Case summary: A 74-year-old man undergoing valve and ascending aortic replacement experienced hemodynamic collapse after transfusion of heparin, fresh frozen plasma, and platelets. Transfusion reaction, cardiogenic shock, and sepsis were ruled out. Recovery occurred within 6 hours of medical treatment. After an otherwise uncomplicated hospitalization, he was diagnosed with AGS and treated with diet restriction and omalizumab.
Discussion and take-home messages: In addition to anaphylaxis, AGS may also have long-term cardiovascular effects such as early bioprosthetic valve failure, accelerated atherosclerosis, and coronary artery disease. Understanding of clinical subtleties of AGS and its cardiovascular implications is important for clinicians who manage these patients both in the short and long terms.
| AUTHORS | DATE | TITLE & ABSTRACT | PUBLICATION/LINK | KEYWORDS |
|---|---|---|---|---|
| Hollenhorst MA, Anderson JR, Dzik W. | 2026 | Ticks and transfusion at the Crossroads—alpha-gal syndrome. |
JAMA Intern Med. Published online August 24, 2026. doi:10.1001/jamainternmed.2026.3993 | TRAGS; transfusion; transfusion reactions; transfusion-related alpha-gal syndrome |
| Roy N, Imran SM, Rabbi MF, Al Adib A. | 2026 | Prevalence and Risk Factors of Food Allergy and Its Association With Asthma Coexistence and Severity in Bangladeshi Schoolchildren: A GIS‐Based Cross‐Sectional Study. |
Food Science & Nutrition. 2026 Aug 19;14(8):e72240. | Asia; Bangladesh |
| Zillioux J. | 2026 | Reply to editorial comment on “implications of alpha-gal syndrome in urologic management.” |
Urology. 2026;0(0). doi:10.1016/j.urology.2026.08.014 | Urology; medical products; perioperative |
| Howard H. Weitz, Geno J. Merli, Maziar M. Nourian. | 2026 | Annals Consult Guys - Preoperative Evaluation: Uncovering a Condition Hidden in Plain Sight. |
Ann Intern Med.2026;179:e2603447CG. [Epub 18 August 2026]. Doi:10.7326/ANNALS-26-03447-CG | Perioperative care; cardiac surgery; cardiology; heparin; bioprosthetic heart valves |
| Hunter Hamilton DN. | 2026 | Empowering Anesthesia Providers with Evidence-Based Tools for Alpha-Gal Syndrome. |
Thesis | Perioperative care; provider education |
| Ahonkhai AA, Heller HM, Schrader SM. | 2026 | Case 20-2026: A 38-Year-Old Man with Abdominal Pain. |
New England Journal of Medicine. 2026 Jul 16;395(3):291-300. | Gastroenterology; GI; symptoms; GI phenotype; GI variant; symptoms; eosinophilia |
| Ghenbot, R.G., Newman, I., Leung, A., Gonzalez, A., Uchi, J. and Zillioux, J. | 2026 | Implications of Alpha-gal Syndrome in Urologic Management. |
Urology. 2026 Jul 7. | Urology; medical products; perioperative |
| Saunders EF, Taylor ML, Jones ES, Biggerstaff BJ, Vorobiov JM, McCormick DW, Lanteri MC, Green V, Custer B, Tonnetti L, Kersh GJ. | 2026 | Alpha-gal Immunoglobulin E Seroprevalence Among Blood Donors—10 States, 2024–2025. |
MMWR. Morbidity and Mortality Weekly Report. 2026;75 | Seroprevalence |
| Jacobs JW, Kaufman RM, Schwartz JY, Hall E, Tahiri T, Adkins BD, Costa V, Crowe EP, Orton L, Sharma D, Savani BN. | 2026 | Alpha-Gal Syndrome: Unrecognized Risks of a Tick-Bite-Associated Allergy in Transplantation and Cellular Therapy. |
American Journal of Transplantation. | transplantation; risk stratification |
| Elghezewi A, Obeidat Y. | 2026 | Alpha-Gal Syndrome and the Gastrointestinal Tract: Epidemiology, Clinical Phenotype, Diagnosis, Management, and the Case for a Public Health Response. |
Pre-print | Review article |
| Salam E, DelaRosa VS, Trivedi M. | 2026 | Acute Diverticulitis as an Atypical Presentation of Alpha-Gal Syndrome. |
Cureus. 2026 Jun 28;18(6). | gastroenterology; GI; symptoms; diverticulitis |
| Saunders EF, Taylor ML, Jones ES, et al. | 2026 | Alpha-gal immunoglobulin E seroprevalence among blood donors — 10 states, 2024–2025. |
MMWR Morb Mortal Wkly Rep. 2026;75(25):315-321. doi:10.15585/mmwr.mm7525a1 | Seroprevalence |
| Platts-Mills TA, Dunaway CA, Gangwar RS, Workman LJ, Wilson JM. | 2026 | The alpha-gal syndrome: Understanding the role of tick bites, and the delays in severe anaphylaxis. |
InAllergy and Asthma Proceedings 2026 Jul 1 (Vol. 47, No. 4, pp. 237-246). OceanSide Publications, Inc. | Review article |
| Salam E, DelaRosa VS, Trivedi M. | 2026 | Acute diverticulitis as an atypical presentation of alpha-gal syndrome. |
Cureus. 2026;18(6). doi:10.7759/cureus.111671 | gastroenterology; GI; symptoms; diverticulitis |
| Suriapperuma T, Jayasundara K, Badanasinghe N, Mettananda S. | 2026 | Alpha-gal syndrome presenting with recurrent wheezing mimicking asthma in a Sri Lankan child. |
Sri Lanka Journal of Child Health. 2026 Jun 5;55(2). | Asia; Sri Lanka; symptoms; respiratory; differentials; asthma |
| Andersson H, Engström F, Guterstam M, Kättström U, Livéus F. | 2026 | Recombinant Cell Lines for Industrial Production of Monoclonal Antibodies: Recommendation of Cell lines for Allergy Tests. |
Uppsala Universitet | cell lines; CHO; monoclonal antibodies |
| Khanipour R, Bera RK, Suarez I, Moghadam AS, Mattumpuram J. | 2026 | Heparin-Induced Anaphylaxis With Cardiac Arrest in a Patient With Alpha-Gal Syndrome: A Case Report. |
Cureus. 2026 Jun 7;18(6). | medical products; heparin; cardiac; perioperative care |
| Li Y, Jin F, Qian Y, Wang S, Ding S, Li Y, Hu L, He R, Yan Y, Tao T, Bo M. | 2026 | Allergens and Allergenicity in Cell-cultured Meat: Current Status and Reflections. |
Trends in Food Science & Technology. 2026 Apr 27:105779. | cell-based foods; cultured meat; cell-based meat |
| Zerihun W, Tewodros B, Fahed J, Mohammad A, Bekele A. | 2026 | Acute Coronary Syndrome in Alpha-Gal Syndrome: A Rare Immune-Cardiac Intersection. |
Cureus. 2026 May 5;18(5). | cardiac surgery; bivalirudin |
| Li Y, Deng JQ, Wang AQ, Xin SY, Sheng LL, Zhao YH, Li XY, Li CY, Wang FS, Shao HR, Sheng JZ. | 2016 | Wholly enzymatic programmable sulfation in nonanimal heparin synthesis. |
Trends in Biotechnology. 2026 Jun 17. | heparin; synthetic heparin |
| Zikria B, Murali S. | 2026 | Tick-Borne Diseases in Orthopaedic Practice: Lyme Arthritis and Alpha-gal Syndrome. |
JAAOS-Journal of the American Academy of Orthopaedic Surgeons. 2022 May 13:10-5435. | orthopediedics; orthopedic surgery; perioperative care |
| Román-Carrasco P, Ridlmaier N, Martínez-Martos S, Kornmüller K, Swoboda I. | 2026 | Anti–α-Gal IgG antibodies promote macrophage uptake of α-Gal–bearing lipoproteins and foam cell formation. |
Journal of Allergy and Clinical Immunology. 2026 Jun 15. | IgG; atherosclerosis; cardiovascular disease; cardiology; cardiac |
| van Nunen S. | 2026 | Ticks and transfusions: a potentially fatal mix!. |
Blood. 2026 Jun 18;147(25):2999-3000. | TRAGS; transfusion; deaths; fatalities |
| Mateos-Hernandez L, Wu-Chuang A, Maitre A, Rego RO, Denis-Abuin L, Piloto-Sardiñas E, Fernández-Ruiz N, Maye J, Aželytė J, Banovi P, Palinauskas V. | 2026 | Natural antibodies induced by host gut microbiota modulate tick microbiota, inhibiting Borrelia colonization. |
Ticks and Tick-borne Diseases. 2026 Jul 1;17(4):102674. | Anti-gal; alpha-gal antibodies; Borrelia sp.; Lyme |
| Li D, Zhang WF, Deng YP, Duan DY, Liu W, Fu YT, Meng Q, Zeng YK, Elsheikha HM, Liu L, Liu GH. | 2026 | Disrupted barriers, evolved risks: toward precision One Health in arthropod allergy. |
Trends in Parasitology. 2026 Jun 19. | |
| Sadtler K, Sommerfeld SD, Wolf MT, Wang X, Majumdar S, Chung L, Kelkar DS, Pandey A, Elisseeff JH. | 2016 | Proteomic composition and immunomodulatory properties of urinary bladder matrix scaffolds in homeostasis and injury. |
InSeminars in immunology 2017 Feb 1 (Vol. 29, pp. 14-23). Academic Press. | Medical products; medical devices |
| de Chaisemartin L, de la Taille V, Nicaise-Roland P, Malard L, Beuscart C, Gouel-Cheron A, Laperche S, Tiberghien P. | 2026 | Severe allergic transfusion reactions to B/AB plasma or platelets in group O recipients are linked to α‑Gal sensitization. |
Blood. 2026;(blood.2025032045). doi:10.1182/blood.2025032045 | transfusion reactions; TRAGS |
| Bitzer E, Bourke P, Hussain S. | 2026 | MEAT PIES: Mammalian Meat Allergy in Patients Investigated for Gastrointestinal Symptoms: Detection of Mammalian Meat Allergy in the Gastroenterology Outpatient Department, Cairns Hospital, Queensland, Australia. </b | JGH Open: An Open Access Journal of Gastroenterology and Hepatology. 2026 Jun 16;10(6):e70433. | gastroenterology; GI variant; GI phenotype. Australia; protocol |
| Rothenberg ME. | 2021 | *An Allergic Basis for Abdominal Pain. |
N Engl J Med. 2021;384(22):2156-2158. doi:10.1056/NEJMcibr2104146 | gastroenterology |
| Faitelson Y, Beigelman A. Can you teach an old drug new tricks? | 2021 | The use of salbutamol for gastrointestinal anaphylaxis. |
J Allergy Clin Immunol Pract. 2021;9(8):3138-3139. doi:10.1016/j.jaip.2021.05.017 | gastroenterology |
| Vighi G, Marcucci F, Sensi L, Di Cara G, Frati F. | 2008 | Allergy and the gastrointestinal system. |
Clinical & Experimental Immunology. 2008 Sep;153(Supplement_1):3-6. | gastroenterology |
| Canziani KE, Pucci Molineris ME, Guzman L, Bermedo V, García MN, Altamirano EM, Muglia CI, Docena GH. | 2021 | Direct evidence for local IgE production in the human colonic mucosa. |
Allergy. 2021 May 2;76. | gastroenterology |
| Casterline, B. W., Franzese, C., Park, Y., & McElroy, J. A. | 2026 | α-Gal Syndrome in the South: Why We Need Treatment Trials, Not Just Tick Prevention. |
Southern Medical Journal. 2026 Jun;119(6):328-32. | treatment; OIT; oral immunotherapy |
| Bingemann TA. | 2026 | ACAAI/AAP Symposium-What was served in the last year: Food Allergy Non-treatment. |
Annals of Allergy, Asthma & Immunology. 2026 May 19. | Meeting conference symposium; ACAAI |
| Ruan W, Wang G, Qu Q, Gai X, Wang C, Liu J, Zhu F, Qu Z, Liu C. | 2026 | Comparative in vitro and in vivo assessment of three experimental extracellular matrix meshes for soft tissue remodeling. |
Scientific Reports. 2026 May 21. | Perioperative care; medical devices; extracellular matrix; surgical mesh |
| Conway AE, Verdi M, Sinclair-Lian N, Fredlund E, Soffer GK, Sanders J, Kumar BP, Tsoulis M, Rider NL, Abrams EM, Hand M. | 2026 | Finding A Balance: Auricular Acupressure in the Allergy Clinic. |
The Journal of Allergy and Clinical Immunology: In Practice. 2026 May 20. | |
| Sobala ŁF, Szymczak-Kulus K, Kasper Ł, Kasper M, Kaczmarek R, Czerwinski M. | 2026 | Alpha-Gal syndrome unveiled: decoding the glycan-driven red meat allergy. |
Glycoconjugate journal. 2026 May 14;43(1):19. | glycobiology |
| Fish D. | 2026 | Getting Serious about Tickborne Diseases—Shifting Research Priorities. |
New England Journal of Medicine. 2026 May 13. | Tick control; white-tailed deer; prevention |
| Nakamura H, Okagawa T, Maekawa N, Parizi LF, Ikehata M, Tiyamanee W, Win SY, Takeuchi H, Maezono K, Thammahakin P, Kobayashi S. | 2026 | Tick saliva reprograms macrophages into immunosuppressive hubs that regulate T-cell immunity in Rhipicephalus microplus infestation. |
Communications Biology. 2026 Apr 30;9(1):581. | Vector; tick; tick saliva; immunomodulation; immunosuppression |
| Akinkugbe OA, Titus-Okpanachi A, Oduneye OM. | 2026 | Reframing Alpha-Gal Syndrome as a One Health Oral Health Risk: A Theoretical Model for Dental Safety and Policy Reform. |
Published online 2026. | dentistry; dental |
| Peruško M, Apostolović D, Grundström J, Kronqvist M, Radomirović M, Smed-Sörensen A, Hedin U, van Hage M. | 2026 | IgE And IgG Antibody Responses to α-Gal and Association With Carotid Stenosis in Swedish Patients. |
Allergy. 2026. | cardiology; cardiac; atherosclerosis; atheroma; cardiovascular disease; Europe |
| Bryant JS, Scott MD, Gerardo CJ, Platts-Mills TA. | 2026 | Anaphylaxis to Antivenom in a Patient With Asymptomatic Alpha-Gal IgE Antibodies: A Case Report. |
Advanced Emergency Nursing Journal. 2025 Nov 21:10-97. | asymptomatic sensitization; antivenom |
| Davis MJ, Topol D, Davis ME. | 2026 | Beefing Up Awareness: Navigating Alpha-Gal Syndrome. |
Clinical Journal of Oncology Nursing. 2026 Apr 1;30(2):118. | nursing; oncology |
| Platts-Mills TA, Workman LJ, Richards NE, Wilson JM, McFeely E. | 2026 | Reply to “Fatal reactions to alpha-gal might be due to comorbid mast cell diseases”. |
The Journal of Allergy and Clinical Immunology: In Practice. 2026 Apr 1;14(4):994-5. | mast cell disorder; mastocytosis; hereditary alpha-tryptasemia; hereditary α-tryptasemia |
| Moraczewski J, Stone CA. | 2026 | Fatal reactions to alpha-gal might be due to comorbid mast cell diseases. |
The Journal of Allergy and Clinical Immunology: In Practice. 2026 Apr 1;14(4):994. | mast cell disorder; mastocytosis; hereditary alpha-tryptasemia; hereditary α-tryptasemia |
| Foster M, Brown M, Mueller A, Tahiri T, Atchison K, Sharma D, Stone Jr CA, Tucci J, Booth GS, Jacobs JW. | 2026 | Transfusion‐related alpha‐gal syndrome: Two new cases expanding the demographic and geographic spectrum, and evidence of a diagnostic gap in allergic transfusion reaction evaluation. |
Transfusion. 2026;(trf.70196). doi:10.1111/trf.70196 | TRAGS; transfusion-related alpha-gal syndrome; blood type; type O; type B; platelet; plasma; blood type; transfusion reaction |
| de Chaisemartin L, de la Taille V, Nicaise-Roland P, Malard L, Beuscart C, Gouel-Chéron A, Laperche S, Tiberghien P. | 2026 | Severe allergic transfusion reactions to plasma or platelets in group O recipients are linked to α-Gal sensitization. |
Blood. 2026;(blood.2025032045). doi:10.1182/blood.2025032045 | TRAGS; transfusion-related alpha-gal syndrome; blood type; type O; type B; platelet; plasma; blood type; transfusion reaction |
| Hinojosa OA, Dasgupta A, Ye Z. | 2026 | Anaphylactic transfusion reaction to group B platelets related to alpha‐gal syndrome: A case report. |
Transfusion. 2026;(trf.70212). doi:10.1111/trf.70212 | TRAGS; transfusion-related alpha-gal syndrome; blood type; type O; type B; platelet; plasma; blood type; transfusion reaction |
| Noori M, Brüggen MC, Schmid-Grendelmeier P, Möhrenschlager M. | 2026 | Contact Urticaria to Chamois (Rupicapra rupicapra) Raw Muscle Meat in a Non-Occupational Hunter: First Documented Case. |
Contact Dermatitis. 2026 Mar 7. doi: 10.1111/cod.70131. Epub ahead of print. PMID: 41795111. | Contact; blood reaction; dermatological exposure; skin exposure; occupational allergy |
| Aikaterini S. | 2026 | Differential diagnosis of severe reactions mimicking or related to allergy and hidden allergens. |
Respiratory Medicine. 2026 Mar 2:108732. | differential diagnosis; Europe; Greece |
| Rahalkar NJ, Sanders MR, Joshi SN, Dorman SM, Katz HT, Rahalkar N, Sanders M, Joshi S, Dorman S. | 2026 | Alpha-Gal Syndrome in a Pediatric Patient From Northeast Florida. |
Cureus. 2026 Mar 3;18(3). | pediatric; Jacksonville; Florida; University of Florida College of Medicine |
| Herdiana Y, Gozali D, Putriana NA, Muchtaridi M, Shamsuddin S, Sofian FF. | 2026 | Beyond Side Effect: Immuno-Ethical Risk Analysis of Animal-Derived Ingredients in Pharmaceuticals. |
Risk Management and Healthcare Policy. 2026 Dec 31:584055. | Drugs |
| Abadi AE, Becevic M, Dunaway L, Franzese C, Casterline BW. | 2026 | Digital Health Solutions for Alpha-Gal Syndrome: A Scoping Review of Telemedicine Evidence and Applications. |
Missouri Medicine. 2026 Jan;123(1):73. | telehealth; missouri |
| Sami N, Parikh M, Mihatov, N, Frishman W, Peterson S. | 2026 | The Alpha-Gal Syndrome and Hypersensitivity to Biomaterials: Understanding Xenoimmunity. |
Cardiology in Review. 2026 Feb 18. ():10.1097/CRD.0000000000001200 | Cardiology; medical products; medical devices |
| Shah R, Ailsworth S, Workman L, Susi A, Platts-Mills T, Nylund C, Wilson J. | 2026 | High-Negative Alpha-Gal IgE as a Marker of Future Seroconversion in US Military Personnel. Abstract. While considered negative and of unknown clinical significance, alpha-gal IgE levels between 0.02-0.09 kU/L may reflect prior immune priming. This could be a risk factor for future conversion to clinically relevant levels and in some cases be explained by exposure to ticks other than lone stars. |
Journal of Allergy and Clinical Immunology. 2026 Feb 1;157(2):AB72. | risk factor; high negative alpha-gal IgE; prior sensitization |
| Uchi J, Hughes A, Nourian M, Meinholz TM. | 2026 | Carrageenan: A Non-mammalian Allergen in Alpha-gal Syndrome. |
Journal of Allergy and Clinical Immunology. 2026 Feb 1;157(2):AB227. | Medical products; drugs; carrageenan |
| Semenza K, Roome A, Scribani M, Victory J, Thiruvarudchelvam S. | 2026 | Alpha Gal Syndrome in Rural Populations. Abstract. 10 patients were diagnosed with alpha-gal syndrome with 9/10 patients diagnosed in or after 2023. Initial symptoms predominantly involved hives (8/10), diarrhea (4/10), angioedema (3/10), nausea (3/10), and abdominal pain (3/10) with 60% of patients reporting no recurrence of symptoms after diagnosis and mammalian meat avoidance. 60% of patients were noted to have emergency department visits prior to diagnosis with time to diagnosis ranging from 0.3 to 30 months. |
Journal of Allergy and Clinical Immunology. 2026 Feb 1;157(2):AB70. | |
| Mew L, MacCallum M, Bortz PS, Workman L, Platts-Mills T, Wilson J. | 2026 | Characterization and survey of Alpha-gal IgE in tick bitten adults of central Virginia. Abstract. To date, the cohort includes 94 adults with a mean age of 56.5 years and 66 (70%) females. Alpha-gal IgE (≥ 0.1 IU/mL) was detected in 58 (62%). Sensitized subjects were older, had higher total IgE, greater itch duration for the most recent bite, and more tick bites in the past year. Mammalian meat allergy was reported by 11 subjects (total prevalence of 12%), and their levels trended higher compared to the sensitized subjects who did not report meat allergy (median 4.1 IU/mL vs 0.88 IU/mL, P=0.077). |
Journal of Allergy and Clinical Immunology. 2026 Feb 1;157(2):AB67. | pathogenesis; risk factor; tick bite |
| Lee J, Kim HJ. | 2026 | Red meat allergy in Jeju, Korea: Clinical characteristics of 17 cases. |
Journal of Allergy and Clinical Immunology. 2026 Feb 1;157(2):AB235. | Asia; Korea; case series |
| Ikegawa N, Saito-Sasaki N, Sawada Y. | 2026 | Maculopapular-Type Drug Eruption Caused by Cetuximab. Although cetuximab is most commonly associated with immediate, α-gal-mediated hypersensitivity reactions, this case illustrates that T-cell-mediated type IV drug eruptions can also occur. |
Cureus. 2026 Feb 1;18(2). | Medical products; biologics; monoclonal antibody; cetuximab |
| Miller MJ, Zarpak R, Lee P, Osterwind Z, Lenz M, Guevara MA, Fowler S, Price C, Shields TC, Livinski AA, Conry-Cantilena K. | 2026 | Alpha-gal sensitization and allergic blood transfusion reactions: a scoping review. |
Journal of Translational Medicine. 2026 Feb 4. | TRAGS; transfusion-related alpha-gal syndrome; transfusion; blood type; platelets; plasma |
| Valois A, Le Forestier J, Baduel E, Guillot G, Blaise T, Couppié P, Delon F, Epelboin L. | 2026 | Risk factors for α-Gal syndrome: A case-control study exploring the role of tick bites in French Guiana. In this tropical setting, tick bites, especially from the more anthropophilic Amblyomma cajennense sensu stricto, appear to be a major risk factor for AGS, along with forest-related occupational exposure. These findings support the assumption that ticks are probably at least the main vector of symptomatic sensitization to α-Gal in French Guiana. |
Ticks Tick Borne Dis. 2026;17(1):102607. doi:10.1016/j.ttbdis.2026.102607 | case series; risk factor; pathogenesis; vector; tick; Latin America; French Guiana; Amblyomma cajennense sensu stricto |
| Ikegawa N, Saito-Sasaki N, Sawada Y. | 2026 | Maculopapular-type drug eruption caused by cetuximab. Although cetuximab is most commonly associated with immediate, α-gal-mediated hypersensitivity reactions, this case illustrates that T-cell-mediated type IV drug eruptions can also occur. |
Cureus. 2026;18(2). doi:10.7759/cureus.102768 | biologics; cetuximab; monoclonal antibodies |
| Itonori S, Akita Y, Harahata T, Hatanaka M, Ito M, Sugita M. | 2026 | Structural analysis of neutral glycosphingolipids bearing human blood group-like sugar units from the mantle skin of the jumbo flying squid (Dosidicus gigas) |
Glycobiology.;36(2). | Mollusk; squid; B antigen; A antigen |
| Cordova JC. | 2026 | Who's Afraid of Virginia Ham? Alpha-Gal and Why It Matters to Anesthesiologists. |
ASA Monitor. 2026 Feb 1;90(2):35. | perioperative care; surgery; anesthesia |
| Trlin HJ. | 2025 | The impact of long-term culture on primary bovine myoblasts : implications for cultivated meat production and allergenicity. Significant reductions in the abundance of major protein allergens Bos d 6 and Bos d 13 suggest the allergenic potential of cultivated beef meat may be reduced compared to traditional beef meat. However, an increased detection α-Gal in cultured cells, alongside an increased abundance of currently insignificant protein allergens ENO1, ATP5PO, and COL1A2, suggests that allergenicity may be increased. |
Thesis 2025. Accessed January 23, 2026. https://hdl.handle.net/10092/109458 | Cultured meat; alternative meat; cell-based meat |
| Rao S, Rathore SS, Goyal RM, Narakornpichit A, Karkra R, Al‐Khazraji A, Grover M. | 2026 | Understanding Alpha‐Gal Syndrome: A Systematic Review and Meta‐Analysis of Clinical Manifestations and Outcomes. |
Neurogastroenterology & Motility. 2026 Jan;38(1):e70245. | review; meta-analysis; symptoms; phenotypes |
| Awosika A, Balaji P. | 2026 | Misdiagnosis of alpha-gal syndrome as non-celiac gluten sensitivity or lactose intolerance: A diagnostic blind spot for clinicians. |
World Journal of Gastroenterology. 2026 Jan 21;32(3). | gastroenterology; GI variant; differential; gluten sensitivity; lactose intolerance; Illinois |
| Bernth Jensen JM, Søgaard OS, Petersen MS, Hoffmann S, Møller BK, Hansen AG, Sørensen UB, Thiel S. | 2026 | Isohemagglutinins exhibit synergistic polyreactivity toward Streptococcus pneumoniae surface antigens: implications for broad-spectrum reactivity of human antibodies. |
Medical Microbiology and Immunology. 2026 Dec;215(1):5. | polyreactivity of anti-gal and related antigens; blood type; B antigen; A antigen; isohemagglutinins |
| Wang Y, Zhang Y, Dudley C, Fitzgerald K, Carson AS, Kapita CM, Rana D, Kluckman K, Bortner D, Cowley DO, Travis CR, Vorobiov J, Choudhary S, Kepley CL, Commins SP, Smith SA, Iweala OI. | 2026 | Alpha-gal-specific human IgE promotes both alpha-gal-induced and antigen-independent allergic effector cell activation. Certain alpha-gal-specific human IgE clones may partially activate allergic effector cells independent of antigen, potentially lowering thresholds for subsequent alpha-gal-induced or antigen-independent allergic effector cell degranulation. This may affect duration and severity of allergic symptoms in patients with AGS. |
Journal of Allergy and Clinical Immunology. 2026 Jan 12. | |
| Wu Y, Yang M, Xu Y, Jia L, Li J, Wang X, Zhao J, Cai Y, Zhang Y, Sun S. | 2026 | A comprehensive N-glycoproteome atlas reveals tissue-specific glycan remodeling but non-random structural microheterogeneities. Notably, even commonly expressed glycoproteins undergo tissue-dependent glycan remodeling, suggesting that glycosylation may fine-tune protein functions to meet specialized biological demands. These patterns are further shaped by subcellular localization, which constrains glycan variabilities across compartments. |
Nature Communications. 2026 Jan 13. | variability of glycosylation |
| Hayman JA. | 2025 | Darwin’s illness revisited. |
BMJ. 2009 Dec 14;339. | Charles Darwin; historical evidence |
| Krir D, Zamali I, Galai Y, Ben Hmid A, Ben Sghaier I, Nasri Y, Kebaier H, Ouni H, Abdennadher W, Ben Ahmed M, Samoud S. | 2025 | Unraveling a Complex Pediatric Food Allergy: CMPA, Alpha-Gal, and PR-10–Mediated PFAS. |
REVUE ALGERIENNE D’ALLERGOLOGIE. 2026 Jan 5;10(2):36-46. | Tunisia; multiple food allergy |
| Propst SB, Thompson DK. | 2025 | Alpha-gal syndrome and the gastrointestinal reaction: a narrative review. |
Frontiers in Allergy. 2025 Jan 24;6:1535103. | GI variant review article |
| Maldonado-Ruiz P. | 2024 | The Tick Microbiome: The “Other Bacterial Players” in Tick Biocontrol. n this paper, we present a summary of the tick microbiome, including the endosymbiotic bacteria and the environmentally acquired (here referred to as the non-endosymbiotic community). We will focus on the non-endosymbiotic bacteria from Ixodes spp. and Amblyomma americanum and discuss their potential for novel biocontrol strategies. |
Microorganisms. 2024 Nov 28;12(12):2451. | ticks; Amblyomma americanum; tick microbiome |
| Banović P, Jakimovski D, Mijatović D, Bogdan I, Simin V, Grujić J, Vojvodić S, Vučković N, Lis K, Meletis E, Kostoulas P. | 2025 | Genetic and Immunological Insights into Tick-Bite Hypersensitivity and Alpha-Gal Syndrome: A Case Study Approach. These findings emphasize the heterogeneity of tick-related hypersensitivity and the importance of HLA genotypes in susceptibility. Comprehensive molecular, immunological, and genetic profiling offers valuable insights into the mechanisms of hypersensitivity, supporting personalized approaches for the diagnosis and management of tick-induced allergic conditions. |
International Journal of Molecular Sciences. 2025 Jan 15;26(2):680. | |
| Liveris M. | 2025 | Case Report: Delayed Anaphylaxis Following Meat Consumption and Tick Exposure. |
American Family Physician. 2025 Jan;111(1):5A-. | |
| Amrol AJ. | 2025 | Alpha-gal syndrome presentations. Due to its unusual presentation, alpha-gal syndrome is often misclassified as idiopathic anaphylaxis or irritable bowel syndrome. In patients who have delayed allergic or GI reactions to red meat, especially with a history of tick bites, alpha-gal IgE serology is diagnostic with a sensitivity of 100%. Management is avoidance of red meat and provision of an epinephrine autoinjector and allergy action plan. Many patients can eventually tolerate red meat again as long as they do not get additional tick bites. |
Medicine Today. 2025 Mar;26(3):61-62. Available from: https://medicinetoday.com.au/mt/2025/march/journal-watch/alphagal-syndrome-presentations | symptoms; presentations; GI phenotype; GI variant |
| Zhang E, Bylund R, Zhang A, Massop D. | 2025 | Alpha-Gal Syndrome Allergy to Intravitreal Administration of Anti-Vascular Endothelial Growth Factor Agents. To describe a case of allergic reaction to intravitreal (IVT) injection of antivascular endothelial growth factor (anti-VEGF) medications in patients with alpha-gal syndrome. Methods: A single case was evaluated. Bevacizumab, aflibercept, and faricimab are recombinant immunoglobulins produced by DNA technology in Chinese hamster ovary cells, which may contain galactose-α-1,3-galactose (alpha-gal), a potential allergen for patients with alpha-gal syndrome. Patients with alpha-gal syndrome may develop allergic reactions to certain IVT anti-VEGF agents derived from mammalian expression systems. Ranibizumab, produced using an Escherichia coli expression and lacking alpha-gal, seems to be a safe and effective option for patients with alpha-gal syndrome requiring IVT anti-VEGF therapy. |
Journal of VitreoRetinal Diseases. 2026;0(0). | ophthalmology; eyes; medical products; biologics; monoclonal antibodies; alpha-gal syndrome, allergy, anti-VEGF agents, ranibizumab, bevacizumab, choroidal neovascularization |
| Gammage S, Marangoni AG. | 2025 | Safety of edible coatings on fruits and vegetables. |
Comprehensive Reviews in Food Science and Food Safety. 2025 Mar;24(2):e70108. | fruit; vegetable; coating |
| Pointreau Y, Freneaux C, Bejan-Angoulvant T, Ternant D, Calais G, Watier H. | 2025 | Clinical usefulness of anti-α3Gal immunoglobulin E assays for cetuximab-mediated anaphylaxis in head and neck cancer. We have developed an alternative assay based on IgE binding to a3Gal glycans (70BP assay) and compared it with Thermo Fisher Scientific’s bovine thyroglobulin assay (bTG assay)26 to detect red meat allergy in patients. This assay is based on IgE binding to bTG, which is known to be heavily a-galactosylated. Until now, the described assays had good sensitivity and a good negative predictive value, but most of them had a poor positive predictive value, with the risk of overestimation, raising unnecessary concerns, and even loss of opportunity if cetuximab is unnecessarily contraindicated. The bTG assay, which is commercially available worldwide, meets this demand. The European Medicines Agency (EMA), but not the United States Food and Drug Administration (FDA), has recommended the detection of anti-cetuximab IgE before the first infusion; it would be more precise to refer to anti-a3Gal IgE in accordance with their specificity and the available methods of detection. Additional studies in larger cohorts of patients with cancer (head, neck, and colorectal cancer) are now required to more precisely define the clinically relevant cut-off value of this assay and to analyze its cost-effectiveness. |
Immuno-Oncology and Technology. 2025 Mar 1;25:101041. | |
| Altomari C, Uchi J, Carpenter C, Shah S. | 2025 | Emerging Need for Animal-Free Medications in Alpha-gal Syndrome. A total of 1,534 unique inquiries (8.5 inquiries/day) comprising 2,106 medications (median 1 medication/inquiry, range 1-37) were received from 746 individual patients. An 81.9% growth in inquiries was evident from Q1 (n=544) to Q2 (n=990). A total of 531 unique medications were inquired about with animal-free alternatives available 79.3% of the time. Overall, 6.1% (93) of the inquiries were from healthcare providers. The top 5 medications inquired were famotidine, levothyroxine, vitamin D, cetirizine, and amoxicillin. Hydrochlorothiazide was the most commonly inquired medication without a commercially available animal-free alternative. Identifying animal-free medications is a substantial burden for patients with AGS. Increased provider awareness and ADI transparency for medications is essential to ensure patient safety in the setting of AGS. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB293. | |
| Merritt T. | 2025 | Retrospective review of cat and dog dander IgE testing in patients with Alpha-gal Syndrome. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB450. | |
| Workman L, Platts-Mills T, Maccallum M, Taylor A, McNamara C, Wilson J, Moverare R. | 2025 | Isotype diversity of antibodies to alpha-gal Including IgG3 as well as IgE and the possible relevance to coronary artery disease. The different isotypes of immunoglobulin classified as IgG include considerable diversity. In complete contrast to IgG4, IgG3 Ab bind well to Fc receptors, can activate complement, and give rise to immune complexes. We are interested in the possible role of these IgG3 Abs in both coronary artery disease (CAD) and alpha-gal syndrome (AGS). Our results show that patients who experience repeated tick bites can develop levels of sIgG3 to alpha-gal that are significantly associated high atheroma burden. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB33. | isotype diversity; IgG; immunoglobulin G; CAD; coronary artery disease; atheroma; atherosclerosis; cardiac; cardiology |
| Propst SB, Thompson DK. | 2025 | Alpha-gal syndrome and the gastrointestinal reaction: a narrative review. |
Frontiers in Allergy. 2025 Jan 24;6:1535103. | gastroenterological; GI phenotype; variant; presentation; |
| Jang JH, Han B, Jung J, Russo P, Kulasekararaj AG. | 2025 | The Path to Accessible Care: Development and Impact of Eculizumab Biosimilars for Paroxysmal Nocturnal Hemoglobinuria and Atypical Hemolytic Uremic Syndrome. Differences in glycan composition such as the absence of α-gal/NGNA-attached glycans in the biosimilars are linked to their production in Chinese hamster ovary cell lines versus the NS0 murine cell lines used for the reference products. These variations have been fully characterized and are expected to have no impact on the safety, efficacy, or quality of the biosimilars. |
BioDrugs. 2025 Feb 21:1-5. | medical products; biologic; monoclonal antibody; eculizumab |
| Shen R, Chen S, Zhou Z, et al. | 2025 | Sensitization to common foods and early vascular aging: associations and the mitigating effects of health behaviors. Sensitization to at least one food allergen associated with an increased risk of EVA (odds ratio [OR] 1.91 [95% confidence interval (CI), 1.1 to 3.3]). Milk sensitization demonstrated the most robust association (OR 7.18, [95% CI, 2.5 to 20.62]). Additionally, moderate to vigorous activities (MVA) (OR 0.33 [95% CI, 0.11 to 0.97]) and sufficient sleep duration (OR, 0.21 [95% CI, 0.07 to 0.65]) mitigate the association between food sensitization and EVA. Similar results were presented in Poisson regression models, ordinal logistic regression models, and linear regressions. |
BMC Public Health. 2025;25(1):713. doi:10.1186/s12889-025-21951-w | Cardiology; cardiovascular |
| Wu ZL. | 2025 | N-Glycan Fingerprinting of the NIST monoclonal antibody (NISTmAb). Particularly, we report the identification of α-Gal epitopes,core-6 fucosylated glycans, paucimannose glycans and likely some bisecting/tri-antennary glycans on NISTmAb. Overall, our methods could serve as quick assessments of glycosylation on therapeutic antibodies. |
Preprint. bioRxiv. Published online February 20, 2025. doi:10.1101/2025.02.15.638459 | medical products; biologic; monoclonal antibody; NISTmab; Humira |
| Oliva Chávez A, Gonzalez J, Harvey C, Ribeiro-Silva CD, Leal-Galvan B, Persinger KA, Durski S, Olafson PU, Johnson TL. | 2025 | Identification of Potential Amblyomma americanum Antigens After Vaccination with Tick Extracellular Vesicles in White-Tailed Deer. |
Vaccines. 2025 Mar 27;13(4):355. | tick control; deer; amblyomma americanum |
| Atanasio A, Donnianni R, von Recklinghausen A, Maney L, Brydges S, Murphy A, Sleeman M, Limnander A, Orengo J. | 2025 | A novel mouse model for the study of Alpha-Gal Syndrome. Herein, we describe a mouse model of AGS that utilizes passive sensitization with human plasma to allow for interrogation of the polyclonal human alpha-gal IgE-mediated allergic response. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB171. | mouse model |
| Zhang J, Tang Y, Yang D, Yu J. | 2025 | Investigating allergen-specific IgE distribution and correlations in chronic urticaria: a retrospective study in Shanghai, China. Beef and egg whites are prevalent food allergens. |
European Journal of Medical Research. 2025 Dec;30(1):1-8. | Asia; China; beef allergy |
| Moghtaderi M, Mostafavi S, Honar N, Najib K, Nabavizadeh SH. | 2025 | Sensitization to common food allergens in infants with food protein-induced proctocolitis: a prospective study. Of 126 infants analyzed, 81 infants (40 boys and 41 girls) with FPIAP completed this study. The frequency of food sensitization was 32% to at least one of the applied food allergens. Cow’s milk (13.6%), egg (13.6%), and beef (6.2%) were the most frequent allergens, respectively. |
Asia Pacific Allergy. 2025:10-5415. | Asia; Middle East; Iran; comorbidity |
| Douglas JD, Furrie E, Jones S. | 2025 | Alpha-gal syndrome in general practice: red meat food allergy caused by UK ticks These Scottish case reports confirm that the UK tick, Ixodes ricinus, is causing AGS red meat allergy in UK residents. |
British Journal of General Practice. 2025 Apr 1;75(753). | Europe; United Kingdom; UK; Scotland |
| Erickson LD, Wilson JM, Cramton K, Rival CM. | 2025 | Pre-clinical strategies and emerging technologies driving advances in the alpha-gal syndrome. This Review examines the current methodologies, benefits, and limitations of AGS models and highlights the potential of human-based systems for advancing our understanding of the disease and future therapeutic development. |
Allergology International. 2025 Apr 2. | Review article; future directions |
| Zierdt E, Beati L, Humphrey M, Dralabu S. | 2025 | Analysis of the Microbiome of Amblyomma americanum in the Statesboro Region. |
Honors college thesis | Amblyomma americanum; tick microbiome |
| Wu AG, Patel MC, Ramesh M. | 2025 | Desensitization with telemedicine: A novel protocol using remote monitoring for oral immunotherapy for alpha-gal syndrome. This case reveals the feasibility of oral desensitization to beef in an individual with alpha-gal allergy. Allergic reactions in alpha-gal syndrome can be delayed, leading to prolonged observation times which patients on OIT may find unacceptable. Weused telemedicine and remote monitoring in this desensitization protocol to overcome these barriers. Notably, this patient had not experienced any severe anaphylactic reactions requiring respiratory support or intensive care unit admission. Several questions remain, including the reversibility of tolerance by additional tick bites and the applicability of tolerance to other cross-reactivesubstances. This protocol was initiated before the approval of omalizumab for adults with food allergies. Omalizumab is currently approved for risk reduction with strict dietary avoidance. However, its efficacy on alpha-gal allergy syndrome has yet to be defined in clinical trials. |
Annals of Allergy, Asthma & Immunology. 2025 Apr 1;134(4):488-9. | Remote OIT; oral immunotherapy; treatment; management |
| Wasserman RL. | 2025 | Remote oral immunotherapy updosing: Access, safety, and economics. The use of telemedicine-supervised updosing raises important questions about the safety and utility of home OIT updosing, with or without remote supervision, which have significant implications for access to sophisticated allergy care and the economics of allergy practice. |
Annals of Allergy, Asthma & Immunology. 2025 Apr 1;134(4):374-5. | Remote OIT; oral immunotherapy; treatment; management |
| Korçari G, Trebicka A, Lika M, Tushe M. | 2025 | Prevalence of Allergies to Meat and Seafood Products in Childhood. |
Advance Research Journal of Multidisciplinary Studies. 2025;1(1):5–10. | Europe; Albania |
| Papalois VE, Berwanger C, Romagnoli J, Lee J, Cleanthis T, Robinson J, Cairns T, Stansby G, Taube D, Hakim NS. | 2025 | InTransplantation proceedings 1998 (Vol. 30, pp. 2474-2474). APPLETON AND LANGE. These preliminary data indicate that cryopreservation eliminates the expression of Gala1-Gal antigens on adult porcine pancreatic islets and may increase the possibility ofsuccessful pig-to-human islet xenotransplantation. |
Effect of Cryopreservation on Gal 1-3Gal Expression on Adult Porcine Pancreatic Islets. | |
| Kaushik P, Bhatti FS, Bangale T, Marak CP. | 2025 | Alpha-Gal Syndrome: A Concise Review. |
Allergies. 2025 Dec;5(4):42. | Review article; rheumatology |
| Jones S, Bray N, Kaushik P. | 2025 | Erythrodermic Psoriasis and Alpha-gal Syndrome. |
J Med-Clin Res & Rev. 2025;9(3):1-3. | dermatology; symptoms; Erythrodermic Psoriasis; rheumatology |
| Wu S, Nadelmann ER, Koschitzky M, Balagula Y, Halverstam C, Klar T. | 2025 | An eczematous eruption with features of prurigo nodularis: An unexpected presentation of alpha-gal syndrome. Although an urticarial eruption is the hallmark cutaneous manifestation in AGS, we present a case of a patient with an eczematous rash featuring prurigo nodularis, which illustrates the variability in clinical presentations. This atypical presentation points to the need for an increase in clinical awareness and consideration of AGS in patients presenting with dermatological symptoms that are atypical following consumption of mammalian meat. |
JAAD Case Reports. 2025 May 1;59:19-21. | dermatology; symptoms; prurigo nodularis |
| Bernth Jensen JM, Dinh KM, Hindhede L, Erikstrup LT, Hansen AG, Hymøller KM, Ostrowski SR, Pedersen OB, Christiansen SH, Sørensen UB, Thiel S. | 2025 | Impact of Staphylococcus aureus colonization and skin abscesses on formation of human anti-αGal antibodies. This study suggests that skin abscesses lead to elevated plasma anti-αGal antibody levels and that these antibodies might convey or correlate with mucosal immunity to S. aureus. |
Medical Microbiology and Immunology. 2025 Dec;214(1):23. | IgG; anti-gal; staphylococcus; Denmark; Europe |
| Homann, A.; Röckendorf, N.; Kromminga, A.; Frey, A.; Platts-Mills, T.A.; Jappe, U. | 2017 | Glycan and Peptide IgE Epitopes of the TNF-Alpha Blockers Infliximab and Adalimumab—Precision Diagnostics by Cross-Reactivity Immune Profiling of Patient Sera. |
Theranostics 2017, 7, 4699–4709. | medical products; biologics; testing; diagnostics; diagnosis; IgE cross-reactivity immune profiling (ICRIP) |
| Jappe U, Kolaly T, de Vries MS, Gülsen A, Homann A. | 2025 | Connecting Diagnostics and Clinical Relevance of the α-Gal Syndrome—Individual Sensitization Patterns of Patients with Suspected α-Gal-Associated Allergy. Sera from 33 patients with suspected AGS were analyzed. In this study, the binding patterns of 33 well-characterized patients with suspected/manifested meat allergy were analyzed via ImmunoCAP and a newly developed multianalyte array, the IgE cross-reactivity immune profiling (ICRIP) [7]. IgE binding to different forms of α-Gal (CTX, HSA-α-Gal, and Bos d TG) was investigated. The summary of clinical symptoms, clinical history, ImmunoCAP, and ICRIP sheds light on the specific challenges of the diagnosis of α-Gal-dependent allergic reactions and the previously described sensitization mechanism via tick bites [3].Sera from 22 patients yielded a clearly positive signal (>0.35 kU/L) for IgE against α-Gal in ImmunoCAP. For 7 of the remaining 11 patients with negative or ambiguous (IgE level between 0.1 and 0.35 kU/L) results in ImmunoCAP, ICRIP analyses supported the suspected association of the allergy symptoms with IgE against α-Gal components. This component-resolved analysis helps the allergist to provide an individual diagnosis for each patient. |
Nutrients. 2025 Apr 30;17(9):1541. | testing; diagnostics; diagnosis; IgE cross-reactivity immune profiling (ICRIP); Europe; Germany |
| Dasanayake D, Karunatilake C, Karunaratne C, Fernando N, Iddagoda J, de Silva R. | 2025 | Alpha-gal allergy in a South Asian country. The records of 2,902 patients with acute allergic reactions were reviewed, of whom 57 (1.9%) were diagnosed with AGS. This study reveals that AGS is a significant cause of allergy in the Indian subcontinent and is commoner in children unlike in other regions. |
BMC immunology. 2025 May 15;26(1):37. | Asia; Sri Lanka |
| Ji J, Barrett EJ. | 2015 | Suspected intraoperative anaphylaxis to gelatin absorbable hemostatic sponge. |
Anesthesia Progress. 2015 Jan 1;62(1):22-4. | dentistry |
| Gehring MB, Freedman JD, Wolfe B, French BM, Khechoyan DY. | 20244 | Intraoperative anaphylaxis to gelatin during alveolar bone grafting for cleft palate. |
Plastic and Reconstructive Surgery–Global Open. 2024 Mar 1;12(3):e5636. | dentistry |
| Woodruff S, Early R, Qoos W. | 2014 | Anaphylactic reaction with Avitene: a pediatric case report. |
AANA J. 2014; 82(5):368-374. | dentistry |
| Wüthrich B, Bianchi‐Kusch E, Johansson SG. | 1996 | Allergic urticaria and angioedema caused by a hemostatic sponge of bovine fibrin used in tooth extraction. |
Allergy. 1996 Jan;51(1):49-51. | dentistry |
| Tyanna M, Herman M. | 2025 | Alpha-Gal Syndrome: An Emerging Tick-Borne Allergy to Red Meat. |
Cureus. 2025;17(2). | |
| Lubelczyk C, Meagher M, Bartiromo C. | 2025 | Current Status, Public Health Implications, and Potential Future Establishment of Amblyomma americanum, the Lone Star Tick, in Maine. Although collections from Maine do not yet meet the US Centers for Disease Control and Prevention requirements for an established population, evidence shows that low numbers are present in the state, and that further range expansion and increased abundance are likely in years to come. |
Journal of Maine Medical Center. 2025;7(2):13. | vectors; ticks; Amblyomma american; New England; Maine |
| Korsen N. | 2025 | Alpha-Gal Syndrome in New England–A Case Report. |
Journal of Maine Medical Center. 2025;7(2):4. | Maine; black-legged tick; vector; ticks |
| Ailsworth SM, MacCallum M, Richards NE, Workman LJ, Schoppee Bortz P, Makin T, Platts-Mills TA, Wilson JM. | 2025 | IgG to Galactose-Alpha-1, 3-Galactose: Impact of Alpha-Gal IgE Sensitization, Blood Type, and Tick Bites. In a population-based cohort, alpha-gal IgG antibodies were found to be prevalent, and levels were increased in subjects with blood groups A and O, subjects who were alpha-gal IgE sensitized, and those who reported a history of tick bites. |
Antibodies. 2025 May 16;14(2):43. | Risk factor; IgG; blood type; sensitization |
| Schiestl M, Roy N, Trieb M, Park JP, Guillen E, Woollett G, Wolff-Holz E. | 2025 | Analytical Data and Single-Dose PK are Sufficient to Conclude Comparable Immunogenicity for Biosimilars: An Ustekinumab Case Study: M. Schiestl et al. |
BioDrugs. 2025 Sep;39(5):769-76. | medical products; biologics; monoclonal antibodies; ustekinumab; biosimilars |
| Lisiecka MZ. | 2025 | An in-depth analysis of the allergen α-gal: mechanisms, consequences and prospects. |
Journal of Food & Nutrition Research. 2025 Jul 1;64(3). | |
| Özdemiral C, Konuralp I, Sekerel BE. | 2025 | Serum albumin sensitization in children with cow's milk allergy: Clinical relevance to red meat reactions. |
Pediatric Allergy and Immunology. 2025 Jul;36(7):e70157. | Milk allergy; beef allergy; Turkey |
| Choudhary SK, Commins SP. | 2025 | Single-cell mRNA analysis and surface marker expression profiling of circulating immune cells in alpha-gal syndrome. Innate-like cells, including NKT and NKB cells, play an important role in sensitization to alpha-gal. Interestingly, alpha-gal-specific IgE is secreted by the heterogeneous population of B cells, including CCR6-proficient B cells and CCR6-deficient plasmablast/plasma cells. |
Frontiers in Immunology. 2025 Sep 30;16:1629310. | pathogenesis |
| Chiu CY, Henao-Martínez AF, Higuita NI. | 2025 | Association between tick-bite history and safety of gelatin-containing vaccines: Analysis of a large database of the United States. |
Ticks and Tick-borne Diseases. 2025 Sep 1;16(5):102532. | |
| Hussain A, Varga C, Allan BF, Mateus-Pinilla N, Smith RL. | 2025 | Spatial distribution and clustering of medically important tick species in Illinois: Implications for tick-borne disease risk. |
Ticks and Tick-borne Diseases. 2025 Sep 1;16(5):102533. | Illinois; ticks; |
| Kennedy AC, Buoni M, Walls J, Palmer T, Marek E. | 2025 | Statewide passive tick surveillance using companion animals in Delaware reveals 9 tick species (Acari: Ixodidae) and 6 associated pathogens. |
Journal of the American Veterinary Medical Association. 2025 Dec 1;263(12):1-7. | Delaware; vector; ticks; Amblyomma americanum; pets |
| Wormser GP, Shishido A. | 2025 | Could alpha-gal syndrome be the cause of southern tick-associated rash illness (STARI)? |
A simple study could answer that question. Wiener klinische Wochenschrift. 2025 Aug 11:1-2. | STARI |
| Barnett KM, Maki CK, Nicholson WL, Beard CB, Kersh GJ, Salzer JS. | 2025 | Opinion: Ecologists and entomologists wanted! An open invitation to alpha-gal syndrome research. |
Ticks and Tick-borne Diseases. 2025 Sep 1;16(5):102538. | gap analysis; entomology |
| Sribalaji S, Asmathulla S, Manavalan J. | 2025 | Alpha gal syndrome-A rare case report in South India. |
Bioinformation. 2025 May 31;21(5):982. | Asia; India |
| Sabouraud‐Leclerc D, Mariotte D, Bradatan E, Divaret‐Chauveau A, Metz‐Favre C, Beaumont P, Dumond P, Serrier J, Karaca‐Altintas Y, Tscheiller S, Pouessel G. | 2025 | Food anaphylaxis: eight food allergens without mandatory labelling highlighted by the French allergy‐vigilance network. |
Clinical & Experimental Allergy. 2025 Nov;55(11):1118-25. | prevalence; Europe; major food allergens; labeling |
| Ross M, Daley G, Burnard ML, Sen A, Beyene E, Bisrat M, Zinabu SW, Abrie M, Michael M. | 2025 | Alpha-Gal on the Rise: The Alarming Growth of Alpha-Gal Syndrome in High-Risk Regions. |
Cureus. 2025 Jul 21;17(7). | prevalence |
| McKnight M, Mullins ME. | 2025 | Fab or F (ab’) 2 Antivenom: Which Should we use for North American Crotalids?. |
Journal of Medical Toxicology. 2025 Sep 18:1-3. | Medical products; antivenom; anivenin |
| Adams DR, Kays R, Reiskind MH. | 2025 | Environmental correlates and fine-scale distribution of Amblyomma americanum, Ehrlichia spp., and Rickettsia amblyommatis at a single site in south-central Virginia. The significance of edge habitat and forest variables on A. americanum abundance highlights promising targets for control interventions and can be used to develop public health recommendations to reduce tick encounter risk and subsequent pathogen transmission. |
Parasites & Vectors. 2025 Sep 29;18(1):393. | vector; tick; amblyomma americanum; tick control |
| Di Liddo R, Naso F, Gandaglia A, Sturaro G, Spina M, Melder RJ. | 2025 | Enhanced Detection of αGal Using a Novel Monoclonal IgG1 Antibody: Comparative Evaluation with IgM Antibody [Clone M86]. |
Journal of Personalized Medicine. 2025 Nov 17;15(11):558. | |
| Colli A, Zilla P, Calafiore AM, Padalino M, Naso F, George I. | 2025 | Quantification of alpha-Gal expression in commercial bioprosthetic heart valves and its potential mitigation. For the first time, the residual amount of αGal epitopes has been quantified in the tissue of twelve different commercially available models of BHV. The data confirm that commercially available BHVs retain a substantial immunogenic burden attributable to αGal xenoantigens. Importantly, the overtime degradation of glutaraldehyde crosslinks facilitates the gradual re-exhibition of these epitopes, potentially undermining long-term valve performance. The pronounced efficacy of polyphenol-based treatment in inhibiting αGal antigens highlights its promise as a biocompatibility-enhancing pre-treatment strategy for next-generation bioprosthetic heart valves. |
Structural Heart. 2025 Oct 13:100739. | medical products; medical devices; bioprosthetic heart valves; premature degeneration |
| Zahrawi F, Alharami M, Alwan O, Suleiman Z, Hemaidan H. | 2025 | S4283 Eosinophilic Gastrointestinal Disorders and Marked Leukocytosis in Alpha-Gal Syndrome: Infection, Allergy, or Hematologic Malignancy?. |
Official journal of the American College of Gastroenterology| ACG. 2025 Oct 1;120(10S2):S916-7. | eosinophilic gastrointestinal; GI; gastrointestinal; gastroenterology |
| Lisiecka MZ. | 2025 | Specific Immunoglobulin E and Immune Response Regulation With Mechanistic Insights From Allergic Disorders Helminth Infections and Alpha-Gal Syndrome. |
Nutrition Today. 2025 Oct 29:10-97. | Poland |
| Reznik SE, Tiwari AK, Ashby Jr CR. | 2025 | UB-221, an antibody that neutralizes IgE and downregulates the CD23 receptor: a potential treatment for the alpha-gal syndrome. We propose a randomized, double-blind, placebo-controlled clinical trial to evaluate the safety and efficacy of UB-221. Eligible participants will be adults (≥18 years) with a documented history of at least one tick bite, prior allergic reactions to α-gal–containing foods, and α-gal–specific IgE constituting >2% of total plasma IgE. |
Ticks and tick-borne diseases. 2025 Nov 1;16(6):102562. | treatment |
| Tanrıbilir, Mahmut Esat. | 2025 | Alpha-gal syndrome: under-recognized food allergy in dermatology practice. |
Clinical and Experimental Dermatology (2025): llaf484. | dermatology |
| Bianco A, Aruanno A, Lucchini M, Cicia A, Longhino D, Bisurgi M, Colò F, Carlomagno V, Rizzi A, Buonomo A, Mirabella M. | 2025 | IgE-mediated allergic reactions to ocrelizumab in multiple sclerosis: A retrospective cohort study. |
Multiple Sclerosis and Related Disorders. 2025 Oct 31:106826. | biologic; monoclonal antibody; ocrelizumab |
| Razzaq BW, Passman JN, DiMaria S, Servider J, Kleyner RS, Sacks GI, Bergese S, Mushlin H. | 2025 | Complex Spine Surgery in the Setting of Alpha-Gal Syndrome. |
World Neurosurgery. 2025 Nov 6:124634. | Perioperative; surgery; neurosurgery; medical procedure; medical products; allograft; spine surgery |
| Salazar Aguirre A. | 2025 | Seasonal life cycle of the Lone Star Tick (Amblyomma americanum) and the influence of prescribed burning on tick abundance and presence of microorganisms. |
Thesis, Kansas State University | Tick control |
| Piroth M, Gohard F, Le Naour S, Daude M, Boussemart L, Veyrac G, Quéreux G, Coltoiu C, El Hanache H. | 2025 | Hypersensibilité immédiate au cétuximab: une prévention reposant sur la recherche des IgE anti-alpha-gal?. |
Annales de Dermatologie et de Vénéréologie-FMC. 2025 Dec 1;5(8):A347. | Cetuximab |
| Gan Y, Johnson EJ, Tran V, Spitler K, Liang Y, Briggs J, Baginski T, Schöneich C, Yang F. | 2025 | Unambiguous identification and quantification of galactose-α-1, 3-galactose as a critical quality attribute with mass spectrometry and exoglycosidases. Alpha-galactosylation, galactose-α-1,3-galactose (α-Gal), is always regarded as a critical quality attribute due to its potential to provoke immunogenic responses in patients. Consequently, monitoring alpha-galactosylation in therapeutic proteins is essential, but current analytical techniques fall short in terms of identification sensitivity and quantification accuracy. Specifically, the released glycan assay by hydrophilic interaction liquid chromatography-fluorescence-mass spectrometry, the gold standard for glycan separation/identification, faces challenges due to ambiguities with isomeric glycan structures.To address these challenges, we developed a comprehensive analytical method that enhances both the identification sensitivity and quantification accuracy for α-Gal. We developed an integrated workflow that combines an advanced mass spectrometry technique – parallel reaction monitoring triple-stage mass spectrometry – with exoglycosidase sample treatment. This approach generates structurally specific signature ions, enhances identification sensitivity, enables the separation of α-Gal from its isomers, and improves quantification accuracy. By employing this more sensitive analytical approach without ambiguity in assignment for common glycan structures found in monoclonal antibodies, the safety of therapeutic proteins can be better assured, effectively minimizing the risk of α-Gal-induced immunogenicity. |
InmAbs 2025 Dec 31 (Vol. 17, No. 1, p. 2588410). Taylor & Francis. | Alpha-galactosylation;critical quality attribute;mass spectrometry;exoglycosidase |
| Na Y, Kinzer JL, Morrissette L, Cho YS, Shay B, Ford M, Schwendeman A. | 2025 | Multimodal mass spectrometric characterization of structural microheterogeneity in rituximab reference and biosimilars. "α-Gal constituted 0.10 %, 0.05 %, 0.02 %, and 0.06 % of the total glycans in Rituxan, Riabni, Ruxience, and Truxima, respectively." |
International Journal of Biological Macromolecules. 2025 Nov 17:149062. | Biologics; monoclonal antibodies; rituximab biosimilars |
| Owens Pickle EE. | 2025 | Aggressive, Adaptive, and Underestimated: From Allergy to Arboviruses, the Rise of the Lone Star Tick. |
Thesis | vector; lone star tick |
| Stancic J. | 2025 | An investigation into possible causes of, and diagnostics for, Alpha Gal Syndrome |
(Doctoral dissertation). | alpha-galactosidase |
| Carrasco PR, Ridlmaier N, Martos SM, Wijnveld M, Ruivo M, Hemmer W, Wagar L, Swoboda I. | 2025 | Tick Saliva Proteins as Potential Inducers of Th2 Responses in Alpha-Gal Syndrome 3434. Alpha-Gal syndrome (AGS) is a delayed form of anaphylaxis triggered by red meat consumption, caused by IgE antibodies against galactose-α-1,3-galactose (α-Gal). Sensitization to α-Gal typically occurs after a tick bite, but the mechanisms underlying this sensitization and the tick saliva components involved remain unclear. In this study, we aimed to identify α-Gal-carrying proteins in tick saliva that are recognized by Th2 cells from AGS patients. We hypothesize that these proteins act as hapten-carriers, promoting allergic responses after tick exposure. Proteins were purified from tick salivary glands and saliva, then used to stimulate peripheral blood mononuclear cells (PBMCs) from AGS patients and healthy individuals. Flow cytometry analysis revealed that tick proteins induce proliferation of Th2 cells from AGS patients but not from healthy controls. Proteins that stimulated Th2 responses were identified by peptide mass spectrometry. Based on this finding, the mechanisms of allergic sensitization to tick saliva are also being investigated using human immune organoids. Interim results suggest that α-Gal-containing tick proteins preferentially activate Th2 cells in AGS patients, supporting their role as hapten-carriers driving allergic sensitization. |
The Journal of Immunology. 2025 Nov;214(Supplement_1):vkaf283-1241. | Pathogenesis |
| Hashizume H, Matsuura A, Miyachi Y. | 2025 | 087 Anaphylaxis across the Lifespan in Japan: Population-Based Evidence of a Bimodal Pattern and Tick-Associated Risk; Shizuoka Study. Anaphylaxis is a life-threatening hypersensitivity reaction increasingly recognised worldwide. However, its epidemiology in Asian populations remains poorly characterised. Japan’s ageing population and evolving environmental exposures—such as tick-induced alpha-gal syndrome— highlight the need for region-specific data. To estimate the incidence and risk factors of anaphylaxis across age groups, and to evaluate the association between tick bites and anaphylaxis using a large Japanese population dataset. A retrospective cohort study was conducted using the Shizuoka Kokuho Database, covering 1.89 million residents over 10 years. Anaphylaxis was defined by diagnostic codes, epinephrine prescriptions, and emergency visits. Multivariable logistic regression was used to identify risk factors. Propensity score matching and Cox models assessed the relationship between tick bites and anaphylaxis. A total of 2,230 cases were identified, corresponding to an incidence of 2.0 cases per 10,000 person-years. A bimodal age distribution was seen, with peaks in children and older adults. Significant risk factors included male sex, food allergy, urticaria, and cardiovascular/pulmonary diseases. Neuropsychiatric disorders were inversely associated. Tick exposure significantly increased the risk of anaphylaxis (HR 6.25; 95% CI, 2.8–14.1; P = 0.0001), exhibiting a dose-response trend. This study reveals a unique bimodal age pattern of anaphylaxis in Japan and implicates tick bites—likely via alpha-gal sensitisation—as a novel adult-onset risk factor. These findings underscore the need for heightened clinical vigilance among older individuals with tick exposure. |
Journal of Investigative Dermatology. 2025 Dec 1;145(12):S281. | Japan; anaphylaxis |
| Oyediran O, Karim S. | 2025 | Unusual Paralytic Response to Amblyomma maculatum Nymphal Bite in Alpha-Gal knockout Mice. |
Frontiers in Arachnid Science. 2025;4:1709631. | Tick paralysis; Amblyomma maculatum |
| Yamada Y, Fukuyama A, Miyazaki M, Sumi Y, Fukue H, Nakashima A, Akasaki T, Imakyure O, Suzuki Y. | 2025 | Pharmacist-Led Prevention of Recurrent Cetuximab Infusion Reactions. |
Cureus. 2025 Nov 26;17(11). | Biologics; monoclonal antibodies; cetuximab |
| Grković N, Čobanović N, Suvajdžić B, Đurić S, Vićić I, Karabasil N, Dimitrijević M. | 2025 | Alpha-gal syndrome: allergy to red meat. |
Scientific journal" Meat Technology". 2025 Oct 27;66(3):216-9. | Europe; Serbia |
| Murangi T, Mans B, Pienaar R, Botha M, Facey-Thomas H, Cunningham S, Halajian A, Joshi L, Falcone FH, Horsnell W, Levin ME. | 2025 | Differential alpha-gal expression during A. hebraeum and R. evertsi feeding and development: A driver for the development of alpha-gal syndrome in South Africa. There is differential expression of alpha-gal in endemic South African ticks Amblyomma hebraeum and Rhipicephalus evertsi. Immunoblotting demonstrated an increase in the prominence of alpha-gal-containing protein bands in salivary glands to be proportional to feeding time. Alpha-gal in both fed and unfed ticks was localized in the salivary acini and testes. IgE and IgG4 to A hebraeum antigens were significantly raised in alpha-gal-allergic individuals. There was a correlation between anti-A hebraeum IgE and anti-alpha-gal IgE in the alpha-gal-allergic group. Inhibition of human serum anti-alpha-gal IgE to A hebraeum and R evertsi proteins was significantly reduced by the addition of bovine thyroglobulin. |
Journal of Allergy and Clinical Immunology: Global. 2025 Dec 6:100623. | Vectors; ticks; Amblyomma; Rhipicephalus; Africa; South Africa |
| Orive IV, Díaz MV, de Lazarraga MM, del Pozo Gil MD, Mahave IG, Portillo A. | 2025 | Contribution of Alpha-gal in Pathologies Other than Alpha-gal Syndrome: Focusing on Chronic Spontaneous Urticaria. |
Current Treatment Options in Allergy. 2025 Dec 9;12(1):30. | Chronic hives; urticaria; dermatology |
| Kökcü Karadağ Şİ, Kutlu A, Kutluğ Ş, Gündüz ZG, Bozkurt HB, Özçeker D, Öztürk F, Sancak R, Yıldıran A. | 2025 | Childhood-onset alpha-gal syndrome in the central black sea region: real-world data on diagnostic delays, age-specific clinical patterns, environmental risk factors, and anaphylaxis predictors. |
European Journal of Pediatrics. 2026 Jan;185(1):9. | Pediatric; childhood; Europe; Asia; Turkey; case series; vitamin D; anaphylaxis rate; fresh red meat prick-to-prick testing; comorbidity; delayed diagnosis; genetic predisposition |
| Leung ASY, Estrada-Reyes E, Goto K, et al. | 2025 | Global trend of food-induced anaphylaxis: Up to date. |
Pediatr Allergy Immunol. 2025;36(12):e70246. doi:10.1111/pai.70246 | Anaphylaxis; global |
| Browning RL, Iweala OI, Jerath MR. | 2025 | Mammalian meat allergy and beyond: overview of alpha-gal syndrome. |
Curr Opin Allergy Clin Immunol. 2025 Nov 28. | Review article |
| Di Liddo R, Naso F, Gandaglia A, Sturaro G, Spina M, Melder RJ. | 2025 | Enhanced Detection of αGal Using a Novel Monoclonal IgG1 Antibody: Comparative Evaluation with IgM Antibody [Clone M86]. |
J Pers Med. 2025 Nov 17;15(11):558. doi: 10.3390/jpm15110558. PMID: 41295260; PMCID: PMC12653364. | Detection; testing |
| Owusu-Asare C, Browning RL, Jerath MR. | 2025 | Successful home reintroduction of mammalian meat in patients with alpha gal syndrome. |
J Allergy Clin Immunol Pract. Published online November 26, 2025. doi:10.1016/j.jaip.2025.11.027 | Remission; reintroduction |
| Kepley CL, Wang Y, Yelton A, Siebert ER, Iweala OI. | 2025 | Ticked Off: Allergic Effector Cells in the Pathogenesis of Alpha-gal Syndrome. |
Curr Allergy Asthma Rep. 2025 Nov 29;25(1):57. doi: 10.1007/s11882-025-01237-2. PMID: 41317280. | Pathogenesis; mast cell activation syndrome MCAS |
| Commins SP, Biedermann T, McGill SK, Ottosson C, Perusko M, Saunders EF, van Hage M. | 2025 | Letter to the Editor-Re: Sabouraud-Leclerc D, Mariotte D, Bradatan E, et al. Food Anaphylaxis: Eight Food Allergens Without Mandatory Labelling Highlighted by the French Allergy-Vigilance Network. |
Clin Exp Allergy. 2025;(cea.70179). doi:10.1111/cea.70179 | Europe; policy; major food allergen; labeling; label |
| Foley J, Rubino F, Kam D, Lozano K. | 2025 | Assessing the potential risk of lone star tick, Amblyomma americanum, establishment in California. In summary, we find a potential risk of future establishment of LSTs particularly in coastal California. We believe that there is a need for far greater education and surveillance for LSTs and the diseases they cause, and a serious need to improve programs to reduce LST and other Amblyomma spp. introductions into the state. |
Ticks and Tick-borne Diseases. 2025 Nov 1;16(6):102566. | California; West Coast; ticks; amblyomma americanum, Amblyomma cajennense |
| Gan Y, Johnson EJ, Tran V, Spitler K, Liang Y, Briggs J, Baginski T, Schöneich C, Yang F. | 2025 | Unambiguous identification and quantification of galactose-α-1, 3-galactose as a critical quality attribute with mass spectrometry and exoglycosidases. |
InmAbs 2025 Dec 31 (Vol. 17, No. 1, p. 2588410). Taylor & Francis. | Assay; quantification of alpha-gal; biologics; medical products |
| Vaz-Rodrigues R, Duru VC, Nijhof AM, de la Fuente J. | 2025 | Transcriptomics insights into the functional role of tick Ixodes ricinus proteins metalloprotease and antigen p23. |
PLoS One. 2025;20(11):e0336570. | Tick, vector, Ixodes ricinus, pathogenesis |
| Malard L, Beuscart C, de Chaisemartin L, de la Taille V, Delettre F, Humbrecht C, Dunbar N, Lecam S, Laperche S, Tiberghien P, Biomedical Excellence for Safer Transfusion (BEST) Collaborative. | 2025 | Association between group B major ABO‐incompatible platelet or plasma transfusion and severe allergic reactions: A nationwide haemovigilance analysis suggesting a role for α‐gal syndrome. A Biomedical Excellence for Safer Transfusion Collaborative study. |
Vox Sanguinis. 2024 Dec 31. | transfusion reactions; blood type; TRAGS |
| Aloyan T, McGrath K. | 2025 | Alpha-gal syndrome as an underrecognized cause of chronic urticaria: A diagnostic challenge in community practice. |
Ann Allergy Asthma Immunol. 2025;135(5):S207-S208. | chronic hives; urticaria; dermatology; heparin |
| Platts-Mills TAE, Workman LJ, Richards NE, Wilson JM, McFeely EM. | 2025 | Implications of a fatal anaphylactic reaction occurring 4 hours after eating beef in a young man with IgE antibodies to galactose-α-1,3-galactose. The circumstances of fatal anaphylaxis 4 hours after eatingbeef draw attention to the importance of understandinggalactose-α-1,3-galactose syndrome, which includes therole of ticks, the severity of delayed attacks, and the widevariety of symptoms. |
J Allergy Clin Immunol Pract. 2025;0(0). doi:10.1016/j.jaip.2025.09.039 | Death; fatality; mortality |
| Farooqui Z, Dykewicz, MS | 2025 | Managing Heparin-Induced Anaphylaxis Risk In Alpha-Gal Syndrome Through Preoperative Heparin Desensitization Protocol And Pretreatment. |
Accessed November 7, 2025. https://epostersonline.com/acaai2025/poster/m450?view=true | heparin; desensitization protocol |
| Gohri J, Maheshwari A, Rawal A, Jolly A, Satish S. | 2025 | ABSTRACT: Work-related alpha-gal syndrome in emergency physician with mastocytosis. |
Ann Allergy Asthma Immunol. 2025;135(5):S150-S151. | India |
| Henderson J. | 2025 | Abstract 4369550: Intraoperative anaphylaxis in the setting of undiagnosed alpha-gal syndrome: A heart team clinical conundrum. |
Circulation. 2025;152(Suppl_3). doi:10.1161/circ.152.suppl_3.4369550 | cardiac; cardiovascular; cardiothoracic; cardiology; perioperative; surgery; heparin; bioprosthetic |
| Henderson JJ, Saleem D, George E, Still S. | 2026 | Intraoperative Anaphylaxis in the Setting of Undiagnosed Alpha-Gal Syndrome: A Heart Team Clinical Conundrum. |
JACC: Case Reports. 2025 Nov 8:106033. | cardiac; cardiovascular; cardiothoracic; cardiology; perioperative; surgery; heparin; bioprosthetic; Alabama |
| Ghedira MM, Palisson H, Espina C, Baillard C, Samama CM. | 2025 | Perioperative management of a patient with alpha-gal syndrome: A case report. |
Eur J Anaesthesiol Intensive Care. 2025;4(6):e0090. | medical products; drugs; medical devices; perioperative; surgery |
| Glaser T, Culbreth R, Liebelt EL, et al. | 2025 | Analysis of acute hypersensitivity reactions by antivenom type and geographic location in the north American snake bite registry (NASBR). |
J Med Toxicol. 2025;21(3):312-319. | antivenom; antivenin |
| Dart RC. | 2025 | Snake antivenom reactions: A new finding and continued controversy. |
Ann Emerg Med. 2025;0(0). doi:10.1016/j.annemergmed.2025.09.023 | antivenom; antivenin |
| Hafeez N, Murlidhar F, Shahid Z, Boshnaf M, Ijaz O, Dunn SH. | 2025 | S4125 Alpha-Gal Syndrome: A Case Series Supporting the Need for Greater Clinical Recognition. |
Official journal of the American College of Gastroenterology| ACG. 2025 Oct 1;120(10S2):S883. | GI variant; gastroenterology: GI phenotype |
| Ghishan S, Obeidat Y, Altarawneh S, Wang X, Sherif A. | 2025 | S2588 Alpha Gal Allergy Associated With Eosinophilic Gastroenteritis, Coincidence or Coexistence?. |
Official journal of the American College of Gastroenterology| ACG. 2023 Oct 1;118(10S):S1793-4. | comorbidity; comorbidities; eosinophilic gastroenteritis |
| Rama K, Jahagirdar V, Kumar P, Tariq R, Bickston SJ, Vachhani R. | 2025 | S2142 explosive rise in alpha-gal syndrome: A real-world analysis. |
Am J Gastroenterol. 2025;120(10S2):S460. | Prevalence |
| Sempa J, Brenes P, Tegeler A, Looper J, Chao M, Park Y. | 2025 | Alpha-Gal Syndrome in the Heartland: Dietary Restrictions, Public Awareness, and Systemic Barriers in Rural Kansas. |
Preprint | demographics; rural; Kansas |
| Patrick B, Salathe V, Casterline BW. | 2025 | Alpha-Gal Syndrome Across the Lifespan: Distinct Pediatric Clinical Patterns and Rural Predominance in Midwestern Patients. |
Annals of Allergy, Asthma & Immunology. 2025 Aug 22. | Lifespan; age |
| Emerson AG, Mundy L, Murphy BA, Stone CA. | 2025 | Cetuximab Hypersensitivity in the Setting of Asymptomatic Alpha‐Gal Sensitization. |
Head & Neck. 2025 Sep 1. | medical products; biologic; monoclonal antibody; cetuximab |
| Rodero M, Romero S, Valcárcel Á, González-Fernández J, Olmeda AS, Valcárcel F, Daschner A, Cuéllar C. | 2025 | The Role of Anisakis sp. in α-Gal Sensitization: Implications for Parasitic-Induced Meat Allergy. |
Pathogens. 2025 Aug 7;14(8):789. | Vectors; anisakis |
| Lavrand A, Adam L, Da Rocha A, Lemaire F, Loth C, Baldit A, Vasseaux M, Van Gulick L, Beljebbar A, Augusto P, Berquand A. | 2025 | Hydrogels from Wharton's jelly as alternative to conventional extracellular matrix-based constructs. |
International Journal of Biological Macromolecules. 2025 Sep 9:147552. | medical products; medical devices; extracellular matrix |
| Jones VM, Nakahara H, Choudhary SK, et al. | 2025 | Immunologic investigation of an allergic transfusion reaction suspected due to alpha-gal syndrome. |
Transfusion. Published online September 12, 2025. doi:10.1111/trf.18405 | transfusion reactions; blood type |
| Branicka O, Rozłucka L, Gawlik R, Glück J. | 2025 | Alpha-Gal Syndrome—A Series of Cases with Different Clinical Pictures. |
International Journal of Molecular Sciences. 2025 Sep 4;26(17):8601. | Europe; Poland; case study; hymenoptera; mastocytosis |
| Cutshaw MK, Sciaudone M, Vasquez-Martinez B, McClean CM, Kharabora O, Murray K, Strohminger S, Zivanovich MM, Gurnett R, Salgado EM, Boyce RM. | 2025 | Seroprevalence of spotted fever rickettsiosis and ehrlichiosis among food processing workers and their families in Latino communities in North Carolina. |
PLOS Global Public Health. 2025 Sep 2;5(9):e0005116. | |
| Khalil N, Chang A, Sandland L, Feder Jr HM, Molaei G. | 2025 | A Case of Illness Following a Bite by a Male Lone Star Tick (Amblyomma americanum Linnaeus) Infected With Ehrlichia sp. and Rickettsia amblyommatis in Connecticut, United States. |
Clinical Case Reports. 2025 Sep;13(9):e70825. | Tick-borne disease; Rickettsia amblyommatis |
| Patrick B, Salathe V, Casterline BW. | 2025 | Alpha-Gal Syndrome Across the Lifespan: Distinct Pediatric Clinical Patterns and Rural Predominance in Midwestern Patients. |
Annals of Allergy, Asthma & Immunology. 2025 Aug 22. | |
| Filip AB, Mahmood L, Tilly C, Foster HR, Jackson F, Banner W, Platts-Mills TAE, Wilson J, Bortz PS, Charlton N, Kennedy JL. | 2025 | Prevalence of adverse drug reactions: Comparing crotalidae immune polyvalent antivenoms F(ab’)2 and F(ab) in a galactose-alpha-1,3-galactose (alpha-gal) endemic area. |
Ann Emerg Med. Published online August 16, 2025. doi:10.1016/j.annemergmed.2025.06.618 | Antivenom; antivenin; snake bite; medical products |
| Della Marta N, Yuile A, Mok C, Wei J, Oatley M, Skinner T, Miller S, Hudson AL, van Nunen S, Clarke SJ, Diakos CI. | 2025 | A protocol for pre-treatment testing for antibodies to galactose-alpha-1, 3-galactose to mitigate the risk of cetuximab hypersensitivity reactions–a retrospective cohort review. Of 254 assessable patients, 39 underwent the pre-treatment screening protocol. Of the Protocol Applied group, 3% (n=1/38) experienced a cetuximab HSR compared to 16% (n=35/215) in the Protocol Not Applied group (Odds ratio (OR) 7.16; 95% CI 1.13–299.61, p=0.02). Patients with alpha-gal antibody titres >0.1 kUA/L were more likely to experience a cetuximab HSR (OR 69.71; 95% CI 5.18–4296.81, p=0.0001). Conclusions: Pre-treatment screening for alpha-gal antibodies significantly reduces the incidence of cetuximab HSRs. A testing threshold of 0.1 kUA/L is effective in identifying patients at risk. Implementing this protocol can improve the safety of cetuximab therapy in high-risk populations. |
Cancer Treatment and Research Communications. 2025 Jul 24:100969. | biologic; monoclonal antobody; cetuximab; pre-treatment testing |
| Shishido AA, Wormser GP. | 2025 | A Review of Alpha-Gal Syndrome for the Infectious Diseases Practitioner. |
InOpen Forum Infectious Diseases 2025 Aug (Vol. 12, No. 8, p. ofaf430). US: Oxford University Press. | Infectious disease; review |
| Hashizume H, Matsuura A, Ishikawa Y, Hata A. | 2025 | Flounder Roe Triggering α-Gal Syndrome: Hyosophorin as a Possible Allergen. This series of 25 cases, including the current one, highlights the risks of α-Gal syndrome associated with traditional Japanese dishes like nitsuke (boiled flounder with roe). Most patients were elderly (over 60 years old) and exhibited specific IgE antibodies to red meat and α-Gal, alongside a history of urticaria/anaphylaxis – hallmark features of the α-Gal syndrome. Anaphylaxis mostly occurred within 120 min of consuming flounder roe in these cases, a shorter timeframe than that observed with red meat. This suggests that α-Gal-related allergens in flounder roe may have unique bioavailability and abun- dance, enhancing their immunogenicity. |
Acta Dermato-Venereologica. 2025 Feb 12;105:42664. | Flounder egg; Asia; Japan |
| Vaz-Rodrigues R, P′ Odyek Abila P, Kasaija PD, Kibuuka M, de la Fuente J. | 2025 | Allergic reactions associated with tsetse fly bites. |
Annals of Medicine. 2025 Dec 31;57(1):2514096. | vector; tsetse fly |
| Platts‐Mills TA, Gangwar RS, Workman L, Wilson JM. | 2025 | The Immunology of Alpha‐Gal Syndrome: History, Tick Bites, IgE, and Delayed Anaphylaxis to Mammalian Meat. |
Immunological Reviews. 2025 Jul;332(1):e70035. | Review; expert opinion |
| Ridlmaier N, Román-Carrasco P, Wien FC. | 2025 | Immune Responses to α-Gal. |
Master Thesis | Pathogenesis |
| DeGenova MBA A, Soileau K. | 2025 | The Implications of Alpha-Gal Syndrome for Dental and Medical Treatment. |
New Orleans Dental Association News. 2025;63(6):4. | Dentistry |
| Cucco A, Pearce N, Simpson A, Pembrey L, Mpairwe H, Figueiredo CA, Cooper PJ, Douwes J, Brooks C, Adcock IM, Kermani NZ. | 2025 | Exploring geographical differences in IgE response through network and manifold analyses. |
Journal of Allergy and Clinical Immunology. 2025 Jun 30. | Ecuador; Uganda; seroprevalence; IgE |
| Thompson CC, Saracco B, Pruthi A, Cerceo E. | 2025 | Alpha-Gal Syndrome: Often Hidden, Under-Recognized, and in Need of Attention—A Rapid Review. |
International Journal of General Medicine. 2025 Dec 31:3477-88 | Review |
| Dunbar NM, Kaufman RM, Bary KS, Bellairs GR, Cohn CS, Delettre F, Ditcham S, Duarte GC, Ellison A, Fachini R, George CE. | 2025 | ABO‐mismatched platelet and plasma transfusion practices and the potential for transfusion‐related alpha‐gal syndrome: The Biomedical Excellence for Safer Transfusion Collaborative Study. |
Transfusion. 2025 Jul 15. | Blood transfusion; perioperative |
| Naso F, Gandaglia A, Sturaro G, Lepore A, Arcaro A, Gentile F, Di Costanzo A, Angiolillo A. | 2025 | Anti-Alpha-Gal Antibodies Against Gangliosides: A New Autoimmune Target in Alzheimer’s Disease Patients. |
Preprint | Alzheimer's disease; autoimmune; anti-gl |
| Clancy D, Frey S, Chayes D. | 2025 | Safety of Bovine and Porcine Derived Orthopaedic Implants: Growing Concern for Alpha-gal Syndrome. |
Journal of Orthopaedic Experience & Innovation. 2025 Jul 1;6(2). | Perioperative; implants; bioprosthetic; surgery; orthopedic |
| Misra G, Grohman R, Kazachkov M, Nowak-Wegrzyn A. | 2025 | Severe asthma and new-onset meat allergy in a child-could a new puppy be to blame?. |
Annals of Allergy, Asthma & Immunology. | Dog allergy; pork cat |
| Ma J, Wu G, Huang H, Li G. | 2025 | Allergic Risk Among the Children in Southern China: The Association of Influencing Factors with the Allergen Distribution. |
Journal of Asthma and Allergy. 2025 Dec 31:955-66. | Asia; China |
| Rinehart CD, Wang K, LoBue C, Augoustides JG, Patel SJ, Monette P, Zvara J, Ernst LR, Fernando RJ. | 2025 | Perioperative Considerations for a Patient with Alpha-Gal Syndrome Undergoing Cardiac Surgery. |
Journal of Cardiothoracic and Vascular Anesthesia. 2025 Apr 30. | cardiac; cardio; cardiothoracic; surgery; perioperative |
| Brooks JK, Hoch NI, Hoch ER, Sultan AS. | 2025 | Alpha-gal syndrome: potential for a hypersensitivity reaction after the use of dental products: Literature review and case report associated with oral health care. |
The Journal of the American Dental Association. 2025 May 15. | Dentistry; dental |
| Noor K, Orren J, Kennedy K. | 2025 | Alpha-gal syndrome presenting in the emergency department: a case report. |
Journal of Emergency and Critical Care Medicine. 2025 May 22. | |
| Leth-Møller KB, Hansen FR, van Hage M, Thomsen SF, Linneberg A, Kjær LJ. | 2025 | Living close to the forest is a risk factor for galactose‐α‐1, 3‐galactose sensitization. |
Journal of Allergy and Clinical Immunology: Global. 2025 May 27:100500. | Prevalence; geography; Europe; Denmark; risk factor |
| Wong J, Croote D, Creeks P, Aruva V, Lowman H, Smith S. | 2024 | Alpha-gal Specific Monoclonal Antibodies Discovered from Red Meat Allergic Individuals. Over sixty mAbs were discovered from several red meat allergic individuals, including from one individual at three separate time points. Despite alpha-gal being a glycan of limited size relative to canonical protein allergens, discovered antibodies were diverse in variable domain gene usage and originated from both plasmablasts and memory B cells. Furthermore, despite such sequence variability, mAbs had strikingly similar affinity to several alpha-gal containing antigens. Lastly, clonal families of similar antibodies exhibited persistence over time, suggesting mechanisms underpinning immunological memory in AGS. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB275 | Pathogenesis; life history; cellular mechanism; IgE |
| Haljasmaa E, Parkes D, Tamaska W. | 2025 | Case Report: Alpha Gal Syndrome. | In: Rowan Virtual Research Day. rdw.rowan.edu; 2025. Accessed May 4, 2025. https://rdw.rowan.edu/stratford_research_day/2025/may1/20/ | occupational allergy; meat packing; airborne reactions |
| Zhang YY, Tang YT, Huang SL, Sun WQ. | 2025 | Optimizing α-Gal Epitope Removal in Porcine Dermal Matrix: Enzyme Selection and Tissue Form Matter. |
Tissue Engineering Part C: Methods. 2025 May 2. | alpha-gal removal; alpha-galactosidase |
| Naseem Z, Muhammad A, Chatterjee A, Rubio-Tapia A. | 2025 | Alpha-gal syndrome: Recognizing and managing a tick-bite-related meat allergy. |
Cleveland Clinic journal of medicine. 2025 May 1;92(5):311-9. | |
| Vaz-Rodrigues R, Rafael M, Carniato D, de la Fuente J. | 2025 | Public perspectives on tick bite exposure, healthcare visits and associated allergies in iberia. |
Ann Med. 2025 Dec;57(1):2499028. doi: 10.1080/07853890.2025.2499028. Epub 2025 May 3. PMID: 40317252. | Europe; Spain; portugal; tick bite; citizen science |
| Vaz‐Rodrigues R, de la Fuente J. | 2025 | Is Zebrafish a Good Model for the Alpha‐Gal Syndrome?. |
The FASEB Journal. 2025 May 15;39(9):e70602. | animal model; Zebrafish |
| Rosele MI, Md Ariffin MF, Ali AK, Harun MS, Abdillah H. | 2025 | Halal issue in blood plasma-based food products. |
Food Research. 2025 Apr;9(2):323-32. | Hidden ingredients; mammalian byproducts; mammal-derived byproducts; seafood; pasta; bread |
| Hollingsworth BD, Wiener M, Giandomenico DA, Commins SP, Boyce RM. | 2025 | Environmental risk and Alpha-gal Syndrome (AGS) in the Mid-Atlantic United States. |
PLOS Climate. 2025 Apr 23;4(4):e0000528. | geography; epidemiology |
| Abdallah MA, Larson EA. | 2018 | Delayed Anaphylaxis to Mammalian Meat: A Fascinating Disease and Captivating Story. Delayed anaphylaxis to mammalian meat is a newly recognized IgE-mediated syndrome associated with Lone Star tick bites. IgE-mediated anaphylaxis classically occurs within one hour of exposure to the allergen, which is typically a protein epitope. However, in this disease, circulating antibodies to a carbohydrate, alpha-gal (galactose-alpha-1,3-galactose), stimulate the anaphylactic cascade with hives, diarrhea, abdominal cramps, respiratory distress and anaphylactic shock developing after ingestion of beef, pork or lamb meat. The delayed onset of symptoms three to six hours after ingestion of meat is unique. Recognition and understanding of this disease is important for treating and educating patients with suggestive symptoms. Avoidance of red meat is the recommended therapy. |
SD Med Assoc. 2018 Oct;71(10):463-5. | South Dakota |
| Abdelghany Y, Resnyk J, Nadi Khalil A, Zimrin A, Rose JJ. | 2024 | A Case of Anaphylaxis Associated Thrombocytopenia. C32. ALL THAT WHEEZES (AND THEN SOME): CASE STUDIES. |
C32. ALL THAT WHEEZES (AND THEN SOME): CASE STUDIES. American Thoracic Society International Conference Abstracts. American Thoracic Society; 2024:A5290-A5290. | thrombocytopenia; enoxaparin; heparin |
| Abreu C, Bartolomé B, Cunha L, Falcão H. | 2018 | Galactose-alpha-1,3-galactose allergy: a rare syndrome and an atypical presentation. Summary: Allergies to red meat associated with galactose-alpha-1,3-galactose, commonly known as alpha-gal, are rare and have only recently been described. At this time, the literature reports only one case documented in Portugal. In this study, we report the case of a 76-year-old male with an immediate reaction following the ingestion of red meat. Rigorous diagnostic exams, including prick test, prick-to-prick tests, serum specific IgE and SDS-PAGE IgE-immunoblotting, were performed. The alpha-gal epitope IgE re-turned a value of 35.3 kUA/L, leading the authors to believe that this is an atypical case of alpha-gal allergy. |
European annals of allergy and clinical immunology. 2018 Jul;50(4):190-2. | Bartolome; Falcao; Europe; Portugal; rapid onset reaction; immediate reaction; no tick bite; unknown vector |
| Abreu C, Cunha L, Bartolomé B, Falcão H. | 2015 | Anaphylaxis after consumption of red meat in patient with IgE antibodies specific for galactose-alpha-1,3-galactose. | Allergy: European Journal of Allergy and Clinical Immunology. 2015 Sep;70:616-7. | Bartolome Falcao |
| Adams CB, Street DS, Crass M, Bossaer JB. | 2016 | Low rate of cetuximab hypersensitivity reactions in Northeast Tennessee: An Appalachian effect? Purpose: Cetuximab is a monoclonal antibody with a known risk of hypersensitivity reactions. Early studies showed hypersensitivity reaction rates of 3%, but there appears to be a higher incidence in the southeastern United States. To confirm the findings from nearby institutions that cetuximab-associated hypersensitivity reactions occur in approximately 20% of patients in the southeastern United States. Methods: A retrospective chart review was conducted at Johnson City Medical Center in Johnson City, Tennessee. Each patient's first infusion was analyzed for hypersensitivity reaction, as well as for demographic information such as allergy and smoking history, pre-medications, and malignancy type. Results: Data from the first infusion of cetuximab were collected for a total of 71 patients with various malignancies. The overall rate of grade 3 or higher hypersensitivity reaction was 1.4%, and total rate of hypersensitivity reaction was 8.5%. These findings more closely correlate to the early clinical trials and package insert. Both severe (p=0.001) and any-grade (p=0.002) hypersensitivity reaction occurred less frequently in one Southeastern Appalachian medical center compared to academic medical centers directly to the east and west. Conclusions: Patients in southern Appalachia may be less likely to develop cetuximab hypersensitivity reactions compared to surrounding areas in the Southeastern U.S. These results lend support to the theory that exposure to lonestar ticks (Amblyomma americanum) may be responsible for the development of IgE antibodies to cetuximab that cause hypersensitivity reactions. The development of quick and reliable bedside predictors of cetuximab hypersensitivity reactions may aid clinicians considering the use of cetuximab. |
Journal of Oncology Pharmacy Practice. 2016 Dec;22(6):784-9. | pharmacy; pharmaceutical; medication; biologic; biological agent; monoclonal antibody; mAb; cetuximab; prevalence; Tennessee; Appalachia |
| Adegoke A, Kumar D, Budachetri K, Karim S. | 2021 | Changes in microbial composition, diversity, and functionality in the Amblyomma maculatum microbiome following infection with Rickettsia parkeri. Background: Ticks are the primary vectors for emerging and resurging pathogens of public health significance worldwide. Examining tick bacterial composition, diversity, and functionality across developmental stages and tissues is necessary for designing new strategies to control ticks and prevent tick-borne diseases. Methods: A high-throughput sequencing approach was used to determine the influence of blood meal and Rickettsia parkeri infection on changes in Amblyomma maculatum microbiome composition, diversity, and functionality across the developmental timeline and in different tissues. Quantitative insight into microbial ecology analysis allowed us to determine microbial population structure, composition, and diversity. A non-metric multidimensional scaling, the sparse correlations for compositional data (SparCC) module, and phylogenetic investigation of communities by reconstruction of unobserved states 2 (PICRUSt2) software were used in the assessment. . Results: The Amblyomma maculatum microbiome comprises ten bacterial genera present across tick life cycle stages. Among the top ten bacterial genera (the core tick microbiome), Rickettsia, Francisella, and Candidatus Midichloria are the key players, with positive interactions within each developmental stage and adult tick organ tested. The bacterial abundances, based on the number of operational taxonomic units (OTUs), increase with blood meal in each stage, helping bacterial floral growth. The growth in bacterial numbers is related to highly abundant energy metabolism orthologs with blood meal, according to functional analysis. Whereas R. parkeri had a positive correlation with Candidatus Midichloria during the tick life cycle, based on the increased number of OTUs and network analysis, this was due to an increased level of metabolic activity. Interestingly, R. parkeri replaces Francisella, based on the lower level of OTUs representing Francisella in R. parkeri-infected ticks (in all stages/organs) and negatively correlated according to network and linear discriminant analysis effect size (LEfSe). br> Conclusions: We found that Rickettsia and Francisella predominate in the core microbiome of the Gulf Coast tick, whereas Candidatus Midichloria and Cutibacterium levels increase with infection. Network analysis and functional annotation suggest that R. parkeri interacts positively with Candidatus Midichloria and negatively with Francisella and that metabolic profiles are upregulated with blood meal and R. parkeri infection. Overall, this is the first study to determine the combinatorial outcome of blood meal and pathogen interaction on microbiome composition over the developmental stages of Am. maculatum. This new study expands on our existing knowledge of the Am. maculatum microbiome and further highlights the need to investigate pathogen–symbiont interactions between R. parkeri and Francisella or Candidatus Midichloria to facilitate the development of strategies for controlling tick-transmitted diseases. |
bioRxiv 2021.10.25.465777 | Amblyomma maculatum; tick biome |
| Afshan T, Kelbel T. | 2019 | M301 ALLERGIC REACTION WHILE MAKING BURGERS—BLAME IT ON THE DOG!. Introduction: A 5-year-old girl with history of significant eczema, severe dog allergy (IgE>100), and anaphylactic allergy to egg and treenuts developed urticaria on her bilateral arms after preparing hamburger patties. No other ingredients, such as egg, were handled. She had previously tolerated cooked beef and had no history of milk allergy. Case Description: Why, in the absence of milk allergy, was this patient able to tolerate cooked beef ingestion but developed urticaria after raw beef exposure? Diagnostic Plan: Initial diagnostics for beef allergy included beef extract skin testing and beef IgE blood testing, both of which were negative. IgE blood tests for α-Gal, pork, and venison were also negative. The patient passed an oral food challenge to cooked beef. Subsequent skin testing for raw beef was positive (5mm x 10mm). Discussion: Mammalian meat allergy is overall rare, and is frequently associated with α-Gal allergy. A relationship between mammalian meat and epithelia has been described infrequently and is thought to be due to serum albumin cross-reactivity. There is one previous case of an adult cook who developed wheezing and contact urticaria after exposure to raw beef, had previously tolerated cooked beef ingestion, and was subsequently found to have positive skin testing to raw beef. Given structural similarities between mammalian albumins and prior described relationships (i.e. cat and pork), further study would be beneficial to better understand this possible connection. Conclusion: To the best of our knowledge, this is the first pediatric case of raw beef allergy coinciding with severe dog allergy. |
Annals of Allergy, Asthma & Immunology. 2019 Nov 1;123(5):S124. | |
| Ahlers C, Parker E. | 2023 | 41761 Alpha-gal Syndrome for the Dermatologist. Note: this is an abstract only. |
Journal of the American Academy of Dermatology. | dermatology |
| Ahmady A, Yashi K, Virk JP, Roudabeh K, Parikh T. | 2023 | A Case Report on Alpha-gal Syndrome. The alpha-Gal syndrome (AGS) is a relatively newly recognized food allergy in which patients develop sensitization to meat after being bitten by specific tick species. AGS causes a delayed IgE mediated allergic reaction after consumption of meat and sometimes-dairy products and currently it is treated by avoiding consumption of allergens. Here we present a patient who has been living with AGS for about 20 years. |
Curr Res Cmpl Alt Med. 2023;7(178):2577-201. | case report; Kansas; chicken |
| Ailsworth S, Noth A, Patel J, Workman L, Keshavarz B, Nelson M, Platts-Mills T, Susi A, Nylund C, Wilson J. | 2023 | Association of Sex and ABO-blood Group with Alpha-Gal Sensitization in a Cohort of Military Personnel. Rationale: IgE antibodies to galactose-alpha-1,3-galactose (alpha-gal) are strongly linked with tick bites and cause a syndrome of mammalian meat allergy. Previous reports suggest that male sex is associated with alpha-gal sensitization, whereas B blood group is protective. We sought to investigate these associations in a large military cohort. Methods: Baseline and follow-up serum samples (median 3.5 years) were collected and stored in the Department of Defense Serum Repository from 3000 personnel stationed at 10 military bases in the central/eastern USA. Alpha-gal IgE (cut-off 0.1 kU/L) was measured by ImmunoCAP and ABO-blood group assessed by reverse-typing in a subset of the cohort. Results: Of the 3000 subjects, median age was 19 years (IQR 18-22), 2456 (82%) were male, 179 (6.0%) were sensitized to alpha-gal at baseline and 169 (5.6%) had incident alpha-gal sensitization (defined as subjects who sero-converted or had levels increase from baseline to follow-up). 6.6% of males versus 3.3% of females were sensitized at baseline, p=0.004. Adjusted for age, race and home state the odds ratio for sensitization was 1.8 in males (95%CI 1.1-3.0). Incident alpha-gal IgE was higher in males (6.4%) than females (2.4%), p<0.001. Adjusted for age, race and military branch the odds ratio for incident alpha-gal was 1.7 in males (95%CI 1.0-3.3). Using a nested control cohort (n=169) matched for age, sex, race and geography, incident alpha-gal subjects trended toward a lower frequency of B/AB blood types (12% vs 16%), but this was not significant (p=0.28). Conclusions: Alpha-gal sensitization is significantly associated with male sex, but not ABO-blood group status. |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB93. | Epidemiology, military, blood type, prevalence, occupational medicine |
| Ailsworth S, Workman L, Susi A, Platts-Mills T, Nylund C, Wilson J. | 2024 | Is High-level Total IgE a Risk Factor for Alpha-gal Sensitization or a Consequence of Tick Bites?. |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB46. | total IgE; risk factor; atopy; tick antigens; |
| Ailsworth SM, Susi A, Workman LJ, Ji YS, Patel J, Nelson MR, Platts-Mills TA, Nylund CM, Wilson JM | 2023 | Alpha-gal IgE Prevalence Patterns in the United States: An Investigation of 3000 Military Recruits. Background: IgE to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) is an important cause of allergic reactions to mammalian meat. The “alpha-gal syndrome” (AGS) is strongly associated with preceding history of tick bites and in the US is most commonly reported in parts of the southeast, but there has been limited investigation into national alpha-gal sensitization patterns and the relevance of other risk factors. Objective: Systematically investigate alpha-gal IgE prevalence, regional patterns and risk factors. Methods: Alpha-gal IgE was measured by ImmunoCAP in biobanked serum samples collected from 3000 service members who presented for intake to one of 10 military bases in the central/eastern US. Alpha-gal IgE sensitization (cut-off 0.1 IU/mL) was related to home of record at enlistment. Results: Of the cohort, 2456 subjects were male (81.9%), median age was 19 years (IQR 18-22) and alpha-gal IgE was detected in 179 (6.0%). Home of record spanned all 50 states, with a median of 36 recruits per state (range 3-261). The highest prevalence rates were in Arkansas (39%), Oklahoma (35%) and Missouri (29%), with several other southeastern states >10%. Granular mapping revealed sensitization patterns that closely mimicked county-level Amblyomma americanum reports and Ehrlichia chaffeensis infections. Sensitization was associated with male sex, rural residence and White race in univariate and multivariable models. Conclusions: In this systematic survey, prevalence of alpha-gal IgE among incoming military personnel was 6.0%. There were significant regional differences, with an overall pattern consistent with the known range of the lone star tick (A. americanum) and highest frequency in an area including Arkansas, Oklahoma and Missouri. |
The Journal of Allergy and Clinical Immunology: In Practice. | military; prevalence; epidemiology; geography; distribution; race; ethnicity; gender; |
| Airaksinen L, Suojalehto H, Lindström I, Sund J, Pallasaho P, Puustinen A. | 2022 | Characterization of relevant bovine dander allergen components. |
J Investig Allergol Clin Immunol. 2024;34(1):1. | Finland; occupational allergy; cattle farmer; cows |
| Aiuto B, Cirrincione S, Giuffrida MG, Cavallarin L, Portesi C, Rossi AM, Borreani G, Rolla G, Geuna M, Nicola S, Quinternetto A. | 2024 | Milk Fat Globule Proteins Are Relevant Bovine Milk Allergens in Patients with α‐Gal Syndrome. Alpha-gal syndrome (AGS) is a mammalian meat allergy associated with tick bites and specific IgE to the oligosaccharide galactose-α-1,3-galactose (α-gal). Recent studies have shown that 10-20% of AGS patients also react to the dairy proteins. Considering the already described role of the meat lipid fraction in AGS manifestations, the aim of this work has been to investigate whether the milk fat globule proteins (MFGPs) could be involved in AGS. The MFGPs are extracted and their recognition by the IgE of AGS patients is proved through immunoblotting experiments. The identification of the immunoreactive proteins by LC-HRMS analysis allows to demonstrate for the first time that butyrophillin, lactadherin, and xanthine oxidase (XO) are α-gal glycosylated. The role of xanthine oxidase seems to be prevalent since it is highly recognized by both the anti-α-gal antibody and AGS patient sera. The results obtained in this study provide novel insights in the characterization of α-Gal carrying glycoproteins in bovine milk, supporting the possibility that milk, especially in its whole form, may give reactions in AGS patients. Although additional factors are probably associated with the clinical manifestations, the avoidance of milk and milk products should be considered in individuals with AGS showing symptoms related to milk consumption. |
Molecular Nutrition & Food Research.:2300796. | milk; dairy; milk fat globule proteins (MFGPs); butyrophillin, lactadherin, and xanthine oxidase (XO) |
| Aiuto B, Cirrincione S, Gosso E, Brussino L, Cavallarin L, Giuffrida MG, Rossi AM, Portesi C, Lamberti C. | 2024 | Study of α-gal glycosylation of cow's milk proteins and allergological implications. |
InALLERGY 2023 Dec 1 (Vol. 78, pp. 60-61). 111 RIVER ST, HOBOKEN 07030-5774, NJ USA: WILEY. | milk; dairy; protein |
| Akarsu A, Soyer O, Sekerel BE. | 2020 | Hypersensitivity Reactions to Biologicals: from Bench to Bedside. Purpose of Review: Biologic agents are new treatment options for chronic inflammatory diseases and cancers. As a result of their unique mechanism of action, they are more effective and less toxic treatment option and their clinical usage is increasing. While they are more commonly used, various adverse effects have been observed including life-threatening ones, including anaphylaxis. The aim of this review is to distinguish the anaphylaxis from other hypersensitivity reactions (HSR) and provide a management algorithm for the anaphylactic reactions induced by biological agents. Recent Findings: Many case reports and series have been published regarding anaphylaxis and other hypersensitivity reactions (concerning cytokine release syndrome, acute infusion–related reactions) due to biologic agents. Although acute treatment of HSR varies according to the clinical presentation, desensitization with the drug is the major management option for subsequent administrations in the case of anaphylactic reactions. . Summary: Anaphylaxis and other immediate onset hypersensitivity reactions are occasionally difficult to differentiate from each other, and mixed-type reactions may be observed. Immediate management of anaphylaxis includes discontinuation of infusion, immediate administration of adrenaline, antihistamines, corticosteroids, and other treatment options depending on the symptoms. After 30–120 min of the reaction, a blood sample for serum tryptase levels should be obtained and after 4–6 weeks skin testing with the culprit drug should be performed for decision of long-term management via either graded challenge or desensitization. |
Current Treatment Options in Allergy. 2020 Jan 18:1-3. | review article; biologic; biological agent; mAb; monoclonal antibody; pharmacy; pharmaceutical |
| Akella K, Patel H, Wai J, Roppelt H, Capone D. | 2017 | Alpha Gal-Induced Anaphylaxis to Herpes Zoster Vaccination. INTRODUCTION: Reported incidence of tick borne illness has progressively risen over the last decade. Galactose-alpha-1,3- galactose (alpha gal) allergy is a novel presentation of a tick borne illness induced by the Lone Star Tick, which is a well known vector for ehrlichiosis, tularemia, and Southern Tick-associated Rash Illness (STARI). Individuals with tick borne illnesses in the Lone Star Tick distribution of southern, midwestern and northeastern states are at greater risk for developing this condition. Three major hypotheses exist to describe how ticks might induce an IgE response through transmission of alpha gal: 1) alpha gal may be a component of tick saliva, 2) alpha gal may be residual from prior blood meal, and 3) alpha gal may be transmitted through commensal organism transmission. Clinical presentation of alpha gal allergy includes gastrointestinal symptoms, itching and urticaria, and delayed anaphylaxis. There has been one prior report of alpha gal induced anaphylaxis after administration of herpes zoster vaccination in the literature. We describe a second, unique presentation of this allergic condition observed at our institution. CASE PRESENTATION: A 73 year old female with a past medical history of hypertension, chronic hepatitis C, and alpha gal allergy presented to our Emergency Department for near syncope after epinephrine administration for upper lip, mouth and tongue swelling experienced 45 minutes after obtaining her herpes zoster vaccination. Review of the vaccination contents revealed use of porcine gelatin - a meat product felt to have induced an IgE response in the setting of alpha gal allergy. The patient was admitted, managed with intravenous fluids, and discharged the following morning. DISCUSSION: To increase physician awareness of alpha gal allergy and increased incidence in populations exposed to tick-borne diseases. We suggest avoiding administering the herpes zoster vaccine in patients with a history of a tick borne illness. CONCLUSIONS: Alpha gal allergy is a relatively novel presentation of tick borne illness induced by the Lone Star Tick - commonly found in the southern, midwest and northeastern United States. We report an unusual case of alpha gal allergy with anaphylaxis induced by herpes zoster vaccination due to use of porcine gelatin. |
Chest. 2017 Oct 1;152(4):A6. | pharmacy; vaccination; vaccine; herpes zoster; primary care; management |
| Altman MO, Gagneux P. | 2019 | Absence of Neu5Gc and presence of anti-Neu5Gc antibodies in humans—an evolutionary perspective. The glycocalyx of human cells differs from that of many other mammals by the lack of the sialic acid N-glycolylneuraminic acid (Neu5Gc) and increased abundance of its precursor N-acetylneuraminic acid (Neu5Ac). Most humans also have circulating antibodies specifically targeting the non-human sialic acid Neu5Gc. Recently, several additional mammalian species have been found to also lack Neu5Gc. In all cases, loss-of-function mutations in the gene encoding the sialic acid-modifying enzyme CMAH are responsible for the drastic change in these species. Unlike other glycan antigens, Neu5Gc apparently cannot be produced by microbes, raising the question about the origin of these antibodies in humans. Dietary exposure and presentation on bacteria coating themselves with Neu5Gc from the diet are distinct possibilities. However, the majority of the non-human species that lack Neu5Gc do not consume diets rich in Neu5Gc, making it unlikely that they will have been immunized against this sialic acid. A notable exception are mustelids (ferrets, martens and their relatives) known for preying on various small mammal species rich in Neu5Gc. No studies exist on levels of anti-Neu5Gc antibodies in non-human species. Evolutionary scenarios for the repeated, independent fixation of CMAH loss-of-function mutations at various time points in the past include strong selection by parasites, especially enveloped viruses, stochastic effects of genetic drift, and directional selection via female immunity to paternal Neu5Gc. Convergent evolution of losses of the vertebrate-specific self-glycan Neu5Gc are puzzling and may represent a prominent way in which glycans become agents of evolutionary change in their own right. Such change may include the reconfiguration of innate immune lectins that use self-sialic acids as recognition patterns. |
Frontiers in immunology. 2019 Apr 30;10:789. | glycan antigen; xenoglycan; sialic acid; Neu5Gc; Neu5Ac; carbohydrate; evolution |
| Altmann F. | 2016 | Coping with cross-reactive carbohydrate determinants in allergy diagnosis. A relevant proportion of allergy diagnosis is accomplished by in vitro determination of specific immunglobulin E (sIgE) to extracts from suspected allergens. Such extracts inevitably contain glycoproteins, which may react with patients’ IgE. In the case of plant and insect allergens, the relevant epitope structure is an alpha-1,3-fucose on the Asn-linked sugar residue of so-called N-glycans. Due to their wide distribution, N-glycans carrying this epitope are known as “cross-reactive carbohydrate determinant(s)” (CCD[s]). About 15 years of awareness allow the conclusion that anti-CCD IgE does not cause noticeable clinical symptoms. In consequence, diagnostic results arising from CCD reactivity must be rated as false positives. With up to 30 % of CCD reactive patients, this can be regarded as a serious problem. Another cross-reactive carbohydrate determinant became notorious as a potential cause of anaphylactic reactions to a recombinant glycoprotein drug carrying alpha-1,3-galactose. This galactose-containing determinant (GalCD, galactose containing cross-reactive carbohydrate determinant) was supposed as a trigger for delayed allergic reactions to red meat in several cases. Thus, alpha-1,3-galactose may have clinical relevance in certain cases – possibly as a result of tick bites. Often, however, GalCDs probably cause false-positive results with milk and meat extracts. No clear evidence for the role of other non-human carbohydrate structures such as N-glycolylneuraminic acid as CCD has been presented so far. Remedies for sIgE based in vitro diagnosis come in the form of non-glycosylated recombinant allergen components or of specific CCD inhibitors. The high potential of recombinant allergens is optimally realized in the context of component resolved diagnosis using allergen arrays with more than 100 components, whereas CCD inhibitors increase the specificity of conventional extract-based diagnosis. Reagents for the detection and inhibition of CCDs from plants and insects have been developed, whereas tools for GalCDs of milk and meat lag behind. |
Allergo journal international. 2016 Jun 1;25(4):98-105. | cross-reactive carbohydrate determinant; CCD |
| Altmann F. | 2007 | The role of protein glycosylation in allergy. The asparagine-linked carbohydrate moieties of plant and insect glycoproteins are the most abundant environmental immune determinants. They are the structural basis of what is known as cross-reactive carbohydrate determinants (CCDs). Despite some structural variation, the two main motifs are the xylose and the core-3-linked fucose, which form the essential part of two independent epitopes. Plants contain both epitopes, insect glycoproteins only fucose. These epitopes and other fucosylated determinants are also found in helminth parasites where they exert remarkable immunomodulatory effects. About 20% or more of allergic patients generate specific anti-glycan IgE, which is often accompanied by IgG. Even though antibody-binding glycoproteins are widespread in pollens, foods and insect venoms, CCDs do not appear to cause clinical symptoms in most, if not all patients. When IgE binding is solely due to CCDs, a glycoprotein allergen thus can be rated as clinical irrelevant allergen. Low binding affinity between IgE and plant N-glycans now drops out as a plausible explanation for the benign nature of CCDs. This rather may result from blocking antibodies induced by an incidental ‘immune therapy’ (‘glyco-specific immune therapy’) exerted by everyday contact with plant materials, e.g. fruits or vegetables. The need to detect and suppress anti-CCD IgE without interference from peptide epitopes can be best met by artificial glycoprotein allergens. Hydroxyproline-linked arabinose (single β-arabinofuranosyl residues) has been identified as a new IgE-binding carbohydrate epitope in the major mugwort allergen. However, currently the occurrence of this O-glycan determinant appears to be rather restricted. |
International archives of allergy and immunology. 2007;142(2):99-115. | Glycan antigen; xenoglycan; sialic acid; Neu5Gc; Neu5Ac; carbohydrate |
| Altomari C, Candido K, Uchi J, Shah S. | 2025 | Role of Omalizumab in Alpha-gal Syndrome Based on Social Media Reports. |
Journal of Allergy and Clinical Immunology. 2025 Feb 1;155(2):AB103. | |
| Altrich ML, Blum SP, Foster SM. | 2015 | Delayed Anaphylaxis to Mammalian Meat: A Fascinating Disease and Captivating Story. Delayed anaphylaxis to mammalian meat is a newly recognized IgE-mediated syndrome associated with Lone Star tick bites. IgE-mediated anaphylaxis classically occurs within one hour of exposure to the allergen, which is typically a protein epitope. However, in this disease, circulating antibodies to a carbohydrate, alpha-gal (galactose-alpha-1,3-galactose), stimulate the anaphylactic cascade with hives, diarrhea, abdominal cramps, respiratory distress and anaphylactic shock developing after ingestion of beef, pork or lamb meat. The delayed onset of symptoms three to six hours after ingestion of meat is unique. Recognition and understanding of this disease is important for treating and educating patients with suggestive symptoms. Avoidance of red meat is the recommended therapy. |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB37. | North America; United States; prevalence |
| Altshuler E, Krikpatrick J, Aryan M, Miralles F. | 2021 | Mammalian meat allergy emerges after tick bite: the alpha-gal syndrome. Alpha-gal syndrome (AGS) is a hypersensitivity reaction to mammalian meat that develops after tick bite exposure. AGS was first described in 2009 and testing for the allergy has become available in the last decade. We report the case of a 56-year-old farmer with a history of frequent lone star tick bites who presented with a 7-year history of diffuse urticaria occurring hours after eating red meat. AGS is likely underdiagnosed because of the unusual presentation of the allergy, historic lack of available testing, and deficiency of physician knowledge about the condition. Recognition of AGS is important both to help alleviate symptom burden and to avoid iatrogenesis. Patients with AGS should not receive products containing mammalian products, such as cat-gut suture, porcine-derived heart valves, and bovine-derived vaccines. Patients with AGS may present in a variety of clinical environments and physicians of all kinds should be able to recognise the symptoms. |
BMJ Case Reports CP. 2021 Nov 1;14(11):e245488. | Florida |
| Alvarez-Perea A, Caralli ME, Zubeldia JM, Baeza ML. | 2014 | Pork-cat syndrome as a cause of occupational asthma. We report the case of a 30-year-old woman with a family history of atopy. At the age of 13, soon after receiving a cat, she began to experience perennial ocular and nasal symptoms, as well as cough, wheeze, and dyspnea, all of which worsened in spring. At age 14, she was diagnosed with allergic rhinoconjunctivitis and mild intermittent asthma caused by pollen and dander. Her allergy improved when the cat was removed, and symptoms remained limited to mild rhinoconjunctivitis in springtime, although she still had mild asthma throughout the year when practicing sports. When she was 20, she started working at a grocery store selling cured meats. One of her duties was to cut pork bones (cured and cooked ham). From that point, her rhinoconjunctivitis worsened and her asthma attacks resumed. These manifestations were exacerbated at her workplace, especially when she had to cut pork bones. Her asthma continued to deteriorate, and she experienced 3-4 exacerbations per year that forced her to be absent from work. She frequently needed aerosol therapy after work, although she felt better on days off work and was almost asymptomatic during vacations. In 2010-2011, she was admitted to hospital on 4 occasions, forcing her to miss work for 1-2 months each time. Her asthma was controlled with oral corticosteroids. |
J Investig Allergol Clin Immunol. 2014 Jan 1;24(3):192-211. | airborne reactions; pork-cat syndrome; occupational medicine |
| Amoah AS, Asuming-Brempong EK, Obeng BB, Versteeg SA, Larbi IA, Aryeetey Y, Platts-Mills TA, Mari A, Brzezicka K, Gyan BA, Mutocheluh M. | 2018 | Identification of dominant anti-glycan IgE responses in school children by glycan microarray. Letter to the editor In helminth-endemic areas, elevated levels of cross-reactive IgE to environmental and food allergens are often seen that do not translate into positive skin prick test results or allergy symptoms. 1 Among Ghanaian children, such cross-reactivity was shown to be associated with Schistosoma haematobium infection and dominated by high IgE against cross-reactive carbohydrate determinants (CCDs). 2 The specific carbohydrate motifs involved in this IgE recognition were not determined. |
Journal of Allergy and Clinical Immunology. 2018 Mar 1;141(3):1130-3. | |
| Andrade AL, Riccetto AG, Vilela MM, de Oliveira DN, Catharino RR, Nolasco da Silva MT. | 2018 | Anaphylactic reaction to galactose‐derived oligosaccharide residues from lactose used as a drug excipient. Inhaled steroids are currently the most widely used and recommended medicines for the management of persistent asthma because of their high local and anti-inflammatory efficacy.1 There are three main presentations of the drug: aerosol spray (hydrofluoroalkane – HFA - as a propellant), liquid solution and dry powder inhaler. Dry powder devices are often preferred over HFA sprays in patients over 6 years of age, both for environmental issues and for the intrinsic advantages of the technique, such as ease of use and greater uptake and metabolism of the drug.1,2 This article is protected by copyright. All rights reserved. |
Pediatric Allergy and Immunology. 2018 Mar 1;29(2):207-10. | |
| Anemüller W, Mohr M, Brans R, Homann A, Jappe U. | 2018 | Alpha-Gal-assoziierte verzögerte Anaphylaxie gegen rotes Fleisch als Berufskrankheit. Bei einem 30-jährigen Koch mit rezidivierenden verzögerten Angioödemen konnte anamnestisch und laborexperimentell als Ursache die Sensibilisierung gegen das Kohlenhydratepitop Galactose-alpha-(1,3)-Galactose (alpha-Gal) aufgedeckt werden. Mit der Diagnose einer verzögerten Anaphylaxie bei Sensibilisierung gegen alpha-Gal erfolgte aufgrund des beruflichen Bezuges die Meldung an die Berufsgenossenschaft mittels Hautarztbericht BK 5101. Hierauf wurde dem Patienten fristlos gekündigt. Als Konsequenz zeigten wir eine Berufskrankheit an. Diese Kasuistik stellt die Bedeutung der unterdiagnostizierten, potenziell lebensbedrohlichen Allergie gegen das Disaccharid alpha-Gal des roten Fleisches als Berufskrankheit dar. English translation: Alpha-gal associated delayed red meat anaphylaxis as an occupational disease In a 30-year-old chef with recurrent delayed angioedema history as well as the experimental detection of IgE antibodies to galactose-alpha (1,3) -galactose (alpha-gal) pointed to alpha gal as the causative agent. The diagnosis, therefore, was delayed by anaphylaxis due to alpha-gal. Because of the potential relationship to his profession, we have submitted a dermatologist's report BK 5101 to the liability and insurance association, whereupon his contract of employment without notice. As a result, we reported an occupational disease. This case demonstrates underdiagnosed, potential life-threatening allergy to the disaccharide alpha gal in red meat as to occupational disease. |
Der Hautarzt; Zeitschrift fur Dermatologie, Venerologie, und verwandte Gebiete. 2018 Oct;69(10):848-52. | Anemuller; occupational medicine; chef |
| Angiolillo A, Gandaglia A, Arcaro A, Carpi A, Gentile F, Naso F, Di Costanzo A. | 2021 | Altered Blood Levels of Anti-Gal Antibodies in Alzheimer’s Disease: A New Clue to Pathogenesis?. Alzheimer’s disease is a neurodegenerative disorder whose pathological mechanisms, despite recent advances, are not fully understood. However, the deposition of beta amyloid -peptide and neuroinflammation, which is probably aggravated by dysbiotic microbiota, seem to play a key role. Anti-Gal are the most abundant xenoreactive natural antibodies. They are supposed to stem from immunization against the gut microbiota and have been implicated in the pathogenesis of several diseases, including multiple sclerosis. These antibodies target the alpha-Gal epitope, expressed on the terminal sugar units of glycoprotein or glycolipid of all mammals except apes, Old World monkeys and humans. The alpha-Gal is constitutively expressed in several bacteria constituting the brain microbiota, and alpha-Gal-like epitopes have been detected in gray matter, amyloid plaque, neurofibrillary tangles and corpora amylacea of the human brain, suggesting a potential link between anti-Gal and Alzheimer’s disease etiopathogenesis. For the first time, our study searched for possible alterations of anti-Gal immunoglobulin levels in Alzheimer’s disease patients. IgG and IgM blood levels were significantly lower, and IgA significantly higher in patients than in healthy subjects. These results suggest that such immunoglobulins might be implicated in Alzheimer’s disease pathogenesis and open new scenarios in the research for new biomarkers and therapeutic strategies. |
Life. 2021 Jun;11(6):538. | Brain; Alzheimer's; anti-gal; autoimmune |
| Ankersmit HJ, Copic D, Simader E. | 2017 | When meat allergy meets cardiac surgery: A driver for humanized bioprosthesis. Virginia cardiothoracic surgeons, recently described 2 patients who underwent implantation of a bioprosthetic aortic valve and postoperatively developed a meat allergy associated with a gal-specific IgE immune response. Both patients developed premature degeneration of their bioprosthesis that required reoperation and implantation of a mechanical valve in the aortic position.10 What can we learn as academic surgeons from this scientific story? (1) Big Pharma has not reacted to academic work to provide more durable gal-deficient bioprosthesis. Cardiac surgeons and cardiologists are continuing to implant valves that are known to induce a systemic immune response, leading to precocious degeneration. Furthermore, the uncritical lowering of age limits for biovalve replacement has severe consequences.11,12 (2) Academic research pertaining to the alpha-gal immune response in cardiac surgery is rather meek: A PubMed search in November 2016 with the key words ‘‘alpha-gal’’ and ‘‘valve’’ brought up only 40 citations. (3) Only the very avant-garde centers, such as the Hannover and Seoul Group, are trying to tackle this important question by means of detergent-based decellularization procedures13,14 or by using alpha-galactosidase.15 Tissueengineering research is ongoing in most academic centers of relevance, but commercial producers must instigate the manufacture of such ‘‘humanized’’ bioprostheses with potentially longer life spans. The first successful endeavors in that direction have been reported.16 Allergy and cardiac surgery do not particularly fit together, but in my opinion these ‘‘case insights’’ from patients with meat allergy with valve degeneration will lead to commercially available gal-deficient bioprostheses for future generations of patients with valve disease. Another speculation is that regulatory affairs in the European Union or the Food and Drug Administration in the United States will force the industry to provide such valves, and then ignorance will be overcome. The valve industry takes pride in being innovative at annual cardiac surgery meetings. Will we wait for another decade for action? |
The Journal of thoracic and cardiovascular surgery. 2017 Oct 1;154(4):1326-7. | cardiac surgery; cardiothoracic surgery; bioprosthetic heart valve |
| Apari P, Földvári G | 2022 | Tick bite induced α‐gal syndrome highlights anticancer effect of allergy. Tick bite induced α-gal syndrome (AGS) following consumption of mammalian meat is a recently described intriguing disease occurring worldwide. Here we argue that AGS and delayed allergy in general is an adaptive defence method against cancer. Our hypothesis synthesizes two lines of supporting evidence. First, allergy has been shown to have direct anti-cancer effects with unknown mechanism. Second, eating processed meat was shown to be linked to developing cancer. Humans lost their genes encoding molecules α-gal 30 MYA and Neu5Gc 2 MYA, the latter co-occurring with the start of using fire. These molecules are acquired from external sources, as tick bite for α-gal and mammalian meat for Neu5Gc, the latter accumulating in tumors. The resulting specific delayed allergic response is a molecular adaptation to fight cancer. By further testing and applying our hypothesis, new avenues in cancer research and therapy will open that might save lives and decrease human suffering. |
BioEssays. 2022 Jan;44(1):2100142. | cancer |
| Apostolovic D, Bigdeli N, Starkhammar M, van Hage M. | 2019 | Red meat allergic patients have specific TH2 derived cellular and humoral responses against Ixodes ricinus tick proteins supporting the link to alpha-gal allergy. | ALLERGY. 2019 Aug 1; 4: 155-156. | Europe; Sweden; vector; Ixodes ricinus |
| Apostolovic D, Grundström J, Kiewiet MB, Perusko M, Hamsten C, Starkhammar MH, Paulie S, van Hage M. | 2023 | Th2-skewed T cells correlate with B cell response to α-Gal and tick antigens in α-Gal syndrome. Tick bites have been shown to transmit a novel form of severe food allergy, the galactose-α-1,3-galactose (α-Gal) syndrome (AGS). Cellular responses to α-Gal in AGS patients have to date not been thoroughly scrutinized. Therefore, we investigated T and B cell proliferation, activation and cytokine profiles in response to tick protein extract (TE) and α-Gal-free TE in AGS patients and healthy controls. T and B cells from both patients and controls proliferated in response to TE, but significantly more in the patients. B cell proliferation, but not T cell proliferation, in AGS patients was reduced by removing α-Gal from the TE. In addition, TE induced a clear Th2 cytokine profile in AGS patients. Expression of CD23 by B cells correlated only to T cell proliferation. However, both B cell proliferation and CD23 expression were reduced when CD40L and IL-4 were blocked. A large proportion of the IgG1 and IgE antibodies binding TE in AGS patients were directed against the α-Gal epitope. We have for the first time investigated T and B cell responses to α-Gal carrying tick proteins in AGS patients, which will be essential for the understanding of the immune response against an allergenic carbohydrate transmitted by ticks. |
The Journal of Clinical Investigation. 2023 Jan 26. | cellular mechanisms; B cells; T cells |
| Apostolovic D, Krstic M, Mihailovic J, Starkhammar M, Velickovic TC, Hamsten C, van Hage M. | 2017 | Peptidomics of an in vitro digested a-Gal carrying protein revealed IgE-reactive peptides. The mammalian carbohydrate galactose-α1,3-galactose (α-Gal) causes a novel form of food allergy, red meat allergy, where patients experience severe allergic reactions several hours after red meat consumption. Here we explored gastric digestion of α-Gal glycoproteins using an in vitro model. Bovine thyroglobulin (BTG), a typical α-Gal carrying glycoprotein, was digested with pepsin. The resulting peptides were characterized by SDS PAGE, immunoblot and ImmunoCAP using sera from 20 red meat allergic patients. During pepsinolysis of BTG, a wide range of peptide bands was observed of which 14 to 17 kDa peptides remained stable throughout the gastric phase. The presence of the α-Gal epitope on the obtained peptides was demonstrated by an anti-α-Gal antibody and IgE from red meat allergic patients. The α-Gal digests were able to inhibit up to 86% of IgE reactivity to BTG. Importantly, basophil activation test demonstrated that the allergenic activity of BTG was retained after digestion in all four tested patients. Mass spectrometry-based peptidomics revealed that these peptides represent mostly internal and C-terminal parts of the protein, where the most potent IgE-binding α-Gal residues were identified at Asn1756, Asn1850 and Asn2231. Thus allergenic α-Gal epitopes are stable to pepsinolysis, reinforcing their role as clinically relevant food allergens. |
Scientific reports. 2017 Jul 12;7(1):1-0. | proteins; peptides; digestion; stability Sweden; Europe |
| Apostolovic D, Mihailovic J, Commins SP, Wijnveld M, Kazimirova M, Starkhammar M, Stockinger H, Platts-Mills TA, Cirkovic VT, Hamsten C, van Hage M. | 2020 | Allergenomics of the tick Ixodes ricinus reveals important alpha-Gal-carrying IgE-binding proteins in red meat allergy. Letter to the editor. |
Allergy. 2020 Jan;75(1):217. | Europe; Sweden; vectors; Ixodes ricinus; |
| Apostolovic D, Rodrigues R, Thomas P, Starkhammar M, Hamsten C, van Hage M. | 2018 | Immunoprofile of α‐Gal‐ and B‐antigen‐specific responses differentiates red meat‐allergic patients from healthy individuals. Background: The galactose--1,3-galactose (-Gal) epitope is involved in red meat allergy. As -Gal is structurally similar to the blood group B-antigen, we explored the relationship between the immune responses to -Gal- and the B-antigen in red meat-allergic patients compared to healthy A/O or B blood donors. Methods: Sera from 51 red meat-allergic patients IgE-positive to -Gal and 102 healthy blood donors (51 blood group A/O; 51 blood group B) were included. -Gal- and B-antigen-specific IgE (ImmunoCAP) and IgG/IgG (1-4) (ELISA) responses were determined. Basophil activation tests were performed. Results: Fifteen healthy donors were IgE positive to -Gal, of which 3 had blood group B. The allergic patients had significantly higher -Gal IgE levels compared to the healthy donors. The majority of the allergic patients, but none of the healthy donors, had IgE against the B-antigen. Inhibition studies revealed cross-reactivity between -Gal and the B-antigen. The biological activity of the B-antigen was confirmed by basophil activation tests. Anti--Gal IgG (1) and IgG (4) levels were significantly higher in the patients compared to the healthy donors. Moreover, the IgG response to the B-antigen was comparable between the allergic patients and healthy A/O donors. Conclusion: Red meat-allergic patients showed significantly higher -Gal IgE, IgG (1), and IgG (4) levels, reflecting a Th2 response, compared to healthy blood donors. Blood group B donors had significantly reduced antibody responses to -Gal, due to similarities with the B-antigen, resulting in a lower risk of sensitization to -Gal and development of red meat allergy. |
Allergy. 2018 Jul;73(7):1525-31. | Europe; Sweden; Blood group |
| Apostolovic D, Tran TA, Hamsten C, Starkhammar M, Cirkovic Velickovic T, van Hage M. | 2014 | Immunoproteomics of processed beef proteins reveal novel galactose-alpha-1,3-galactose-containing allergens. BACKGROUND: Red meat allergy presents a novel form of food allergy with severe delayed allergic reactions where IgE antibodies are directed against the carbohydrate alpha-Gal epitope. Food preparation and processing can influence the allergenicity of proteins. The aim of this study was to characterize the proteomic profile of different beef preparations and to investigate their alpha-Gal reactivity and potential allergenicity. METHODS: Extracts from raw, boiled, fried, and medium rare prepared beef were assessed by 2D PAGE for the comparison of protein profiles. IgE-binding proteins were identified using immunoblot-coupled proteomic analysis using sera from red meat-allergic patients. Presence of the alpha-Gal epitope was verified using anti-alpha-Gal antibody and IgE inhibition immunoblot with alpha-Gal. RESULTS: Multiple IgE-binding proteins were detected in the different beef preparations, many of which were also recognized by the anti-alpha-Gal antibody. Protein spots reacting with IgE in patient sera were analyzed by MS/MS, resulting in identification of 18 proteins with high identification scores. Seven of the 18 beef allergens identified using meat-allergic patient sera were also recognized by the anti-alpha-Gal monoclonal antibody, and four of them were stabile to thermal treatment. Furthermore, a dose-dependent inhibition of red meat-allergic patients' IgE to beef by alpha-Gal was demonstrated. CONCLUSIONS: We show that the alpha-Gal epitope is commonly present in IgE-reactive beef proteins recognized by meat-allergic patients. Seven novel alpha-Gal-containing IgE-binding proteins were identified, of which four were stable to heat treatment. Thus, the allergenicity of red meat proteins is preserved even upon different thermal cooking. |
Allergy. 2014 Oct;69(10):1308-15. | Europe; Sweden; proteins; beef; cooking; thermal stability; |
| Apostolovic D, Tran TA, Sánchez‐Vidaurre S, Cirkovic Velickovic T, Starkhammar M, Hamsten C, van Hage M. | 2015 | Red meat allergic patients have a selective IgE response to the α-Gal glycan. Galactose-alpha-1,3-galactose (alpha-Gal) is a mammalian carbohydrate with significance in a novel type of food allergy. Patients with IgE against alpha-Gal report severe allergic symptoms 3-6 h after consumption of red meat. We investigated whether IgE from red meat allergic patients recognizes other mammalian glycans than alpha-Gal or glycans from the plant kingdom and insects of importance in allergy. We found that none of the 24 red meat allergic patients investigated had an IgE antibody response against the other abundant mammalian glycan N-glycolylneuraminic acid or against cross-reactive carbohydrate determinants from plant or venom sources (nCup a 1, nArt v 1, and MUXF3). Deglycosylation of an alpha-Gal-containing protein, bovine thyroglobulin, significantly reduced the IgE response. In conclusion, we show that red meat allergic patients have a selective IgE response to the alpha-Gal glycan found in red meat. Other common glycans reactive in allergic disease are not targets of red meat allergic patients' IgE. |
Allergy. 2015 Nov;70(11):1497-500. | Europe; Sweden; Sanchez-Vidaurre; glycan; cross-reactive carbohydrate determinant; Neu5Gc; N-glycolylneuraminic acid |
| Apostolovic D, Tran TA, Starkhammar M, Sánchez-Vidaurre S, Hamsten C, Van Hage M. | 2016 | The red meat allergy syndrome in Sweden. In the last decade, a novel type of food allergy presenting with severe allergic reactions several hours after consumption of red meat has been recognized. The allergic responses are due to IgE antibodies directed against the carbohydrate epitope galactose-α-1,3-galactose (α-Gal) found in mammalian meat. This review presents the red meat allergy syndrome in Sweden, discusses the features of the immune response to carbohydrates, and highlights the presence of heat stable α-Gal-containing proteins in meat. The number of diagnosed red meat allergy cases in Sweden has increased significantly over the past few years. All patients have been tick bitten. Our recent work has shown that α-Gal is present in the European tick Ixodes ricinus (I. ricinus), thus potentially explaining the strong association between anti-α-Gal IgE and tick bites, with development of red meat allergy as a secondary phenomenon. Further studies using immunoproteomics have identified novel α-Gal-containing meat proteins that bound IgE from red meat allergic patients. Four of these proteins were stable to thermal processing pointing to the fact that the allergenicity of red meat proteins is preserved in cooked meat. In keeping with the fact that the α-Gal epitope is structurally related to the blood group B antigen, a positive association with the B-negative blood groups among our red meat allergic patients was noted. A selective IgE reactivity to the pure carbohydrate moiety was observed when investigating the specificity of the α-Gal immune response. IgE from red meat allergic patients does not recognize the other major mammalian carbohydrate, N-glycolylneuraminic acid (Neu5Gc), also present in high amounts in red meat. Furthermore, neither common cross-reactive carbohydrate determinants (CCDs) from plants nor venoms are targets of the IgE response in these patients. . Taken together, the α-Gal carbohydrate has shown to be a potentially clinically relevant allergen that should be taken into account in the diagnosis of food allergy. Many new findings in the field of red meat allergy have been obtained during the past years, but further efforts to understand the process of digestion, absorption, and delivery of α-Gal-containing molecules to the circulation are needed. |
Allergo Journal. 2016 Mar 1;25(2):29-34. | Europe; Sweden; Sanchez-Vidaurre; review article; Europe; Scandanavia; Sweden |
| Araujo RN, Franco PF, Rodrigues H, Santos LC, McKay CS, Sanhueza CA, Brito CR, Azevedo MA, Venuto AP, Cowan PJ, Almeida IC, Finn MG, Marques MF. | 2016 | ** Amblyomma sculptum tick saliva: alpha-Gal identification, antibody response and possible association with red meat allergy in Brazil. The anaphylaxis response is frequently associated with food allergies, representing a significant public health hazard. Recently, exposure to tick bites and production of specific IgE against α-galactosyl (α-Gal)-containing epitopes has been correlated to red meat allergy. However, this association and the source of terminal, non-reducing α-Gal-containing epitopes have not previously been established in Brazil. Here, we employed the α-1,3-galactosyltransferase knockout mouse (α1,3-GalT-KO) model and bacteriophage Qβ-virus like particles (Qβ-VLPs) displaying Galα1,3Galβ1,4GlcNAc (Galα3LN) epitopes to investigate the presence of α-Gal-containing epitopes in the saliva of Amblyomma sculptum, a species of the Amblyomma cajennense complex, which represents the main tick that infests humans in Brazil. We confirmed that the α-1,3-galactosyltransferase knockout animals produce significant levels of anti-α-Gal antibodies against the Galα1,3Galβ1,4GlcNAc epitopes displayed on Qβ-virus like particles. The injection of A. sculptum saliva or exposure to feeding ticks was also found to induce both IgG and IgE anti-α-Gal antibodies in α-1,3-galactosyltransferase knockout mice, thus indicating the presence of α-Gal-containing epitopes in the tick saliva. The presence of α-Gal-containing epitopes was confirmed by ELISA and immunoblotting following removal of terminal α-Gal epitopes by α-galactosidase treatment. These results suggest for the first known time that bites from the A. sculptum tick may be associated with the unknown etiology of allergic reactions to red meat in Brazil. |
International journal for parasitology. 2016 Mar 1;46(3):213-20. | Latin America; Brazil; vectors; tick species; Amblyomma sculptum; tick saliva |
| Archer-Hartmann SA, Crispell G, Karim S, Dharmarajan G, Azadi P. | 2018 | Tick Bites and Hamburgers: N-Glycosylation analysis of saliva and salivary glands from the ticks responsible for Alpha-Gal Syndrome. | GLYCOBIOLOGY. 2018 Dec 1; 28(12):1080-1081. | vectors; tick saliva |
| Arkestål K, Sibanda E, Thors C, Troye-Blomberg M, Mduluza T, Valenta R, Grönlund H, van Hage M. | 2011 | Impaired allergy diagnostics among parasite-infected patients caused by IgE antibodies to the carbohydrate epitope galactose-α-1,3-galactose. BACKGROUND: The carbohydrate epitope galactose-alpha 1,3-galactose (alpha-Gal) is abundantly expressed on nonprimate mammalian proteins. We have recently shown that alpha-Gal is responsible for the IgE binding to cat IgA, a newly identified cat allergen (Fel d 5). OBJECTIVE: We sought to investigate the diagnostic relevance of IgE antibodies to Fel d 5 and alpha-Gal among parasite-infected patients from central Africa without cat allergy compared with patients with cat allergy from the same region. METHODS: Sera from 47 parasite-infected patients and 31 patients with cat allergy were analyzed for total IgE and IgE antibodies against cat dander extract (CDE) by using the ImmunoCAP system. Inhibition assay was performed with alpha-Gal on solid phase-bound CDE. The presence of IgE specific for the major cat allergen Fel d 1, Fel d 5, and alpha-Gal was analyzed by means of ELISA. RESULTS: Among the 47 parasite-infected patients, 85% had IgE antibodies against alpha-Gal (OD; median, 0.175; range, 0.102-1.466) and 66% against Fel d 5 (OD; median, 0.13; range, 0.103-1.285). Twenty-four of the parasite-infected patients were sensitized to CDE, and 21 of them had IgE antibodies to Fel d 5 and alpha-Gal. There was no correlation between IgE levels to CDE and rFel d 1 among the parasite-infected patients but a strong correlation between CDE and Fel d 5 and alpha-Gal (P < .001). Among the group with cat allergy, only 5 patients had IgE to alpha-Gal, and nearly 75% (n = 23) had IgE to rFel d 1 (median, 7.07 kU(A)/L; range, 0.51-148.5 kU(A)/L). In contrast, among the patients with cat allergy, there was a correlation between IgE levels to CDE and rFel d 1 (P < .05) but no correlation between CDE and Fel d 5 and alpha-Gal. CONCLUSION: IgE to alpha-Gal causes impaired allergy diagnostics in parasite-infected patients. Screening for IgE to rFel d 1 and other allergens without carbohydrates might identify patients with true cat sensitization/allergy in parasite-infested areas. |
Journal of Allergy and Clinical Immunology. 2011 Apr 1;127(4):1024-8. | Arkestal Gronlund; Africa; Zimbabwe; cat allergy; non-tick vector; parasite; helminth; geohelminth; Ascaris lumbricoides; Ascaris lumbricoides; Necator americanus; hookworm; Ancylostoma duodenaleschistosome; schistosomiasis |
| Armentia A, Martin-Gil FJ, Pascual C, Martin-Esteban M, Callejo A, Martinez C | 2006 | Anisakis simplex allergy after eating chicken meat. Background: Allergic reactions to food can be produced by contaminants that induce sensitization. Among these, Anisakis simplex can cause seafood infestation, and allergic symptoms (urticaria–angioedema, anaphylaxis, and asthma) can follow the eating or handling of affected fish. Although seafood is the principal source of human infections by this parasite, we have found allergic symptoms in 8 patients previously diagnosed as having A simplex sensitization after they ate chicken meat. Chicken feed usually has a high proportion of fishmeal, which might possibly be contaminated by this nematode. Objective: The aim of our study was to determine whether parasite proteins present in chicken meat could be responsible for the symptoms reported by these subjects. Methods: We carried out in vivo tests (prick, bronchial challenge, and double-blind placebo-controlled challenge with meat chicken) in these 8 patients. We performed immunoblotting using the sera from the 8 patients and controls in order to detect A simplex sensitization. We also investigated the presence of A simplex proteins in sera from chickens fed with fishmeal and in other sera from chickens fed only with cereals. We excluded sensitization to other chicken nematodes by serologic methods. Results: All 8 patients presented positive prick and challenges to A simplex. When we used serum from chickens fed with fishmeal as the antigen in blotting, patients 3, 4, 5, 6, 7, and 8 recognized a band of 16 kd, also obtained when using pools of fish–shellfish and A simplex larva. No detection was observed with sera from chickens fed with only cereals. Conclusion: We provide evidence, based on in vivo and in vitro tests, that subjects highly sensitized to A simplex can detect the presence of Anisakis species allergens in chicken meat. |
Journal of Investigational Allergology and Clinical Immunology. 2006 Jan 1;16(4):258. | Chicken diet |
| Armstrong P, Binder A, Amelio C, Kersh G, Biggerstaff B, Beard C, Petersen L, Commins S. | 2019 | Descriptive Epidemiology of Patients Diagnosed with Alpha-gal Allergy—2010–2019. Rationale: Alpha-gal allergy is an immunoglobulin E (IgE) mediated allergy to galactose-alpha-1,3-galactose (alpha-gal), a carbohydrate found in mammalian meat. Clinical presentation ranges from hives to anaphylaxis, and episodes typically occur 3–6 hours after ingestion of meat. Exposure to the Lone Star tick (Amblyomma americanum) has been implicated as the primary risk factor for developing alpha-gal allergy. Methods: We performed a retrospective, descriptive analysis of randomly selected patients with alpha-gal allergy, with at least one positive (IgE ≥ 0.1) test, who presented for care during 3/2010–3/2019. Data were collected through medical chart review and analyzed using SAS v9.4 (Cary, NC). Results: Of 100 patients, median age at onset was 53 years (IQR 42-60), 56% were female, and 95% reported Caucasian race. Pre-existing food allergies were rare. Nearly all (86, 97%) reported history of tick or chigger bite prior to onset. On average, patients experienced 3 episodes before diagnosis. Common symptoms included hives (63%), abdominal pain (39%), and nausea/vomiting (33%). The most commonly reported triggers were beef (42%), dairy (33%), pork (26%) and red meat (26%). Conclusions: Alpha-gal allergy occurs predominantly in Caucasian adults. Previously noted trends, such as report of tick bite, and lack of prior food allergies were also seen in this cohort. Hives is the most commonly reported symptom; however, gastrointestinal involvement remains prominent. Dairy was reported as a trigger in a larger proportion of patients than has been seen in other studies. Continued understanding of this condition is important for detection and clinical management. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB145. | CDC; epidemiology; symptoms; triggers; dairy; gastrointestinal; GI; gastroenterology |
| Arnold DF, Misbah SA. | 2008 | Cetuximab-induced anaphylaxis and IgE specific for galactose-alpha-1,3-galactose. TO THE EDITOR: Chung and colleagues (March 13 issue)1 found IgE antibodies to galactose-α-1,3-galactose in pretreatment serum samples from 17 of 25 patients who had hypersensitivity reactions to cetuximab, whereas IgE antibodies were found in only 1 of 51 patients who did not have a hypersensitivity reaction. If, as suggested, the presence of such antibodies in pretreatment samples is predictive of anaphylaxis, pretreatment testing would help in minimizing the risk of anaphylaxis associated with cetuximab. It would be important to know whether skin testing was done in the study patients, and if so, whether the results were concordant with the presence of IgE antibodies to cetuximab. |
The New England journal of medicine. 2008 Jun 1;358(25):2735-author. | biologics; biological agents; monoclonal antibody; mAb; cetuximab; |
| Arroyo A, Tourangeau, L. | 2015 | Regional anaphylaxis: Not so regional? A case of IgE antibodies to Alpha-Gal after tick bite in California. | ANNALS OF ALLERGY ASTHMA & IMMUNOLOGY. 2015 Nov 1; 115(5):A71-A71. | geography; distribution; West Coast; California; prevalence |
| Arthur CM, Zerra PE, Shin S, Wang J, Song X, Doering CB, Meeks S, Lollar P, Stowell SR. | 2021 | Non-Human Glycans Can Regulate Anti-FVIII Antibody Formation in Mice. |
Blood. 2021 May 21. | medical products; drugs, hemophilia; Recombinant Factor VIII (FVIII) |
| Asaumi T, Ebisawa M. | 2018 | How to manage food dependent exercise induced anaphylaxis (FDEIA). Purpose of review: In recent years, the number of reports on food-dependent exercise-induced anaphylaxis (FDEIA) has been increasing. This review aims to describe the standard management of FDEIA including provocation tests and identify the issues that remain unclear. Recent findings: Provocation tests with aspirin for FDEIA enable us to confirm the definitive diagnosis and to make differential diagnosis. In some cases, FDEIA symptoms can be induced by aspirin and the causative food without exercise. Exercise may only be an augmenting factor of FDEIA, similar to aspirin or alcohol. Summary: The mechanisms of FDEIA development remain unclear. It has been suggested that in FDEIA, exercise lowers the threshold of a food allergy. Further research is needed to elucidate the mechanism of FDEIA and to establish strategies for effective disease management. |
Current opinion in allergy and clinical immunology. 2018 Jun 1;18(3):243-7. | cofactor |
| Atkins J. | 2020 | Regulating the Impending Transformation of the Meat Industry:" Cultured Meat". |
J. Tech. L. & Pol'y. 2019;24:1. | Cultured meat; cell-based meat; law; legal; FDA; USDA |
| Atkinson C, Hatch, R. | 2018 | Resolution of galactose alpha 1-3 galactose (Alpha-Gal) anaphylaxis after tick and hooved meat avoidance. Introduction: Anaphylatic reactions to Alpha-Gal carbohydrate epitope commonly present in meat of hooved animals and are recognized as an important cause of delayed anaphylaxis. Tick bites appear to be a necessary cofactor in developing sensitization to Alpha-Gal. Case Description: Our patient is a 53-year-old female living in Oklahoma who presented to the clinic in 2011 with a two-year history of pruritis, hives, throat tightness, and facial swelling. Symptoms occurred at night after consuming corn or potato chips which had previously been tolerated. Prior to presentation, she had labs drawn which showed elevated counts to pork and beef. It was discovered that six hours after consuming meat she had these episodes and reported having tick bites from her dogs. Percutaneous tests with allergenic extracts showed minimal activity to fresh beef and lamb. Alpha-gal specific IgE was elevated at 65.8 kU/L and she was advised to avoid all meat products except poultry and fish. At four-month follow-up, she continued to avoid pork and beef without further events and had no new tick bites. She had her dogs and home treated for ticks and moved to a new house. At six years after presentation, she reintroduced small amounts of well cooked meat products without problems. Alpha-Gal specific IgE was 0.47 kU/L and continued to decline despite continued meat consumption. . Discussion: This case implies that, at least in this patient, both tick bites and meat exposure are necessary to maintain sensitization. Reintroducing the meat alone without tick exposure did not result in re-sensitization. |
Annals of Allergy, Asthma & Immunology. 2018 Nov 1;121(5):S117. | Oklahoma; vector; tick; sero-reversion |
| Atwal D, Safar AM, Govindarajan R, Makhoul I. | 2019 | Severe first infusion reaction related to cetuximab in cancer patients in Arkansas. Introduction: Cetuximab, a chimeric monoclonal antibody, is a commonly used anticancer drug that prevents binding of epidermal growth factor to epidermal growth factor receptor. It has been widely used in a variety of cancers since its initial approval by the FDA in 2004. Despite its efficacy, it has met with some genuine concerns especially regarding the anaphylactoid reactions occurring after first infusions. Cetuximab-related first infusion reaction has been found to be much more prevalent in the Southeastern United States with several studies from the southern United States supporting it. The purpose of our study was to determine the rate of first infusion reaction in the state of Arkansas and the factors that could predispose to first infusion reaction.Methods and results: We performed a retrospective chart review of consecutive patients who received cetuximab between January 2004 and December 2016 at the University of Arkansas for Medical Sciences. We included a total of 220 patients in our analysis out of which 32 (14.5%) developed cetuximab-related first infusion reaction. There was a statistically significant increased risk in males versus females (18.2% vs. 8.4%, P = 0.045) and trend toward significance for the difference between Caucasians and Blacks (16.5% vs. 7.1%, P = 0.054).Conclusion: There is increased incidence of cetuximab-related first infusion reaction in Arkansas which is much higher than the national average but comparable to the incidence in other neighboring states in the Southeastern United States. This increased incidence tends to cluster in Caucasian males. Safer alternatives should be preferred for treatment of cancers particularly in the Southeastern United States whenever possible. |
Journal of Oncology Pharmacy Practice. 2019 Jul;25(5):1130-4. | pharmacy; pharmaceutical; medication; biologic; biological agent; monoclonal antibody; mAb; cetuximab; demographics; race |
| Avila SA, Wojno T. | 2022 | Alpha-Gal Syndrome: A New Etiology for Periorbital Edema. Alpha-gal syndrome is characterized by an IgE-mediated hypersensitivity response to the carbohydrate galactose-alpha-1,3-galactose. It can manifest as both an immediate drug allergy to pharmaceuticals containing alpha-gal as well as a delayed hypersensitivity response to the ingestion of mammalian meat products. In the United States, sensitization to alpha-gal is thought to occur from tick bites and can cause severe angioedema, most commonly periorbitally and periorally, with high rates of anaphylaxis. We present a unique case of chronic periorbital edema in a carnivorous individual after acquiring a new red meat allergy from Alpha-Gal Syndrome. |
Ophthalmic Plastic and Reconstructive Surgery. 2022 Feb 15. | Ophthalmology; edema; nocturnal symptoms |
| Aykut B, Lim HK, Ngeve SM, Hoover A, Medina CK, Scherba J, Menken A, Overbey DM, Omer TM, Commins SP, Nellis JR. | 2024 | Perioperative Outcomes After Bioprosthetic Valve Replacement In Patients Sensitized To Alpha-Gal. BACKGROUND: Alpha-gal syndrome (AGS) from tick bites, due to sensitivity to alpha-gal, can cause severe allergies. Heart valve implants contain alpha-gal, yet AGS screening isn't standard before valve replacement. This study examines perioperative outcomes in patients with alpha-gal antibodies. METHODS: This is a single-institution prospective cohort study of patients undergoing bioprosthetic aortic valve replacement between January 2022 and January 2023. Anti-alpha-gal IgE levels were measured, with primary outcomes being severe allergic reactions and in-hospital mortality, and secondary outcomes including ICU and hospital stay. RESULTS: Of 155 patients, 32.7% (n = 19) of surgical aortic valve replacement (SAVR) and 29.9% (n = 29) of transcatheter aortic valve replacement (TAVR) patients had detectable IgE levels without subsequent serious allergic reactions or in-hospital mortality. Postoperative hospital stay and valve function were similar across groups. CONCLUSIONS: In this study, sensitization to alpha-gal was not associated with serious allergic reactions and did not affect immediate aortic valve function after SAVR or TAVR |
Annals of Thoracic Surgery Short Reports. 2024 Jul 26. | Cardiac surgery; cardiothoracic surgery; bioprosthetic heart valve |
| Azmi S, Marinho S, Liau J, Tsoumani M. | 2021 | Three cases of red meat allergy due to alpha-gal sensitisation in the UK. |
InCLINICAL AND EXPERIMENTAL ALLERGY 2021 Dec 1 (Vol. 51, No. 12, pp. 1664-1665). 111 RIVER ST, HOBOKEN 07030-5774, NJ USA: WILEY. | Europe; United Kingdom; UK; England; Scotland |
| Babineau R, Daily RS. | 2024 | Climate Change, Vector Range, and Alpha-Gal in Psychiatric Practice. |
Psychiatric Times. Published October 22, 2024. | Psychiatric; psychological; mental health |
| Backer E, Carroll J. | 2016 | 1742: Delayed anaphylaxis following mammalian meat consumption: An Evolving vector-born process. Our patient is a 69-year-old male who presented with an anaphylactic reaction. He has no known allergies or co-morbidities. A history revealed consumption of steak 6 hours before symptom onset of generalized urticaria, angioedema and dyspnea. |
Critical Care Medicine. 2016 Dec 1;44(12):511. | Emergency medicine; critical care; first responder |
| Backer E, Carroll J. | 2016 | A Case of Unexplained Shock Following Steak Consumption. INTRODUCTION: Delayed anaphylaxis following red meat consumption is a novel phenomenon in the Southwestern United States. This presentation will illustrate a case of IgE mediated activity against the galactose-a-1,3-galactose (alpha-gal) epitope. This carbohydrate determinant is common in humans and isotope switching to alpha-gal IgE occurs following ectoparasite exposure. First described in 2009, early case reports led to identification of the Amblyomma americanum, or lone star tick, as the sensitizing exposure. We present the first reported case of anaphylaxis in New Hampshire from red meat consumption following alpha-gal sensitization. CASE PRESENTATION: Our patient is a 69-year-old male who presented with an anaphylactic reaction. He has no known allergies or co-morbidities. A history revealed consumption of steak 6 hours before symptom onset of generalized urticaria, angioedema and dyspnea. Treatment included anti-histamines, steroids, and epinephrine. It was later divulged he sustained a tick bite 5 weeks prior to this admission. Further work-up identified a total IgE of 129 kU/L and an elevated alpha-gal IgE of 10 kU/L (normal #0.34 kU/L). His history and serologic testing allowed us to confirm a diagnosis of delayed anaphylaxis due to a red meat allergy. He made a full recovery, and received follow-up in our Allergy clinic and counseling on red meat avoidance. DISCUSSION: IgE sensitization to the oligosaccharide alpha-gal following exposure to the lone star tick is described largely in the southeastern United States. After red meat ingestion, a delayed anaphylactic reaction may occur. The diagnosis should be suspected when caring for the patient with anaphylaxis of unclear etiology, and is confirmed using an IgE specific immunoassay. Treatment in the acute setting is supportive, and long-term care includes avoidance of mammalian meats and prevention of further tick exposure. CONCLUSIONS: This case demonstrates a vector-associated sensitivity leading to delayed anaphylaxis following consumption of mammalian meat. It is the first documented occurrence in our state, supporting the described geographic spread of the lone start tick. Practitioners should maintain this condition on their differential as it becomes increasingly recognized in non-endemic regions. |
Chest. 2016 Oct 1;150(4):1139A. | Northeast; New Hampshire; idiopathic anaphylaxis |
| Baczako A, Ollert M, Biedermann T, Darsow U. | 2015 | Recurrent anaphylaxis in an 18-year old-a case of alpha-gal allergy: 1196. No abstract available |
Not available | |
| Badami GD, Tamburini B, Mohammadnezhad L, Vaz-Rodrigues R, La Barbera L, de la Fuente J, Sireci G. | 2024 | Netosis and trained immunity in tick-borne diseases: a possible pathogenetic role. |
Cellular Immunology. 2024 Nov 1;405:104881. | pathogenesis; Europe; Italy |
| Truong L, Anis TR, Najibfard L, Peck E. | 2025 | Hypersensitivity Reaction After Administration of Crotalidae Polyvalent Immune Fab (CroFab). To our knowledge, this is the first case where a patient tolerated ANAVIP despite being allergic to CroFab. (Alpha-gal likely not the antigen involved) |
Clinical Pharmacology: Advances and Applications. 2025 Dec 31:25-8. | Medical products; antivenom; antivenin |
| Baduel E, Smilov M, Epelboin L. | 2025 | French Guiana and AGS: a path to uncovering hidden clues. Although fewer than 10 cases have been reported across Latin America, two case series involving 11 and 18 patients with AGS have been documented in French Guiana. Advancing AGS research in French Guiana could yield valuable epidemiological insights, as existing data predominantly stem from European, North American, Australian, and Japanese contexts - regions with comparatively lower diversity in tick species, their mammalian hosts, associated pathogens, and parasitic infestations. Additionally, French Guiana presents unique therapeutic scenarios, such as Viperidae envenomation and transfusions under inventory constraints, that merit further investigation. |
Expert Rev Clin Immunol. Published online March 10, 2025:1-13. | Latin America; French Guiana |
| Baker MG, Sampson HA. | 2018 | Phenotypes and endotypes of food allergy: A path to better understanding the pathogenisis and prognosis of food allergy. Key Messages • Proper identification of phenotypes and endotypes of IgE-mediated food allergy may allow for more meaningful investigation of underlying pathobiologic mechanisms that can ultimately improve our approach to treatment. • Both phenotype and endotype are determined by genotype, inherited epigenetic factors and environmental factors. • Proposed phenotypes and respective endotypes include: Classic (persistent, transient, food-dependent exercise-induced, NSAID-dependent, alcohol-dependent), Intermittent and Cross-Reactive, Aerosol Sensitization (local reactions to aerosolized cross reactant antigens, systemic reactions to aerosolized forms of food-specific antigens), α-Gal syndrome and Sensitized Nonreactive. • A formalized cluster analysis of patients with food allergy to refine phenotype and endotype identification remains an area of opportunity in our field. |
Annals of allergy, asthma & immunology: official publication of the American College of Allergy, Asthma, & Immunology. 2018 Mar;120(3):245. | |
| Bakhtiar M, Leong K, Kwok F, Hui M, Tang M, Joseph C, Bathumana‐Appan P, Nagum A, Yadzir ZHM, Murad, S. | 2017 | † P66: ALLERGIC REACTION TO BOVINE GELATIN COLLOID: THE ROLE OF IMMUNOGLOBULIN E TOWARDS GALACTOSE-ALPHA-1,3-GALACTOSE: IMPLICATIONS BEYOND RED MEAT ALLERGIES. Background: The bovine gelatin colloid is a recognised cause of adverse reactions, albeit uncommon. It is noteworthy that many patients with red‐meat‐derived gelatin allergy may have negative specific Immunoglobulin E (sIgE) antibody to the conventional red‐meat‐derived gelatin immunoassay. Bovine gelatin colloids have been shown to contain about 0.44 ± 0.2 mcg/g to 0.52 ± 0.1 mcg/g of galactose‐alpha‐1,3‐galactose (alpha‐gal). It has been demonstrated that sIgE towards the alpha‐gal moiety may cause life‐threatening anaphylactic reactions with wide ranging implications. Method: We describe three patients with an allergic reaction to bovine gelatin colloid who had positive skin test to Gelofusine and sIgE to alpha‐gal but negative sIgE to bovine gelatin. . Report: All three patients presented with suspected perioperative anaphylaxis. None of them had any history of asthma, allergic rhinitis, atopic eczema, drug, latex, cow’s milk and/or cat allergy. Two patients had history suggestive of beef allergy but none reported any allergy to gelatin containing food. They were all investigated via skin and in vitro tests after an eventful course of general anaesthesia. Skin testing to cetuximab was not performed due to costs consideration. All patients had a positive intradermal test to Gelofusine. Results for sIgE to bovine gelatin and alpha‐gal were negative (≤0.1 kU/L) and positive (range 0.25–14.8 kU/L) respectively, for all patients. Two patients had positive sIgE to beef, mutton and cow’s milk (range 0.26–1.22 kU/L). Cat dander sIgE was positive for one patient (0.12 kU/L). Total IgE was raised in all patients (range 214–1483 kU/L). Baseline tryptase level of all patients was not raised (range 3.73–4.98 μg/L). . Conclusion: It appears that the diagnosis of alpha‐gal‐related gelatin sensitisation and allergy may readily be missed by a conventional gelatin sIgE assay. Possibly, the allergenic target for the gelatin immunoassay does not include the alpha‐gal moiety. |
Internal Medicine Journal. 2017 Sep;47:24. | perioperative care; gelatin; gelatine; plasma volume expander; plasma volume substitute |
| Bandino ML, Gomez R, Waibel K. | 2013 | SAFETY OF ZOSTER LIVE VACCINE IN AN ADULT WITH alpha-GAL ALLERGY. No abstract available |
Annals of Allergy Asthma & Immunology 2018; 111 (5), A71-A71. | vaccination; vaccine; herpes zoster |
| Banner W, Edelen K, Epperson LC, Moore E. | 2024 | Hypersensitivity reactions due to North American pit viper antivenom administration and confirmed elevation of alpha-gal IgE.\> The two current antivenom products available in the United States (US) for North American pit viper envenomation include ovine-derived Crotalidae polyvalent immune Fab (FabAV, Crofab®) and equine-derived Crotalidae Immune (F(ab′)2, Anavip®). Both products contain the oligosaccharide, galactose-alpha-1,3-galactose (alpha-gal), and may lead to a hypersensitivity reaction commonly referred to as alpha-gal syndrome (AGS). We report two patients receiving antivenom for pit viper envenomation who developed anaphylactic reactions and had confirmed abnormal titers of alpha-gal-specific IgE. We suggest clinicians seek a history of red meat allergy and administer AV cautiously in endemic areas of AGS. |
Toxicology Communications. 2024 Dec 31;8(1):2314314. | medical products; antivenom; CroFab; snake bite |
| Bansal RA, Bahal S, O’Brien R, Miller J, Bansal AS, Yong PF. | 2021 | The first reported cases of meat allergy following tick bites in the UK. Allergic reactions frequently involve the production of immunoglobulin E (IgE) antibodies to proteins. However, reactions directed against carbohydrate moieties are increasingly being recognised. Tick bites can contribute to the development of immunoglobulin E to the galactose-1,3-galactose (alpha-gal) moiety on tick salivary proteins. These IgE molecules can cross-react with alpha-gal found in red meats, causing Type I IgE-mediated hypersensitivity reactions to these foods. We present three cases of delayed reactions to beef, pork and lamb in patients with prior tick bites and in the presence of a positive-specific IgE to alpha-gal. Patients were advised to avoid red meat consumption and to carry emergency treatment in the form of anti-histamines with or without adrenaline autoinjector devices. This is the first published report of red meat allergy caused by tick bites suffered in the UK |
JRSM open. 2021 Apr;12(4):2054270421996131. | Europe; UK |
| Barbaud A, Granel F, Waton J, Poreaux C. | 2011 | † How to manage hypersensitivity reactions to biological agents? Biological agents induce cutaneous adverse drug reactions (CADR) different from those observed with xenobiotics. Type alpha is the cytokine release syndrome, type beta are hypersensitivity reactions and type gamma is a cytokine imbalance syndrome. Infusion-reactions, anaphylactoid reactions occur with various biological agents administered intravenously. In non-severe cases the infusion rate has to be reduced, in severe reactions, the treatment must be stopped, and resuscitation carried out with corticosteroids and epinephrine. Reactions may be due to an alpha syndrome but a true allergy could be involved as demonstrated in some patients with IgE antibodies to the galactose-alpha-1,3-galactose portion of the cetuximab or anti infliximab-IgE. Some desensitisation protocols have been published. Non allergic itching and eczema-like lesions are frequent with epidermal growth factor receptor inhibitors. Rash or desquamation was observed in 40% of cases with antiangiogenic agents, 90% of patients treated with imatinib have rashes, oedema or pruritus and a non-allergic periorbital oedema. Severe CADR, such as Stevens-Johnson syndrome, can be provoked. Delayed readings of intradermal tests could be of value in managing patients with a maculopapular rash due to interferon. Anaphylaxis attributed to omalizumab seems to be rare (0.2%) and skin rashes occur in 7% of cases. Anaphylactoid reactions occur in 1% of patients treated with natalizumab. In the case of anti-natalizumab antibody-mediated reactions, treatment should be stopped. These allergic-like side effects of new biological agents must be known and reported to Pharmacovigilance agency networks. |
European Journal of Dermatology. 2011 Oct 1;21(5):667-74. | biologic; mAb; monoclonal antibody; biological agent |
| Bardash Y, Tham T, Olson C, Khaymovich J, Costantino P. | 2019 | Anaphylactoid hypersensitivity reaction from intra-arterial cetuximab: Clinical considerations and management. Intra-arterial infusion of drugs shows promising results in terms of safety and efficacy. Intra-arterial cetuximab, a monoclonal antibody treatment, is currently being tested for its use in head and neck cancers. We present the case of a 45-year-old Asian male who developed an anaphylactoid hypersensitivity reaction, manifesting itself in the form of bronchospasm, tachycardia, and hypotension, during intra-arterial infusion of cetuximab. The symptoms were quickly diagnosed, and the patient was treated accordingly. Despite the safety profile of cetuximab and the decreased risk of systemic effects with intra-arterial infusion versus intravenous infusion, severe hypersensitivity reactions are still a risk in intra-arterial cetuximab infusions. Consequently, proper planning and care must be taken to prophylactically prevent and in the case of a reaction, treat the reaction accordingly. The case presented herein is, to the best of our knowledge, the first recorded moderate-to-severe infusion reaction in a patient receiving intra-arterial cetuximab treatment for head and neck cancer. |
SAGE open medical case reports. 2019 Jan;7:2050313X18823447. | |
| Barreiro LB, Chervonsky A. | 2021 | My Old World chap, this α-gal is not for you. 30 million years ago, ancestors of Old World primates lost the ability to produce α-gal. In this issue of Cell Host & Microbe, Singh et al. (2021) show that the loss is associated with increased resistance to sepsis, but that this advantage comes alongside a cost of accelerated reproductive senescence. |
Cell Host & Microbe. 2021 Mar 10;29(3):315-7. | Evolution; catarrhine primates |
| Baumgart KW, Broadfoot AJ, Van Nunen SA. | 2019 | Sensitisation and sero-reversion to tick bite induced galactose-1,3-alpha-galactose, meat and dairy sensitisation in New South Wales, Australia. | Allergy. 2019 Aug; 74:509-509. | Asia; Aulstralia; sensitization; sero-reversion |
| Beaman MH. | 2018 | Non-infectious illness after tick bite. Tick bites are common and may have non-infectious complications. Reactions range from local reactions to systemic syndromes, tick paralysis, mammalian meat allergy and tick anaphylaxis. Management revolves around prevention with vector avoidance and immediate removal of the tick if bitten. Treatment of bite reactions is usually symptomatic only with antihistamines or corticosteroids. Adrenaline may be indicated for severe cases. |
Microbiology Australia. 2018 Nov 27;39(4):212-5. | Australia; tick paralysis; tick anaphylaxis |
| Beaudouin E, Thomas H, Nguyen-Grosjean VM, Picaud J, Moumane L, Richard C, Léon A, Jacquenet S, Sabouraud-Leclerc D, Renaudin JM, Barbaud A, Moneret-Vautrin DA. | 2015 | Allergie à galactose-α-1,3 galactose (α-Gal) : une observation singulière et revue bibliographique. Résumé Les auteurs rapportent une observation singulière induite par galactose-α-1,3 galactose (α-Gal) et se proposent de faire ainsi une revue bibliographique sur le sujet. English translation: Allergy to galactose-α-1,3 galactose (α-Gal): Case report and literature review. The authors report a singular case about mammalian meat anaphylaxis due to galactose-alpha-1,3 galactose (alpha-Gal) and review the current literature. |
REVUE FRANCAISE D ALLERGOLOGIE. 2015;55(7):492-7. | review article; Europe; France |
| Beauti S. | 2021 | Molecular Characterization of Tick Galectin in Context of α-Gal Syndrome. α-Gal Syndrome (AGS) is a tick-borne delayed hypersensitivity reaction that occurs 3-6 hours after red meat consumption. It is induced by oligosaccharide galactose-α-1,3-galactose (α-gal) found in the Lone Star tick, Amblyomma americanum, and all mammalian-derived foods. α-gal specific IgE (sIgE) antibodies are produced after α-gal transmission from the tick bite and activates after subsequent red meat consumption. Previously, an immune-affinity approach utilized α-Gal antibody to isolate and identify covalently linked tick saliva antigens to α-gal followed by Liquid Chromatography-tandem Mass Spectrometry (LS-MS/MS) analysis. The identified antigen included tick salivary Galectin, a carbohydrate-binding protein involved in many physiological functions such as inflammation and immune responses. The goal of this study is to characterize the A. americanum Galectin protein and its involvement in AGS. Our qRT-PCR results revealed decreased gene expression of Galectin in different stages of the bloodmeal. We utilized an RNA interference (RNAi) approach to silence Galectin gene expression and assessed the functional consequences of gene depletion on tick behavior, phenotype, and tick molting. The silencing of Galectin did not have a significant impact on α-gal. However, Galectin knockdown (KD) did cause a significant downregulation in galactose metabolism related genes. Galectin-silenced ticks showed impaired oviposition and increased microbial load. We are currently conducting experiments to further characterize the role of Galectin in microbial maintenance, galactose metabolism and reproductive development to determine possible links between Galectin and α-gal. |
Mississippi Undergraduate Honors Conference 2021 The Certainty of Uncertainty: Research in an Ever-Changing World. 2. | tick galectin |
| Bedolla-Barajas M, Morales-Romero J, Meza-Lopez C, Bedolla-Pulido TR, Mendoza-Solís W, Novelo-del Muro F, Juárez-Luna DI, Mendoza W, Juárez-Luna DI. | 2024 | Red Meat Hypersensitivity and Probable Alpha-Gal Syndrome: Prevalence Among Adolescents. Introduction. It is unknown whether late adolescents represent a particular risk group for the development of red meat hypersensitivity (RMH) and alpha-gal syndrome (AGS). This age group's physiological changes and eating habits could play a determining role. This study aimed to estimate the self-reported prevalence of RMH and probable AGS among late adolescents. Methods. A cross-sectional study analyzed a sample of 1992 Mexican adolescents between 15 and 18 years of age. The data were obtained with a previously validated questionnaire that asked about the clinical manifestations related to red meat intake. Confidence intervals at 95% (95% CI) were estimated for proportions. . Results. In total, there were 19 adolescents with RMH, a prevalence of 1.0% (95% CI: 0.6-1.5%). The main red meats related to symptoms were pork (89.5%), beef (21.1%), lamb (10.5%), and mutton (5.1%). The most frequent manifestations of RMH were gastrointestinal (73.7%), respiratory (63.2%), and cutaneous (63.2%). Once the symptoms were grouped, there were two cases of urticaria (2/19, 10.5%) and six cases with probable anaphylaxis (6/19, 31.6%). Finally, three adolescents were considered probable cases of AGS, which represents a prevalence of 0.15% (95% CI: 0.1-0.4%). Conclusion. Although the prevalence of RMH in late adolescents is low, early detection is justified because approximately one-third present with severe symptoms. |
Cureus. 2024 Mar 2;16(3). | North America; Mexico; adolescents |
| Behmer RG, Thomas RS, Jarawan HT. | 2022 | Urticarial Rash in a Patient with Alpha-Gal Syndrome Caused by Subcutaneous Heparin at Prophylactic Dosing: A Case Report. Introduction: We report a patient with a history of red meat allergy, or alpha-gal syndrome, who had an urticarial rash after exposure to unfractionated heparin at a dose typically used for prophylaxis of deep venous thrombosis. Although anaphylactic reactions have been reported with systemic intravenous heparin, we believe this case is the first report of an immunoglobulin E–mediated reaction to subcutaneous heparin at prophylactic dosing. > Clinical Findings: An 85-year-old male had a 3-year history of red meat allergy and was intolerant of pork and beef. He developed an immunoglobulin E–mediated allergic reaction to subcutaneous heparin at a dose of 5000 units twice daily. > Clinical Course: The patient presented to the emergency department after a fall. He had back pain and was diagnosed with a compression fracture. He was admitted to the hospital because he was unable to safely ambulate. He was treated with subcutaneous unfractionated heparin to prevent deep venous thrombosis as part of routine care. Twenty-four hours after exposure to heparin, he developed an urticarial rash. The rash resolved promptly after discontinuing heparin and excluding other potential allergic triggers. > Conclusions: In patients with alpha-gal syndrome, unfractionated heparin via a subcutaneous route at prophylactic dosing can precipitate immunoglobulin E–mediated systemic reactions and should be avoided. |
Journal of Maine Medical Center. 2022;4(2):9. | surgery; perioperative; medical products; heparin |
| Bellamy P, Sanderson WT, Winter K, Stringer JW, Kussainov N, Commins SP. | 2020 | Prevalence of Alpha-gal Sensitization among Kentucky Timber Harvesters and Forestry and Wildlife Practitioners. This study shows that persons in occupations such as timber harvesting and forestry and wildlife practitioners who encounter frequent exposure to ticks may have a high prevalence of sensitization to the sugar molecule galactose-α-1,3-galactose. Clinicians who treat patients in occupations with frequent exposure to ticks, or with mild to severe gastrointestinal reactions when they eat red meat, should assess sensitization to galactose-α-1,3-galactose. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 Dec 17. | |
| Beltrán-Cárdenas CE, Granda-Restrepo DM, Franco-Aguilar A, Lopez-Teros V, Arvizu-Flores AA, Cárdenas-Torres FI, Ontiveros N, Cabrera-Chávez F, Arámburo-Gálvez JG. | 2021 | Prevalence of Food-Hypersensitivity and Food-Dependent Anaphylaxis in Colombian Schoolchildren by Parent-Report. Background and objectives: The epidemiology of food allergy (FA) and food-dependent anaphylaxis remains unknown in Colombia. Our aim was to estimate by parent-report the prevalence of FA and food-dependent anaphylaxis in a Colombian population of schoolchildren. Materials and methods: A printed questionnaire was sent to parents of schoolchildren aged 5–12 years old from Medellín, Colombia in order to collect FA-related data. Results: Nine hundred and sixty-nine (969) parents returned the questionnaire with valid responses (response rate, 52.5%). The estimated prevalence rates (95% CI) were: adverse food reactions 12.79% (10.76–15.07), “perceived FA, ever” 10.93% (9.08–13.08), “physician-diagnosed FA, ever” 4.33% (3.14–5.81), “immediate-type FA, ever” 6.81% (5.30–8.58), “immediate-type FA, current” 3.30% (2.26–4.63), and food-dependent anaphylaxis 1.85% (1.10–2.92). The most frequently reported food allergens were milk (1.44%), fruits (0.41%), meat (0.41%), and peanut (0.3%). Sixty-one percent of “food-dependent anaphylaxis” cases sought medical attention, but only eleven percent of the cases reported the prescription of an epinephrine autoinjector. Conclusions: FA and food-dependent anaphylaxis are not uncommon among schoolchildren from Colombia. The prescription of epinephrine autoinjectors should be encouraged among health personnel for the optimal management of suspected cases of food-dependent anaphylaxis. Excerpts: "The main triggers of FA reactions in Colombian schoolchildren were milk, fruits, meat, and peanut." "Notably, the presence of 26 species of ticks of the genus Amblyomma has been reported in Colombia and at least 7 of these species are common in the Medellín area (on Antioquia department) [32]. However, a potential high prevalence of alpha-Gal sensitization or meat allergy due to the alpha-Gal allergenic epitope will require evaluations with objective diagnostic criteria. At the moment, our results highlight the need for future studies to evaluate alpha-gal sensitization in this population." |
Medicina. 2021 Feb;57(2):146. | Latin America; Colombia; Amblyomma |
| Benders-Guedj M, Köberle M, Hofmann H, Biedermann T, Darsow U. | 2023 | High-risk groups for alpha-gal sensitization. Background: Tick bite-induced IgE-mediated reactions to the oligosaccharide galactose α-1,3-galactose (alpha-gal) are increasingly recognized. This study investigated alpha-gal sensitization in three groups with different tick bite exposure. Materials and methods: Specific IgE antibodies to alpha-gal and total IgE were investigated in 485 patients with Lyme borreliosis with different disease manifestations and compared to a control group of 200 randomly selected patients without increased exposure to tick bites. A group of 232 hunters and forest workers served as a model for multiple tick bites. Results: Specific IgE (sIgE) antibodies to alpha-gal (> 0.1 kU/L) were found in 12.6% of all borreliosis samples compared to the control group with 9% (relative risk 1.4; 95% CI 0.85 – 2.3; not significant (n.s.). The highest prevalence of sIgE to alpha-gal was observed in hunters and forest service employees (22.8%, relative risk 2.5; 95% CI 1.5 – 4.2; p < 0.001). Higher age and elevated total IgE were also associated with alpha-gal sensitization. Conclusion: IgE sensitization to alpha-gal tends to be more frequent in tick-exposed patients with borreliosis than in controls (n.s.). Moreover, hunters and forest workers show an even higher rate of elevated IgE to alpha-gal. Thus, frequent tick contact may result in alpha-gal sensitization. In the area of Munich, the prevalence of alpha-gal sensitization appears lower than in the state of Baden-Württemberg and lower than in the USA, which may be due to the difference in tick species or the frequency of tick exposure. This study could show that alpha-gal sensitization and presumably alpha-gal syndrome does not seem to be a modern problem but existed already more than 30 years ago. |
Allergologie Select. 2023;7:140. | prevalence; risk group |
| Benedé S, López-Fandiño R, Molina E. | 2024 | Residual α-Gal in digested beef, pork and lamb meat submitted to different cooking methods. |
LWT. 2024 Jul 2:116441. | beef; pork; lamb; cooking; heat stable |
| Bensinger A, Green P. | 2019 | Mammalian Meat Allergy Masquerading as IBS-D: 1846. INTRODUCTION: Mammalian meat allergy, often referred to as alpha gal allergy, is a recently discovered and increasingly prevalent condition with a wide range of clinical manifestations resulting from an allergic reaction mediated by IgE antibodies directed against galactose-alpha-1,3-galactose. Patients can frequently experience nausea, diarrhea, indigestion, urticaria, angioedema or anaphylaxis typically arising three to six hours after ingestion of mammalian protein. Interestingly, patients have longstanding tolerance to mammalian meats years before symptom onset and were bitten by the lone star tick, Amblyomma americanum, prior to symptom onset. We present a case of mammalian meat allergy diagnosed after the discovery of a tick on a patient’s lower extremity during a colonoscopy. CASE DESCRIPTION/METHODS: A 64-year-old female with a history of IBS-D presented to our clinic several years of chronic urticaria, diarrhea, nausea and abdominal pain, typically occurring after food intake. An extensive workup of chronic diarrhea was largely unrevealing. However, during a colonoscopy a tick was discovered on the patient’s inner thigh and was removed. Given her symptom complex, additional blood work was pursued and revealed elevated levels of serum alpha gal IgE. Further history revealed multiple prior tick bites with severe localized skin reactions in the past. At a follow-up visit after avoidance of mammalian meat and byproducts, the patient reported a 90% improvement in her symptoms, with just one formed bowel movement per day. She continued to have some bloating and abdominal pressure, but overall her symptoms were drastically improved with a modified diet. DISCUSSION: This case illustrates the challenges in identifying alpha gal allergy, a unique and frequently misdiagnosed allergic condition that is increasing in prevalence. The clinical presentation of alpha gal is unique when compared to other food allergies as there are a lack of immediate oral symptoms and episodes only occur after lone star tick exposure. Additionally, onset of symptoms occurs three to six hours after mammalian meat consumption, making its association difficult to uncover. The case also highlights the importance of taking a thorough history, with higher suspicion in patients with recurrent episodes of urticaria, angioedema, gastroenteritis, or anaphylaxis without an obvious cause. Thus, improved awareness of alpha gal allergy is essential, particularly for providers located in endemic areas like the southeastern United States. |
American Journal of Gastroenterology. 2019 Oct 1;114(2019 ACG Annual Meeting Abstracts):S1036-7. | gastroenterology; gastrointestinal symptom; GI; IBD; IBS; differential; misdiagnosis |
| Berends AMA, & Elberink JNGO. | 2017 | The alpha-gal syndrome: an allergic reaction to mammalian meat secondary to a tick bite. / Het alfa-galsyndroom, allergische reacties op vlees: allergie voor zoogdierenvlees secundair aan een tekenbeet. Here we present the case of a 68-year-old patient with alpha-gal syndrome. This is a delayed-onset allergic reaction, characteristically occurring 2-6 hours after ingestion of mammalian meat products. The reaction occurs because the patient has developed IgE antibodies to a mammalian oligosaccharide epitope, galactose-α-1,3-galactose (alpha-gal); tick bites induce this IgE antibody response. Presentation varies from chronic urticaria to life-threatening anaphylaxis. The alpha-gal syndrome is usually self-limiting as long as there are no new tick bites. Clinicians should be aware of this syndrome, which is often not recognized as such. |
Nederlands Tijdschrift Voor Geneeskunde. 2017; 161:D1062. | Europe; Netherlands |
| Berg EA, Platts-Mills TAE, Commins SP. | 2014 | Drug allergens and food-the cetuximab and galactose-alpha-1,3-galactose story. Objective: A novel form of food allergy has been described that initially became apparent from IgE reactivity with the drug cetuximab. Ongoing work regarding the etiology, distribution, clinical management, and cellular mechanisms of the IgE response to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) is reviewed. Data Sources: Brief review of the relevant literature in peer-reviewed journals. Study Selection: Studies on the clinical and immunologic features, pathogenesis, epidemiology, laboratory evaluation, and management of IgE to alpha-gal are included in this review. Results: Recent work has identified a novel IgE antibody response to the mammalian oligosaccharide epitope, alpha-gal, that has been associated with 2 distinct forms of anaphylaxis: (1) immediate-onset anaphylaxis during first exposure to intravenous cetuximab and (2) delayed-onset anaphylaxis 3 to 6 hours after ingestion of mammalian food products (eg, beef and pork). Study results have suggested that tick bites are a cause of IgE antibody responses to alpha-gal in the United States. Patients with IgE antibody to alpha-gal continue to emerge, and, increasingly, these cases involve children. Nevertheless, this IgE antibody response does not appear to pose a risk for asthma but may impair diagnostic testing in some situations. Conclusion: The practicing physician should understand the symptoms, evaluation, and management when diagnosing delayed allergic reactions to mammalian meat from IgE to alpha-gal or when initiating treatment with cetuximab in patients who have developed an IgE antibody response to alpha-gal. |
Annals of Allergy, Asthma & Immunology. 2014 Feb 1;112(2):97-101. | review article; primay care; oncology; cetuximab |
| Bermingham M, Agah S, Smith B, Merritt T, Chapman M. | 2024 | Alpha-gal Epitopes in Commercial Cat and Dog Diagnostic Allergenic Products. ABSTRACT |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB137. | dog; cat; pet |
| Bernth Jensen JM, Laursen NS, Jensen RK, Andersen GR, Jensenius JC, Sørensen UBS, Thiel S. | 2020 | Complement activation by human IgG antibodies to galactose‐α‐1, 3‐galactose. Some human antibodies may paradoxically inhibit complement activation on bacteria and enhance pathogen survival in humans. This property was also claimed for IgG antibodies reacting with terminal galactose‐α‐1,3‐galactose (Galα3Gal; IgG anti‐αGal), a naturally occurring and abundant antibody in human plasma that targets numerous different pathogens. To reinvestigate these effects, we used IgG anti‐αGal affinity isolated from a pool of normal human IgG and human hypogammaglobulinaemia serum as a complement source. Flow cytometry was performed to examine antibody binding and complement deposition on pig erythrocytes, Escherichia coli O86 and Streptococcus pneumoniae serotype 9V. Specific nanobodies were used to block the effect of single complement factors and to delineate the complement pathways involved. IgG anti‐αGal was capable of activating the classical complement pathway on all the tested target cells. The degree of activation was exponentially related to the density of bound antibody on E. coli O86 and pig erythrocytes, but more linearly on S. pneumoniae 9V. The alternative pathway of complement amplified complement deposition. Deposited C3 fragments covered the activating IgG anti‐αGal, obstructing its detection and highlighting this as a likely general caveat in studies of antibody density and complement deposition. The inherent capacity for complement activation by the purified carbohydrate reactive IgG anti‐αGal was similar to that of normal human IgG. We propose that the previously reported complement inhibition by IgG anti‐αGal relates to suboptimal assay configurations, in contrast to the complement activating property of the antibodies demonstrated in this paper. |
Immunology. 2020 Jul 14. | |
| Bernth Jensen JM, Petersen MS, Ellerman-Eriksen S, Møller BK, Jensenius JC, Sørensen UB, Thiel S | 2020 | Abundant human anti-Galα3Gal antibodies display broad pathogen reactivity. Antibodies of the IgG class to terminal Galα3Gal (IgG anti-αGal) is abundant in human plasma and are reported to bind most sepsis-causing Gram-negative bacteria. However, these seminal findings, made more than two decades ago, have not been reexamined. Our aim was to assess IgG anti-αGal´s pathogen reactivity. We affinity purified IgG anti-αGal from a therapeutic grade normal human IgG pool applying two rounds of positive selection with Galα3Gal-coupled beads and included removal of column matrix reactive antibodies. The purified antibodies were rigorously characterized in terms of specificity and purity in various solid-phase immunoassays. We used flow cytometry to study reactivity against 100 consecutive clinical isolates diagnosed as cause of sepsis in humans. We found that the purified IgG anti-αGal displays high specificity for Galα3Gal. Also, IgG anti-αGal at 5 mg/L bound 56 out of 100 pathogens with predilection for Gram-positive bacteria binding 39 out of 52 strains. We confirm that although IgG anti-αGal comprise a small fraction of the human antibody pool (~0.1%), these antibodies targets an impressively large part of pathogens causing invasive disease. |
Scientific reports. 2020 Mar 12;10(1):1-3. | |
| Bernth Jensen JM, Skeldal S, Petersen MS, Møller BK, Hoffmann S, Jensenius JC, Sørensen UBS, Thiel S. | 2020 | The human natural anti‐αGal antibody targets common pathogens by broad‐spectrum polyreactivity. Naturally occurring antibodies are abundant in human plasma, but their importance in the defense against bacterial pathogens is unclear. We studied the role of the most abundant of such antibodies, the antibody against terminal galactose‐α‐1,3‐galactose (anti‐αGal), in the protection against pneumococcal infections (Streptococcus pneumonia). All known pneumococcal capsular polysaccharides lack terminal galactose‐α‐1,3‐galactose, yet highly purified human anti‐αGal antibody of the IgG class reacted with 48 of 91 pneumococcal serotypes. Anti‐αGal was found to contain multiple antibody subsets that possess distinct specificities beyond their general reactivity with terminal galactose‐α‐1,3‐galactose. These subsets in concert targeted a wide range of microbial polysaccharides. We found that anti‐αGal constituted up to 40% of the total antibody reactivity to pneumococci in normal human plasma, that anti‐αGal drives phagocytosis of pneumococci by human neutrophils, and that the anti‐αGal level was 2‐fold lower in patients prone to pneumococcal infections compared to controls. Moreover, during a 48‐year period in Denmark, the 48 anti‐αGal‐reactive serotypes caused fewer invasive pneumococcal infections (n = 10,927) than the 43 non‐reactive serotypes (n = 18,107), supporting protection on the population level. Our findings explain the broad‐spectrum pathogen reactivity of anti‐αGal and support that these naturally occurring polyreactive antibodies contribute significantly to human protective immunity. |
Immunology.2020 Dec 19. | |
| Bernth-Jensen JM, Møller BK, Jensenius JC, Thiel S. | 2011 | Biological variation of anti-alpha Gal-antibodies studied by a novel Time-Resolved ImmunoFluorometric Assay. As much as one percent of antibodies in human plasma are reported to be specific for the non-human disaccharide structure alphaGal. Various microbes express alphaGal. However, the implications of anti-alphaGal antibodies for the anti-microbial defenses are poorly established. With the perspective of studying the biological importance of the antibodies, we have established a sensitive Time-Resolved ImmunoFluorometric Assay (TRIFMA) for quantification of such antibodies. Two versions were developed, one for IgM antibodies and one for IgG antibodies. Samples were collected from plasma donations of healthy adults (n=120) of known gender (60+60), AB0-type (0: 15+15, A: 15+15, B: 15+15, and AB: 15+15) and age (19-64 yrs). We subsequently examined the potential association between antibody concentration and AB0-type, gender, age, and titers of antibodies to blood type antigens. We found that IgG and IgM anti-alphaGal concentrations are, 1) stable over time within the individual, 2) vary more than 400-fold between individuals, 3) negatively correlated with age for IgM but not for IgG antibodies, 4) IgM antibodies are 2-fold higher in females whereas no gender difference was observed for the IgG antibodies, 5) inter-mutual correlated, 6) lowest in individuals expressing B-antigen, and 7) AB0-type A individuals may constitute an intermediate group. Our established method and findings pave the way for further studies of the involvement of anti-alphaGal antibodies in immunity and may be a method to examine the potential of an individual to mount an anti-carbohydrate response. |
Journal of immunological methods. 2011 Oct 28;373(1-2):26-35. | Moller; antibody; IgG; IgM; blood type; demographics; age |
| Berry DC, Britton L, Joseph LM, Jessup A. | 2019 | Alpha-gal: a delayed onset of anaphylaxis and uncoverSensitisation and sero-reversion to tick bite induced galactose-1,3-alpha-galactose, meat and dairy sensitisation in New South Wales, Australia.ing the cause. The current literature on alpha-gal delayed anaphylaxis indicates that it is increasing in incidence. • This article contributes key factors and assessment findings relevant to delayed anaphylaxis. • Key implications for emergency nursing practice found in this article include the importance of nurses' eliciting histories of tick bites and patients' dietary intake within the last 6 hours before presentation to emergency departments. |
2019 Sep 1;45(5):567-9. | nursing; emergency care; first responders |
| Bianchi J, Kuravi K, WALTERS A, Commins S, Sorrells L. | 2023 | Quantitative and qualitative assessment of alpha a-gal in food products. Rationale: Large populations in selected regions are sensitized to galactose-alpha 1,3-galactose (alpha-gal). Sensitized individuals that are exposed to alpha-gal via consumption of mammalian food products are well documented to experience adverse events including GI distress and anaphylaxis. The objective of this study was to characterize relative concentration of alpha α-gal in various food products. Methods: Characterization of alpha α-gal was determined via ELISA, Western and IHC assays. The various food products evaluated included bacon, ham, and dietary supplements (collagen, whey, and pepsin). Porcine a-gal knockout (devoid of a-gal aka GalSafe) derived tissue or products served as negative controls. Results: Analytical analysis indicated presence of alpha-gal in all products from standard mammalian sources (pigs and cows) with relative concentrations exceeding 10 million epitopes per mg. Alpha-gal is undetectable in the negative control(porcine alpha-gal knockout). . Conclusions: Alpha-gal persist at very high concentrations in all mammalian derived food products evaluated. Products sourced from alpha gal knockout pigs had no detectable levels of alpha gal AGS patients did not experience any adverse events upon consumption of porcine a-gal knockout (devoid of a-gal aka GalSafe) food. |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB96. | Food; dietary supplements (collagen, whey, and pepsin) |
| Bianchi J, Walters A, Fitch ZW, Turek, JW. | 2020 | † **Alpha-gal syndrome: Implications for cardiovascular disease Alpha-gal syndrome (AGS) refers to a potentially life-threatening allergy to the molecule galactose-α1,3-galactose (gal), which is expressed on most mammalian tissues but, importantly, is not expressed by humans. This syndrome can manifest as an allergic reaction to mammalian meat products, but other sources of mammalian tissue can also provoke an immune response, including injectable and implantable medical products. This syndrome has been linked to coronary atherosclerosis, and medical products that express gal are routinely used in cardiology and cardiac surgery. This article seeks to discuss potential implications of alpha syndrome as it relates to cardiovascular health and to heighten awareness in the cardiovascular community about this emerging public health issue. |
Global Cardiology Science and Practice. 2020 Feb 9;2019(3). | Perioperative care; cardiac surgery; cardiovacular surgery; cardiology; prevalence; atherosclerosis; CAD coronary artery disease |
| Bianchi J, Walters A, KURAVI K, Sorrells L, Choudhary S, Commins S. | 2022 | Evaluation of an Allergen Free Pig for AGS Patients. Rationale: Allergists have identified populations with high titers of anti-alpha-gal (galactose-alpha1,3-galactose) IgE due to a tick bite that adversely react after exposure to alpha-gal (e.g. alpha-gal syndrome (AGS)). Alpha-gal is present in all mammalian derived food and therapeutic products. Our objective was to characterize tissues from a line of engineered pigs (Gal KO), that is devoid of the allergen, alpha-gal. Methods: In vitro and in vivo comparison of selected tissues from standard and Gal KO pigs. Evaluation consisted of analyte, sensory, and immunohistochemistry analysis. Further, a challenge study was performed in a Gal KO murine model with high titers of alpha-gal IgE. Results: Analytes demonstrated the nutrient values of Gal KO food products are consistent to food products from standard pigs as well as nutrient values published in USDA databases. Gal KO pork samples were consistent with sensory attributes from standard pork samples. Immunohistochemistry revealed sera from AGS patients did not react to Gal KO pork samples. Gal KO mice sensitized with tick extract and subsequently challenged to kidney extract indicate substantial response to standard pig kidney and undetectable response to Gal KO pig kidney. Conclusions: The tissue characteristics of the Gal KO pig are consistent to the standard pig except for undetectable alpha-gal. Food and therapeutic products derived from Gal KO pigs have the potential to be a safer alternative for derivation of food or human therapeutics in the AGS population than currently available mammalian sourced material. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB202. | knock-out pig; GalSafe pig; food; pork |
| Bickerton M, Toledo A. | 2020 | Multiple pruritic tick bites by Asian Longhorned tick larvae (Haemaphysalis longicornis). This study presents the first report of multiple human bites by larvae of Haemaphysalis longicornis Neumann in the U.S. An adult male working on a public park in Hackensack City (New Jersey) removed eight attached larvae from the arm, armpit, and back. The worker developed small erythematous pruritic lesions that self resolved in two weeks. No other symptoms were associated with the bite. The Asian longhorned tick is not considered an anthropophilic tick species. Still, the parthenogenetic population present in the eastern U.S can reach high numbers in small areas increasing the risk of tick bites to non-specific hosts, including humans. Public health practitioners should become familiar with the Asian longhorned tick, and vectorial competence studies should be carried out to determine the risk of tick-borne disease transmission to humans. |
International Journal of Acarology. 2020 Aug 12:1-4. | vector; tick; Haemaphylis longicornis |
| Biedermann T, Fischer J, Yazdi A. | 2015 | ‡ Mammalian meat allergy: a diagnostic challenge. Introduction: The first national report in the lay press on galactose--1,3-galactose-mediated meat allergy (or red meat allergy) appeared in the German newspaper “Der Spiegel” in December 2012 [1]. Since then, awareness of this clinical picture has increased significantly, not least among affected patients, and it is not infrequent for affected individuals to take the initiative in terms of obtaining a diagnosis. The present report uses the case of an affected female patient as a basis to convey the fundamentals and procedures involved in a disease recognition and diagnosis that has become better understood and more readily diagnosed in recent years, as well as to emphasize the significance of skin tests. |
Allergo journal international. 2015 May 1;24(3):81-3. | Europe; Germany; diagnosis |
| Biedermann T, Röcken, M. | 2012 | Delayed appearance of symptoms in immediate hypersensitivity: type I sensitization to galactose-alpha-1,3-galactose. Delayed immediate-type allergy to innards and red meat can be mediated by IgE antibodies to galactose-alpha-1, 3-galactose (alpha-Gal). Apart from humans and Old World apes, alpha-Gal is ubiquitously expressed in glycoproteins and glycolipids. Thus, as alpha-Gal is immunogenic for humans, they can be easily sensitized even through a tick bite. Anti-alpha-Gal IgG represents approximately 1% of total IgG; IgE antibodies to alpha-Gal are comparably rare. However, in these patients, consuming red meat and especially innards can lead to the development of immediate type reactions such as urticaria. Cetuximab is a humanized IgG1 antibody containing murine alpha-Gal. Therefore, allergic reactions may occur with its first administration. |
Der Hautarzt; Zeitschrift fur Dermatologie, Venerologie, und verwandte Gebiete. 2012 Apr;63:76-9. | Rocken |
| Bilò MB, Martini M, Tontini C, Mohamed OE, Krishna MT. | 2019 | Idiopathic anaphylaxis. Idiopathic anaphylaxis (IA) or spontaneous anaphylaxis is a diagnosis of exclusion when no cause can be identified. The exact incidence and prevalence of IA are not known. The clinical manifestations of IA are similar to other known causes of anaphylaxis. A typical attack is usually acute in onset and can worsen over minutes to a few hours. The pathophysiology of IA has not yet been fully elucidated, although an IgE-mediated pathway by hitherto unidentified trigger/s might be the main underlying mechanism. Elevated concentrations of urinary histamine and its metabolite, methylimidazole acetic acid, plasma histamine and serum tryptase have been reported, consistent with mast cell activation. There is some evidence that corticosteroids reduce the frequency and severity of episodes of IA, consistent with a steroid-responsive condition. Important differential diagnoses of IA include galactose alpha-1,3 galactose (a carbohydrate contained in red meat) allergy, pigeon tick bite (Argax reflexus), wheat-dependent exercise-induced anaphylaxis, Anisakis simplex allergy and mast cell disorders. Other differential diagnoses include "allergy-mimics" such as asthma masquerading as anaphylaxis, undifferentiated somatoform disorder, panic attacks, globus hystericus, vocal cord dysfunction, scombroid poisoning, vasoactive amine intolerance, carcinoid syndrome and phaeochromocytoma. Acute treatment of IA is the same as for other forms of anaphylaxis. Long-term management is individualized and dictated by frequency and severity of symptoms and involves treatment with H1 and H2 receptor blockers, leukotriene receptor antagonist and consideration for prolonged reducing courses of oral corticosteroids. Patients should possess an epinephrine autoinjector with an anaphylaxis self-management plan. There are anecdotal reports regarding the use of omalizumab. For reasons that remain unclear, the prognosis of IA is generally favourable with appropriate treatment and patient education. If remission cannot be achieved, the diagnosis should be reconsidered. |
Clinical & Experimental Allergy. 2019 Jul;49(7):942-52. | Bilo; idiopathic anaphylaxis |
| Binder A, Armstrong P, Wachs T, Commins S, Beard C, Petersen L, Altrich M, Kersh G. | 2020 | **Trends in Alpha-gal Allergy Diagnostic Testing in the United States, 2010–2018. RATIONALE: Alpha-gal allergy is an immunoglobulin E (IgE) mediated allergy to galactose-alpha-1,3-galactose (alpha-gal), a carbohydrate found in mammalian meat. National data on incidence and distribution are not available, but case reports commonly originate from the southeastern United States, and suggest exposure to the Lone Star tick (Amblyomma americanum) as a risk factor. METHODS: We performed a retrospective analysis of alpha-gal IgE tests performed during 2010–2018 by Viracor Eurofins laboratories. Results≥ 0.1 kU/L were considered positive. We mapped data according to U.S. Census division to identify geographic differences in testing and prevalence. . RESULTS: During 2010–2018, 39% of all tests performed were positive. The number of tests performed annually increased 81-fold between 2010 and 2018; however, percent positivity remained stable, ranging from a peak of 56%in 2010 to 36%in 2016. Sourcelocation was provided for 46% of specimens;the percent positive was highest in the Mid-Atlantic (54%), and lowest in the Pacific (6%).. CONCLUSIONS: The rate of alpha-gal allergy testing increased steadily since 2010, but the proportion of positive samples remained stable. This suggests increased awareness and utilization, with capture of positive results, as opposed to largely inappropriate testing. Geographic distribution of positive results corresponds with the known range of Lone Star ticks. While the findings provide valuable information on the scope and distribution of IgE-positive patients, clinical information was not linked to these results. Systematic collection of clinical and laboratory data together would provide valuable insight into the burden of disease caused by alpha-gal allergy |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB144. | prevalence |
| Binder AM, Cherry‐Brown D, Biggerstaff BJ, Jones ES, Amelio CL, Beard CB, Petersen LR, Kersh GJ, Commins SP, Armstrong PA. | 2022 | Clinical and Laboratory Features of Patients Diagnosed with Alpha‐gal Syndrome—2010–2019. Background: Alpha-gal syndrome (AGS) is an IgE-mediated allergy to galactose-alpha-1,3-galactose. Clinical presentation ranges from hives to anaphylaxis; episodes typically occur 2-6 hours after exposure to alpha-gal-containing products. In the United States, lone star tick bites are associated with development of AGS. To characterize features of AGS, we evaluated a cohort of patients presenting for care at the University of North Carolina, focusing on symptoms, severity, and identifying features unique to specific alpha-gal-containing product exposures. Methods: We performed a chart review and descriptive analysis of 100 randomly selected patients with AGS during 2010-2019. Results: Median age at onset was 53 years, 56% were female, 95% reported White race, 86% reported a history of tick bite, and 75% met criteria for anaphylaxis based on involvement of ≥2 organ systems. Those reporting dairy reactions were significantly less likely to report isolated mucocutaneous symptoms (3% vs 24%; ratio [95% CI]: 0.1 [0.1, 0.3]) than those who tolerated dairy, and were more likely to report gastrointestinal symptoms (79% vs 59%; ratio [95% CI]: 1.3 [0.7, 2.6]), although this difference was not statistically significant. Dairy-tolerant patients demonstrated higher alpha-gal sIgE titers (as a percentage of total IgE) than dairy-reactive patients (GM 4.1[95% CI: 2.7, 6.1] vs. GM 2.5 [95% CI: 1.3, 4.8], respectively; ratio - 1.6 [95% CI: -1.0, 3.9]). Conclusion: While tick exposure is common in the southern United States, nearly all AGS patients reported a tick bite. Gastrointestinal symptoms were prominent among those reporting reactions to dairy. Anaphylaxis was common, underscoring the severity and need to raise awareness of AGS among patients and providers. |
Allergy. 2022 Sep 30. | clinical features |
| Binder AM, Commins S, Altrich ML, Wachs T, Biggerstaff BJ, Beard CB, Petersen LR, Kersh GJ, Armstrong PA. | 2021 | Diagnostic Testing for Galactose-alpha-1, 3-galactose (Alpha-gal), United States, 2010–2018. Background: Alpha-gal syndrome (AGS) is an emerging immunoglobulin E (IgE)mediated allergy to galactose-alpha-1,3-galactose (alpha-gal). The geographic distribution and burden of AGS in the United States is unknown. Objective: To characterizes alpha-gal IgE testing patterns and describes trends and distribution during 2010–2018 in the United States. Methods: This retrospective analysis included all persons tested for alpha-gal IgE antibodies by Viracor-IBT Laboratories (Lee’s Summit, MO), the primary site of testing in the United States. Data included age and sex of person tested, specimen state of origin, collection date, and result value; persons with at least one positive test (≥0.1 kU/L) were compared to negatives. Proportions tested and with positive test results were calculated using U.S. Census population estimates. Results: Overall, 122,068 specimens from 105,674 persons were tested for alpha-gal IgE during July 1, 2010–December 31, 2018. Nearly one-third (34,256, 32.4%) had at least one positive result. The number of persons testing positive increased 6-fold from 1,110 in 2011 to 7,798 in 2018. Of those testing positive, mean [SD] age was 46.9 [19.8] years; males were more likely to test positive than females (43.3% vs 26.0%). Arkansas, Virginia, Kentucky, Oklahoma, and Missouri had the highest number of persons who were tested and had a positive result per 100,000 population. Conclusion: More than 34,000 persons, most presumably symptomatic, have tested positive for IgE antibodies to alpha-gal, suggesting AGS is an increasingly recognized public health problem. The geographic distribution of persons who tested positive is consistent with exposure to Amblyomma americanum ticks. |
Annals of Allergy, Asthma & Immunology. 1920. | prevalence; testing; united states |
| Binetruy F, Buysse M, Lejarre Q, Barosi R, Villa M, Rahola N, Paupy C, Ayala D, Duron O. | 2020 | Microbial community structure reveals instability of nutritional symbiosis during the evolutionary radiation of Amblyomma ticks. |
Molecular Ecology. 2020 Mar;29(5):1016-29. | |
| Bircher AJ, Hofmeier KS, Link S, Heijnen I. | 2017 | Food allergy to the carbohydrate galactose-alpha-1,3-galactose (alpha-gal): four case reports and a review. Until recently, food allergies to mammalian meats have been considered to be very rare. The observation that patients not previously exposed to the monoclonal chimeric antibody cetuximab suffered from severe anaphylaxis upon first exposure, led to the identification of galactose-alpha-1,3-galactose as a new relevant carbohydrate allergen. These patients later often suffered from anaphylactic reactions to red meat. Epidemiological data indicated that bites by the tick Amblyomma americanum in the USA, later also by Ixodes species in other continents, resulted in sensitisation to alpha-gal. On the other hand, in African patients with parasitic disorders, a high prevalence of anti-alpha-gal IgE, without clinical relevance, has been reported. In our four cases, one patient with a late onset of meat allergy had a history of a tick bite. The other three patients had symptoms from childhood or at a juvenile age. This indicates that in some patients, other ways of sensitisation may also take place. However, in patients without atopy, tick bite-induced IgE to alpha-gal may be more relevant. Diagnosis is based on a history of delayed onset of anaphylaxis. Skin tests with commercially available meat test solutions are often equivocal or negative; skin tests with raw meat and particularly pork kidney are more sensitive. Determination of specific IgE to alpha-gal is commercially available. The highest sensitivity is observed with skin and basophil activation tests with cetuximab which is, however, limited by its high costs. |
European Journal of Dermatology. 2017 Jan 1;27(1):3-9. | review article; Europe; Switzerland; co-factor; cofactor; alcohol; organ; lung; goat; vector of sensitization |
| Bircher AJ, Scherer K. | 2009 | Hypersensitivity reactions due to agents that modify the biological response (biologicals). Adverse reactions induced by biological agents which are being used increasingly in the therapy of inflammatory diseases, autoimmune disorders and tumors are being observed more and more frequently. This is a consequence of both the growing number of indications and the increasing number of these substances. They have an intrinsic immunologic effect, due to their structure, to their structural similarity to physiological proteins, as well as to their capacity to act directly on the immune system. In addition, they can induce the production of anti-allotype or anti-idiotype antibodies, especially when they have an extensive murine sequence, but also through their humanized or human antibody components. The adverse reactions which they induce also depend on the structure of their target, which they can activate, inhibit or modify by other mechanisms. The principal adverse reactions are of type alpha, with a "cytokine release syndrome", or of type beta, with the production of IgG or IgE antibodies and subsequent immediate type reactions such as urticaria, anaphylaxis or serum sickness. Pre-existing antibodies directed against some of these agents may have been generated by ubiquitous crossreacting epitopes. Local reactions occur frequently at the subcutaneous injection site of these agents; these reactions can sometimes be avoided by modifying the injection technique. The means of diagnosing such reactions are currently limited and their value has not yet been established on a large number of subjects. Continuation of this therapy is generally contraindicated due to the risk of severe complications. |
REVUE FRANCAISE D ALLERGOLOGIE. 2009 Apr 1;49(3):296-9. | pharmaceutical;; pharmacy; medication; biologic; biological agent |
| Blackburn CM, Pattarabanjird T, Qiao H, Drago F, Marshall M, Erickson LD, McNamara CA. | 2022 | Uncovering Mechanisms Between Oligosaccharide Galactose-alpha 1, 3-galactose (alpha-gal) Sensitization And Atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology. Recent work by our group and others have shown individuals with IgE to the oligosaccharide allergen present in mammalian products (α-gal) have increased atheroma burden with increased necrosis and calcification compared to those without α -gal specific IgE. These data suggest α -gal specific IgE increase plaque severity and vulnerability, yet the mechanisms that promote production of IgE to α -gal are unknown. Previous work from our group utilized multi-omics single cell analysis of circulating PBMCs from subjects with coronary angiography at UVA and showed subjects with IgE α -gal sensitization had a higher frequency of CCR6hi switched memory (SWM) B cells and that the CCR6 ligand, CCL20, increased class switching to IgE. To determine mechanisms whereby CCR6 may mediated class switching to IgE, we enriched total B cells from healthy donor peripheral blood mononuclear cells and stimulated with 20ng/ml human IL-4 and 10μg/ml agnostic anti-human CD40 with or without 20ng/ml CCL20 for 3 days. After 3 days of treatment, cells were collected and stained with a 15-color panel and analyzed via flow cytometry. Cells were analyzed for surface expression of CD20 and CD3 to gate total B cells. Gated B cells were further separated into CD27+/IgM-/IgD- to define SWM B cell population. CCL20 treatment did not increase the total percent of SWM B cells; however, there was a 2-3-fold increase in CCR6+ SWM B cells compared to CCR6- SWM B cells. CCL20 treated CCR6+ SWM B cells have an average of 7% increase of phosphorylated mTOR in total SWM B cells compared to nonCCL20 treated CCR6+ SWM B cells. These results suggest CCL20 stimulation induces mTOR phosphorylation and activation. Thus, mTOR activation and downstream mediators may be necessary for α -gal induced B cell class switching. From these preliminary studies, we conclude that CCL20 stimulation increases the percent pmTOR+ SWM B cells. We will continue to investigate downstream mTOR mediators in regard to B cell class switching after CCL20 stimulation and how α-gal sensitization augments B cell IgE class switching and increases atherosclerosis with our novel α -gal-/- Apoe-/- mouse. |
May;42(Suppl_1):A525-. | CAD; atherosclerosis; cardiac; cardiovascular; coronary artery disease |
| Błaszak B, Gozdecka G, Shyichuk A. | 2018 | Carrageenan as a functional additive in the production of cheese and cheese-like products. Carrageenan is a well-known gelling agent used in the food industry. The present review of patent and scientific literature shows that carrageenan is a useful additive in the cheese production process. The gel-strengthening properties of carrageenan are as a result of the fairly strong bonds it forms with casein macromolecules. However, carrageenan-casein interaction is dependent on pH. Different carrageenan types have different charge levels (the most charged is the helix form of lambda-carrageenan), which affects the carrageenan casein aggregates. The correct concentration of carrageenan and temperature treatment can improve cheese yield and whey protein recovery, which is desirable for cheese producers. Even small amounts of this hydrocolloid can increase cheese firmness and maintain cheese structure after cheese curd heating. Carrageenan improves cheese structure and other properties, such as ease of grating or slicing, which are very importantfor customers. Some modifications to cheese composition can destroy the natural cheese structure, but the addition of carrageenan can be useful for creating modified cheese-like products with desirable attributes. Carrageenan can be a good replacement for emulsifying salts, to stabilize cheese fat without disturbing the Ca:P ratio. The replacement of emulsifying salts with carrageenan (as little as 1%) results in a homogenous cheese product. For that reason, carrageenan is a useful additive for maintaining the organoleptic and structural values of fat-free cheese. Carrageenan can also stabilize the structure in cheese-like products and replace casein in cheese imitations. |
Acta Scientiarum Polonorum Technologia Alimentaria. 2018 Jun 30;17(2):107-16. | carrageenan |
| Blessmann J, Hanlodsomphou S, Santisouk B, Choumlivong K, Soukhaphouvong S, Chanthilat P, Brockow K, Biedermann T. | 2020 | Serum IgE against galactose-alpha-1, 3-galactose is common in laotian patients with snakebite envenoming but not the major trigger for early anaphylactic reactions to antivenom. Snake antivenom is the only specific treatment for snakebite envenoming, but life-threatening anaphylaxis is a severe side effect and drawback for the use of these typically mammalian serum products. The present study investigates the hypotheses whether serum IgE antibodies against the epitope galactose-alpha-1,3-galactose (α-gal) located on the heavy chain of non-primate mammalian antibodies are a possible cause for hypersensitivity reactions to snake antivenom. Serum samples from 55 patients with snakebite envenoming were obtained before administration of snake antivenom and tested for serum IgE (sIgE) against α-gal and total IgE. Early anaphylactic reactions (EARs) during the first 3 h after antivenom administration were classified into mild, moderate or severe and correlated with the presence of sIgE against α-gal. Fifteen (27%) out of 55 patients (37 male, 18 female, median 34 years, range 9–90 years) developed EARs after antivenom administration. Eleven, three and one patients had mild, moderate and severe EARs, respectively. Serum IgE against α-gal was detected in 17 patients (31%); in five (33%) out of 15 patients with EARs and in 12 (30%) out of 40 patients without EAR (Odds Ratio = 1.2; 95%-confidence interval: 0.3–4.2) with no correlation to severity. Although the prevalence of serum IgE against α-gal was high in the study population, very high levels of total IgE in the majority of patients question their clinical relevance and rather indicate unspecific sIgE binding instead of allergy. Lack of correlation between α-gal sIgE and EARs together with significantly increased total IgE levels suggest that sIgE against α-gal is not the major trigger for hypersensitivity reactions against snake antivenom. |
Toxicon: X. 2020; 100054. | Asia; Laos; prevalence; pharmacy; pharmaceutical; medical product; antivenom; helminth; endoparasite |
| Böer U, Schridde A, Anssar M, Klingenberg M, Sarikouch S, Dellmann A, Harringer W, Haverich A, Wilhelmi M. | 2015 | The Immune Response to Crosslinked Tissue is Reduced in Decellularized Xenogeneic and Absent in Decellularized Allogeneic Heart Valves. Background: The degeneration and failure of xenogeneic heart valves, such as the Matrix P Plus valve (MP-V) consisting of decellularized porcine valves (dec-pV) and equine glutaraldehyde-fixed conduits (ga-eC) have been linked to tissue immunogenicity accompanied by antibody formation. In contrast, decellularized allograft valves (dec-aV) are well-tolerated. Here, we determined tissue-specific antibody levels in patients after implantation of MP-V or dec-aV and related them to valve failure or time period after implantation. Methods and Results: Specific antibodies toward whole tissue-homogenates or alphaGal were determined retrospectively by ELISA analyses from patients who received MP-V with an uneventful course of 56.1 ± 5.1 months (n = 15), or with valve failure after 25.3 ± 14.6 months (n = 3), dec-aV for various times from 4 to 46 months (n = 14, uneventful) and from healthy controls (n = 4). All explanted valves were assessed histopathologically.MP-V induced antibodies toward both tissue components with significantly higher levels toward ga-eC than toward dec-pV (68.7 and 26.65 μg/ml IgG). In patients with valve failure, levels were not significantly higher and were related to inflammatory tissue infiltration. Anti-Gal antibodies in MP-V patients were significantly increased in both, the uneventful and the failure group. In contrast, in dec-aV patients only a slight tissue-specific antibody formation was observed after 4 months (6.24 μg/ml) that normalized to control levels after 1 year. Conclusions: The strong humoral immune response to glutaraldehyde-fixed tissues is reduced in decellularized xenogeneic valves and almost absent in decellularized allogeneic tissue up to 4.5 years after implantation. |
The International journal of artificial organs. 2015 Apr;38(4):199-209. | Boer |
| Boni E, Incorvaia C. | 2020 | Near-fatal anaphylaxis with Kounis syndrome caused by Argas reflexus bite: a case report. Background: The pigeon tick Argas reflexus is a temporary parasite of pigeons. It bites during night hours and lies briefly on its prey, as long as it takes the blood meal. When pigeons are not accessible, ticks look for other hosts, invading nearby flats and biting humans. Case presentation: We present the case of a woman aged 46 years who experienced severe anaphylaxis during the night which required emergency medical treatment, tracheal intubation and hospitalization in intensive care unit. Kounis syndrome was documented by transient ST depression and elevation of troponin. The allergological work up ruled out hypersensitivity to drugs, latex and foods containing alpha-gal, which is a cause of anaphylaxis. Basal serum tryptase was in normal range (8.63 ng/ml). When questioned about the presence of ticks, the patient brought into view various specimens of ticks that were recognized by an entomologist as Argas reflexus. Conclusions: An in vitro diagnosis of allergy to Argas reflexus is currently not feasible because, though the major allergen Arg r 1 has been isolated, allergen extracts are not commercially available. Therefore, the diagnosis of anaphylaxis from Argas reflexus, when other causes of anaphylaxis are excluded, must rely only on history and clinical findings, as well as on the presence of pigeons and/or pigeon ticks in the immediate domestic environment. |
Clinical and Molecular Allergy. 2020 Dec;18(1):1-3. | vectors; mites; ectoparasites; arthropods |
| Borsani B, De Santis R, Perico V, Penagini F, Pendezza E, Dilillo D, Bosetti A, Zuccotti GV, D’Auria E. | 2021 | The Role of Carrageenan in Inflammatory Bowel Diseases and Allergic Reactions: Where Do We Stand?. Carrageenan (CGN) is a high molecular weight polysaccharide extracted from red seaweeds, composed of D-galactose residues linked in β-1,4 and α-1,3 galactose-galactose bond, widely used as a food additive in processed foods for its properties as a thickener, gelling agent, emulsifier, and stabilizer. In recent years, with the spread of the Western diet (WD), its consumption has increased. Nonetheless, there is a debate on its safety. CGN is extensively used as an inflammatory and adjuvant agent in vitro and in animal experimental models for the investigation of immune processes or to assess the activity of anti-inflammatory drugs. CGN can activate the innate immune pathways of inflammation, alter the gut microbiota composition and the thickness of the mucus barrier. Clinical evidence suggests that CGN is involved in the pathogenesis and clinical management of inflammatory bowel diseases (IBD), indeed food-exclusion diets can be an effective therapy for disease remission. Moreover, specific IgE to the oligosaccharide α-Gal has been associated with allergic reactions commonly referred to as the “α-Gal syndrome”. This review aims to discuss the role of carrageenan in inflammatory bowel diseases and allergic reactions following the current evidence. Furthermore, as no definitive data are available on the safety and the effects of CGN, we suggest gaps to be filled and advise to limit the human exposure to CGN by reducing the consumption of ultra-processed foods. |
Nutrients. 2021 Oct;13(10):3402. | carrageenan |
| Bortz PS, Susi A, Ching S, Platts-Mills T, Wilson J, Nylund C. | 2024 | Prevalence of IgG to Rickettsia in a Cohort of Military Personnel in relation to incident Alpha-Gal Sensitization. ABSTRACT |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB45. | rickettsia IgG |
| Bosques CJ, Collins BE, Meador JW, Sarvaiya H, Murphy JL, DelloRusso G, Bulik DA, Hsu IH, Washburn N, Sipsey SF, Myette JR. | 2010 | Chinese hamster ovary cells can produce galactose-α-1, 3-galactose antigens on proteins. Chinese hamster ovary (CHO) cells are widely used for the manufacture of biotherapeutics, in part because of their ability to produce proteins with desirable properties, including ‘human-like’ glycosylation profiles. For biotherapeutics production, control of glycosylation is critical because it has a profound effect on protein function, including half-life and efficacy. Additionally, specific glycan structures may adversely affect their safety profile. For example, the terminal galactose-α-1,3-galactose (α-Gal) antigen can react with circulating anti α-Gal antibodies present in most individuals1. It is now understood that murine cell lines, such as SP2 or NSO, typical manufacturing cell lines for biotherapeutics, contain the necessary biosynthetic machinery to produce proteins containing α-Gal epitopes2–4. Furthermore, the majority of adverse clinical events associated with an induced IgE-mediated anaphylaxis response in patients treated with the commercial antibody Erbitux (cetuximab) manufactured in a murine myeloma cell line have been attributed to the presence of the α-Gal moiety4. Even so, it is generally accepted that CHO cells lack the biosynthetic machinery to synthesize glycoproteins with α-Gal antigens5. Contrary to this assumption, we report here the identification of the CHO ortholog of N-acetyllactosaminide 3-α-galactosyltransferase-1, which is responsible for the synthesis of the α-Gal epitope. We find that the enzyme product of this CHO gene is active and that glycosylated protein products produced in CHO contain the signature α-Gal antigen because of the action of this enzyme. Furthermore, characterizing the commercial therapeutic protein abatacept (Orencia) manufactured in CHO cell lines, we also identified the presence of α-Gal. Finally, we find that the presence of the α-Gal epitope likely arises during clonal selection because different subclonal populations from the same parental cell line differ in their expression of this gene. Although the specific levels of α-Gal required to trigger anaphylaxis reactions are not known and are likely product specific, the fact that humans contain high levels of circulating anti-α-Gal antibodies suggests that minimizing (or at least controlling) the levels of these epitopes during biotherapeutics development may be beneficial to patients. Furthermore, the approaches described here to monitor α-Gal levels may prove useful in industry for the surveillance and control of α-Gal levels during protein manufacture. |
Nature biotechnology. 2010 Nov;28(11):1153-6. | Pharmaceutical; pharmacy; biologic; biological agent; Chinese hamster ovary; CHO |
| Boussamet L, Montassier E, Soulillou JP, Berthelot L. | 2021 | α1-3Gal antigen in gut microbiota, a potential new environmental factor in multiple sclerosis. |
Clinical Immunology. 2021 Feb 6:108693. | Autoimmune disease; multiple sclerosis; IgG; microbiota; microbiome |
| Boussamet L, Montassier E, Soulillou JP, Berthelot L. | 2021 | Anti α1-3Gal antibodies and Gal content in gut microbiota in immune disorders and multiple sclerosis Recent observations suggest that Gal antigen content in gut microbiota and anti-Gal antibody response may influence inflammation in immune related disorders. In this review we summarized the current knowledge on antibody response to the Gal epitope in various immune disorders. We discuss the origin of Gal antigen associated to gut microbiota. In multiple sclerosis, the possible mechanisms by which the altered microbiota and/or circulating anti-Gal level could affect the immune response in this disease are presented. |
Red.;84:85 | Autoimmune disease; multiple sclerosis; IgG; microbiota; microbiome |
| Boyce RM, Schulz A, Mansour O, Giandomenico D, Farel CE, Commins SP. | 2022 | Alpha-gal Syndrome in the Infectious Diseases Clinic: A series of five cases in central North Carolina. Background: Alpha-gal syndrome (AGS) is a recently described allergy to galactose-α-1,3-galactose, an oligosaccharide present in mammalian meat. AGS can present with angioedema, urticaria, and anaphylaxis arising 3-6 hours after ingestion, although symptoms such as gastrointestinal distress, fatigue, and arthralgias are also reported. Because AGS appears to be associated with tick bites, patients may present to Infectious Diseases (ID) clinics for evaluation. Methods: We documented a series of five patients referred to the University of North Carolina ID clinic between 2020–2022 for various tick-borne infections that were found to have symptoms and laboratory testing consistent with AGS. Patients were subsequently referred to the Allergy and Immunology clinic. Results: Patients were referred to the ID clinic for persistent symptoms following positive tick-borne disease testing or presumed tick-borne infection. All patients had an elevated alpha-gal IgE and clinical presentation consistent with AGS. Common symptoms included episodic gastrointestinal distress (e.g., cramping, nausea, diarrhea), fatigue, arthralgias, and subjective cognitive impairment, but a notable absence of severe anaphylaxis. Four patients were seen by at least one non-allergy specialist prior to referral to ID. Patients reported substantial improvement in their symptoms following dietary restriction. Conclusions: ID physicians should be aware of AGS as a cause of persistent, non-specific symptoms following a tick exposure or tick-borne illness. Further research is needed to determine the prevalence of alpha-gal sensitization and AGS following tick-borne bites. |
InOpen Forum Infectious Diseases 2022 Dec 12. | Infectious disease; tick-borne disease; chronic tick-borne illness; chronic Lyme; GI; arthralgia; joint; arthritis; rheumatology; rheumatological brain fog; cognitive; post-acute; Rickettsia; Ehrlichia; Borrelia burgdorferi; gastroenterology |
| Boylston TD. | 2019 | Byproducts from Butter and Cheese Processing. | Byproducts from Agriculture and Fisheries: Adding Value for Food, Feed, Pharma, and Fuels. 2019 Oct 14:107-21. | |
| Božan M, Lazarević VV, Marković I, Morović‐Vergles J, Mitrović J. | 2023 | Alpha‐gal syndrome—Food or drug allergy: A case report. Alpha-gal syndrome is an immunoglobulin E-mediated hypersensitivity characterized by delayed allergic reactions to ingested products containing alpha-gal carbohydrate. We present a patient with recurrent urticaria and suspected repaglinide hypersensitivity, who was eventually diagnosed with alpha-gal syndrome, wanting to emphasize possible drug allergy misdiagnosis and required caution with the medication choice. |
Clinical Case Reports. 2023 Sep;11(9). | pharmacy; pharmaceutical; drug; gelatin; magnesium stearate |
| Bradfisch F, Pietsch M, Forchhammer S, Strobl S, Stege HM, Pietsch R, Carstens S, Schäkel K, Yazdi A, Saloga J. | 2019 | Case series of anaphylactic reactions after rabies vaccinations with gelatin sensitization. Side effects due to allergic reactions to vaccine antigen or to additives such as chicken protein or gelatin have been known for some time. Recent findings regarding reactions mediated via the carbohydrate epitope galactose-alpha-1,3-galactose (alpha-gal), a constituent of animal gelatin, broaden the spectrum of gelatin-related allergies. This case series presents four patients who developed anaphylactic reactions following rabies vaccination using the vaccine Rabipur®. After appropriate allergy testing by skin prick testing and the determination of specific IgE to allergens in the vaccine, triggering by alpha-gal could be excluded and an allergy to gelatin was detected. The absence of allergic symptoms following the consumption of gelatin could potentially be explained through intestinal hydrolysis resulting in a loss of allergenic potency. Further implications related to the use of gelatin-containing infusions in emergency medicine are discussed. |
Allergo Journal International. 2019;28(4):103-6. | Primary care; vaccination; vaccine; gelatin; gelatine; rabipur; rabies |
| Brady SP, Novack D, Kulczycki A. | 2015 | Recurrent Anaphylaxis Due to Delayed Allergy to Mammalian Meat in a Patient with Mastocytosis. RATIONALE: Mastocytosis and delayed allergy to mammalian meat are under-recognized and potentially life-threatening conditions. We describe a patient with mastocytosis and delayed allergy to mammalian meat whose diagnoses came to light after several episodes of severe anaphylaxis. METHODS: Measurement of serum tryptase and IgE to galactose-alpha-1,3-galactose alpha-gal) were performed at Mayo Clinic, Rochester, MN. Bone Marrow biopsy was performed at Barnes-Jewish Hospital, St. Louis, MO. RESULTS: A 52-year-old man presented with a several year history of recurrent syncope. Symptoms proceeding syncope included nausea, vomiting, abdominal cramping, flushing, itching and lightheadedness. Prolonged unresponsiveness, hypotension and bradycardia accompanied each event, once requiring intubation and mechanical ventilation. Cardiac work-up was unrevealing. A pacemaker was placed for presumed symptomatic sinus bradycardia. Detailed history later revealed ingestion of beef and pork several hours prior to each event, as well as exposure to tick bites. IgE to alpha-gal was 1.93 kU/L (reference range <0.35kU/L), suggesting that an allergy to alpha-gal triggered these events. Baseline serum tryptase was 30 ng/mL (reference range <11.5ng/mL) and bone marrow biopsy was diagnostic for mastocytosis. The patient was prescribed an epinephrine auto-injector, placed on cetirizine, ranitidine and montelukast, and instructed to limit exposure to ticks and mammalian meat. The patient has had no further episodes. CONCLUSIONS: We believe this is one of the first cases described of life-threatening anaphylaxis secondary to delayed allergy to mammalian meat in a patient with mastocytosis. This case highlights the importance of including these rare entities in the differential diagnosis of unexplained syncope. |
Journal of Allergy and Clinical Immunology. 2015;135(2):AB206. | mastocytosis; mast cell disorder; cardiac; syncope |
| Bramlett KE, Pickle EO, Waltz H, Saunders E, Vorobiov J, Commins S, Haldeman M, Nolan M. P-1407. | 2025 | The Growing Trend of Clinical Tick-Borne Diseases in South Carolina. |
InOpen Forum Infectious Diseases 2025 Jan 29 (Vol. 12, No. Suppl 1, pp. ofae631-1582). | prevalence; South Carolina; race; rural; socioeconomic |
| Breidenbaugh M, Barnes B, McGowan E, Wilson J. | 2023 | INVESTIGATING GI-VARIANT ALPHA-GAL SYNDROME IN PEDIATRIC PATIENTS DIAGNOSED WITH FUNCTIONAL ABDOMINAL PAIN. Introduction: Functional abdominal pain disorders (FAPDs) affect up to 13.5% of all children worldwide. Recognition of novel mechanisms that contribute to gastrointestinal symptoms that are labeled as functional could have important implications for patient management. IgE-mediated allergic responses to mammalian products containing galactose-alpha-1,3-galactose (alpha-gal) classically present with hives or anaphylaxis 3-6 hours later, but it is increasingly recognized that adults and children sensitized to alpha-gal can present with isolated GI symptoms. Methods: The tool SlicerDicer in the electronic health record EPIC was used to identify patients </=18 years old in an academic pediatric GI clinic in central Virginia who were diagnosed with a FAPD, using eleven ICD-10 codes. Alpha-gal IgE that was obtained as part of their work-up was extracted. Results: Of 4,883 patients diagnosed with a FAPD in the pediatric GI clinic in 2022, an alpha-gal IgE was obtained in 277 patients (6%). Mean age was 12 years old, and sensitization to alpha-gal (level >/= 0.1 kU/L) was present in 53/277 patients (19%). Comparing sensitized and non-sensitized, there was a greater frequency of sensitized males (60% vs. 44%, p=0.03), but age was similar. In sensitized patients, median alpha-gal IgE level was 0.42 kU/L, total IgE was 180 IU/mL, and alpha-gal IgE as a percentage of total IgE was 0.51%. Conclusion: Alpha-gal sensitization in patients evaluated for a FAPD in our pediatric GI clinic was common. Further research is needed to assess whether a mammalian avoidance diet is beneficial for these patients. |
Annals of Allergy, Asthma & Immunology. 2023 Nov 1;131(5):S67. | pediatric; gastroenterology; functional abdominal pain |
| Brestoff JR, Tesfazghi MT, Zaydman MA, Jackups R, Kim BS, Scott MG, Gronowski AM, Grossman BJ. | 2018 | The B antigen protects against the development of red meat allergy. ...Collectively, these findings suggest that expressing the B antigen may be protective against allergic sensitization to a-Gal and the development of RMA. Although patients who express the B antigen can undergo allergic sensitization to a-Gal and develop RMA, the likelihood of sensitization, degree of sensitization, and probability of disease appear to be markedly lower than in patients without the B antigen. To our knowledge, RMA is the first example where an ABO antigen may modulate the risk and perhaps the pathogenesis of a food allergy |
The Journal of Allergy and Clinical Immunology: In Practice. 2018; 6(5):1790-1. | blood type; B antigen; |
| Brestoff JR, Zaydman MA, Scott MG, Gronowski AM. | 2017 | ‡ Diagnosis of red meat allergy with antigen-specific IgE tests in serum. Letter to the editor ...Taken together, these findings indicate that the α-gal-bTG IgE test is the most useful for establishing a diagnosis of red meat allergy, although α-gal-biotin, beef, and pork IgE are also effective. The diagnostic value of the beef and pork IgE tests may relate to the presence of α-gal in beef and pork extracts used for IgE capture.1 Despite their favorable performance characteristics, these tests should be used and interpreted carefully. For example, none of these antigen-specific IgE tests can distinguish red meat allergy from tick allergy6 or cetuximab hypersensitivity,7 and pork IgE cannot discriminate between red meat allergy and pork-cat syndrome.8 In addition, 85% of helminth-infected patients have elevated α-gal IgE concentrations without evidence of red meat allergy.9 Therefore, the diagnostic value and interpretation of these tests depend on clinical context. We recommend measuring α-gal or beef IgE concentrations for diagnosis of red meat allergy only in patients who present with symptoms related to red meat exposure or who present with recurrent idiopathic anaphylaxis, angioedema, urticaria, or gastrointestinal symptoms. False positives should be considered in the above clinical scenarios or if the patient's symptoms do not improve after avoiding meat ingestion and/or if challenging with offending meats fails to elicit symptoms. |
Journal of Allergy and Clinical Immunology. 2017 Aug 1;140(2):608-10. | Primary care; diagnosis |
| Brockow K, Kneissl D, Valentini L, Zelger O, Grosber M, Kugler C, Werich M, Darsow U, Matsuo H, Morita E, Ring J. | 2015 | Using a gluten oral food challenge protocol to improve diagnosis of wheat-dependent exercise-induced anaphylaxis. Background: Oral wheat plus cofactors challenge tests in patients with wheat-dependent exercise-induced anaphylaxis (WDEIA) produce unreliable results. Objective: We sought to confirm WDEIA diagnosis by using oral gluten flour plus cofactors challenge, to determine the amount of gluten required to elicit symptoms, and to correlate these results with plasma gliadin levels, gastrointestinal permeability, and allergologic parameters. Methods: Sixteen of 34 patients with a history of WDEIA and ω5-gliadin IgE underwent prospective oral challenge tests with gluten with or without cofactors until objective symptoms developed. Gluten reaction threshold levels, plasma gliadin concentrations, gastrointestinal permeability, sensitivities and specificities for skin prick tests, and specific IgE levels were ascertained in patients and 38 control subjects. Results: In 16 of 16 patients (8 female and 8 male patients; age, 23-76 years), WDEIA was confirmed by challenges with gluten alone (n = 4) or gluten plus cofactors (n = 12), including 4 patients with previous negative wheat challenge results. Higher gluten doses or acetylsalicylic acid (ASA) plus alcohol instead of physical exercise were cofactors in 2 retested patients. The cofactors ASA plus alcohol and exercise increased plasma gliadin levels (P < .03). Positive challenge results developed after a variable period of time at peak or when the plateau plasma gliadin level was attained. Positive plasma gliadin threshold levels differed by greater than 100-fold and ranged from 15 to 2111 pg/mL (median, 628 pg/mL). The clinical history, IgE gliadin level, and baseline gastrointestinal level were not predictive of the outcomes of the challenge tests. The challenge-confirmed sensitivity and specificity of gluten skin prick tests was 100% and 96%, respectively. Conclusion: Oral challenge with gluten alone or along with ASA and alcohol is a sensitive and specific test for the diagnosis of WDEIA. Exercise is not an essential trigger for the onset of symptoms in patients with WDEIA. |
Journal of Allergy and Clinical Immunology. 2015 Apr 1;135(4):977-84. | Wheat-dependent exercise-induced anaphylaxis omega-5-gliadin gluten anaphylaxis cofactors plasma gliadin levels threshold levels oral challenge test |
| Browning R, Jerath M, Kendall P. | 2024 | Differential Expression of B cell Populations in Alpha-Gal Allergic Patients. ABSTRACT |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB264. | B cells; pathogenesis; cellular mechanisms |
| Browning R, Kalaidina E, Saligrama P, Lee I, Mantia T, Jerath M, Kendall P. | 2023 | Increased Population of CD19+ CCR6+ Cells Expressing Intracellular IgE in Alpha-Gal Allergic Patients. ABSTRACT |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB92. | cellular mechanisms; immunology; immunophenotype |
| Browning R, Le V, Jerath M. | 2022 | Alpha-Gal Allergy and Mast Cell Hyperactivity Overlap. Rationale: Galactose-alpha-1,3-galactose (alpha-gal) allergy is often initially misdiagnosed as chronic urticaria or idiopathic anaphylaxis (here collectively referred to as mast cell hyperactivity [MCH]). However, a subset of alpha-gal allergic patients also have concurrent MCH. Here we compare characteristics of these populations. Methods: Within our practice, we identified a cohort of 65 patients with alpha-gal allergy, fourteen of whom also have MCH. Medical record review was performed to compare age, gender, alpha-gal IgE, other atopic conditions, comorbidities, and tick bite history. Results: Patients with alpha-gal allergy and MCH, as compared to those with alpha-gal allergy alone, were more likely to have GERD (64% vs 33%, p=0.03), migraine (21% vs 4%, p=0.03), psychiatric diagnosis (57% vs 27%, p=0.04), multiple psychiatric diagnoses (34% vs 12%, p=0.03), and stinging insect allergy (33% vs 2%, p=0.001). Although both groups were equally likely to have other atopic disease (79% vs 76%, p=0.87), those with MCH were more likely to have multiple other atopic conditions (50% vs 20%, p=0.02). There was no significant difference in average age (42.5 vs 48.6 years, p=0.26), initial alpha-gal IgE (6.41 vs 16.05, p=0.21), diabetes (7% vs 8%, p=0.93), hypertension (7% vs 24%, p=0.18), or cardiovascular disease (0% vs 12%, p=0.18). Although the difference was not significant, patients with both alpha-gal and MCH are more likely to be female (71% vs 53%, p=0.22). Greater than 90% of both groups reported previous tick bite. Conclusions: Combined alpha-gal and MCH is associated with increased prevalence of GERD, migraine, psychiatric conditions, and multiple other atopic conditions. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB201. | mast cell; comorbidity |
| Brzozowska M, Mokrzycka N, PoreBski G. | 2021 | Alpha-gal syndrome: the first report in Poland. |
Central-European Journal of Immunology. 2021;46(3):398. | Europe; Poland |
| Burk CM, Beitia R, Lund PK, Dellon ES. | 2016 | High rate of galactose-alpha-1,3-galactose sensitization in both eosinophilic esophagitis and patients undergoing upper endoscopy. Eosinophilic esophagitis (EoE) is an antigen/allergy-mediated chronic inflammatory condition. The rapid rise in the number of cases of EoE suggests an as-yet undiscovered environmental trigger. This study tested the hypothesis that immunoglobulin E (IgE) to galactose-alpha-1,3-galactose (alpha-gal), a newly recognized sensitization induced by a tick bite that causes mammalian meat allergy, is a risk factor for EoE. We conducted a case-control study using prospectively collected and stored samples in the University of North Carolina EoE Patient Registry and Biobank. Serum from 50 subjects with a new diagnosis of EoE and 50 non-EoE subjects (either with gastroesophageal reflux disease or dysphagia from non-EoE etiologies) was tested for alpha-gal-specific IgE using an ImmunoCAP-based method. Specific IgE > 0.35 kUA /L was considered a positive result. Subjects with EoE were a mean of 35 years old, 68% were male, and 94% were white. Non-EoE controls were a mean of 42 years, 50% were male, and 78% were white. A total of 22 (22%) subjects overall had alpha-gal-specific IgE > 0.35 kUA /L. Of the EoE cases, 12 (24%) were positive, and of the non-EoE controls, 10 (20%) were positive (p=0.63). Neither the proportion sensitized nor the absolute values differed between EoE and non-EoE subjects. We found a similar but high rate of alpha-gal sensitization in patients with EoE as found in non-EoE controls who were undergoing endoscopy. While our data do not support alpha-gal sensitization as a risk factor for EoE, the high rates of sensitization observed in patients undergoing upper endoscopy for symptoms of esophageal dysfunction is a new finding. |
Diseases of the Esophagus. 2016 Sep 1;29(6):558-62. | eosinophilic esophagitis; EE; gastroenterology |
| Burrows AG, Ellis AK. | 2021 | Idiopathic anaphylaxis: Diagnosis and management.> Introduction: Idiopathic anaphylaxis (IA) is a diagnosis of exclusion and is based on the inability to identify a causal relationship between a trigger and an anaphylactic event, despite a detailed patient history and careful diagnostic assessment. The prevalence of IA among the subset of people who experienced anaphylaxis is challenging to estimate and varies widely, from 10 to 60%; most commonly noted is ∼20% in the adult anaphylactic population. Comorbid atopic conditions, such as food allergy, allergic rhinitis, and asthma, are present in up to 48% of patients with IA. Improved diagnostic technologies and an increased understanding of conditions that manifest with symptoms associated with anaphylaxis have improved the ability to determine a more accurate diagnosis for patients who may have been initially diagnosed with IA. Methods: Literature search was conducted on PubMed, Google Scholar and Embase. Results: Galactose-α-1,3-galactose (α-gal) allergy, mast cell disorders, and hereditary a-tryptasemia are a few differential diagnoses that should be considered in patients with IA. Unlike food allergy, when anaphylaxis occurs within minutes to 2 hours after allergen consumption, α-gal allergy is a 3–6-hour delayed immunoglobulin E–mediated anaphylactic reaction to a carbohydrate epitope found in red meat (e.g., beef, lamb, pork). The more recently described hereditary α-tryptasemia is an inherited autosomal dominant genetic trait caused by increased germline copies of tryptase human gene alpha-beta 1 (TPSAB1), which encodes α tryptase and is associated with elevated baseline serum tryptase. Acute management of IA consists of carrying an epinephrine autoinjector to be administered immediately at the first signs of anaphylaxis. Long-term management for IA with antihistamines and other agents aims to potentially reduce the frequency and severity of the anaphylactic reactions, although the evidence is limited. Biologics are potentially steroid-sparing for patients with IA; however, more research on IA therapies is needed. Conclusion: The lack of diagnostic criteria, finite treatment options, and intricacies of making a differential diagnosis make IA challenging for patients and clinicians to manage |
InAllergy & Asthma Proceedings 2021 Nov 1 (Vol. 42, No. 6). | Idiopathic anaphylaxis |
| Butler RA, Papeş M, Vogt JT, Paulsen DJ, Crowe C, Trout Fryxell RT. | 2024 | Human risk to tick encounters in the southeastern United States estimated with spatial distribution modeling. |
PLOS Neglected Tropical Diseases. 2024 Feb 14;18(2):e0011919. | vector; tick; lone star tick; Amblyomma americanum |
| Butler WK, Oltean HN, Dykstra EA, Saunders E, Salzer JS, Commins SP. | 2025 | Onset of Alpha-Gal Syndrome after Tick Bite, Washington, USA. |
Emerging infectious diseases. 2025 Apr;31(4):829-32. | North America; United States; vector; Ixodes pacifica |
| Bylsma LC, Dean R, Lowe K, Sangaré L, Alexander DD, Fryzek JP. | 2019 | The incidence of infusion reactions associated with monoclonal antibody drugs targeting the epidermal growth factor receptor in metastatic colorectal cancer patients: A systematic literature review and meta-analysis of patient and study characteristics. BACKGROUND: Systemic cancer therapies may induce infusion reactions (IRs) or hypersensitivities. Metastatic colorectal cancer (mCRC) patients treated with anti-EGFR therapies, including cetuximab and panitumumab, may be subject to these reactions. We conducted a meta-analysis to estimate the IR incidence in this population and identify variations in this incidence by patient or study characteristics. METHODS: A systematic review was conducted to identify observational studies or clinical trials of mCRC patients treated with anti-EGFR therapies that reported occurrences of IRs, hypersensitivity, or allergy/anaphylaxis. The objective of the study was to estimate the incidence of IRs. Random effects models were used to meta-analyze the incidence of IRs overall and stratified by therapy type, study design, geographic location, RAS or KRAS mutation status, grade of reaction severity, and terminology used to describe the reaction. RESULTS: The pooled estimate for IR incidence was 4.9% (95% confidence interval: 3.6%-6.5%). Lower-grade reactions were more common than higher-grade reactions overall and the incidence of reactions among cetuximab patients was nearly four times that of panitumumab patients (6.1% vs 1.6%). CONCLUSIONS: IRs occur in approximately 5% of mCRC patients treated with anti-EGFR therapies, and the incidence varies significantly by grade of severity and therapy type. Studies evaluating these outcomes should consider investigating survival outcomes by IR status to determine its prognostic relevance. |
Cancer medicine. 2019 Sep;8(12):5800-9. | Cancer; mAb; monoclonal antibody; biologic; biological agent; perioperative; review article |
| Caballero ML, Krantz MS, Quirce S, Phillips E, Stone Jr CA. | 2021 | Hidden Dangers: Recognizing Excipients as Potential Causes of Drug and Vaccine Hypersensitivity Reactions Excipients are necessary as a support to the active ingredients in drugs, vaccines and other products and they contribute to their stability, preservation, pharmacokinetics, bioavailability, appearance and acceptability. For both drugs and vaccines these are rare reactions however for vaccines they are the primary cause of immediate hypersensitivity. Suspicion for these “hidden dangers” should be high in particular when anaphylaxis has occurred in association with multiple chemically distinct drugs. Common excipients implicated include gelatin, carboxymethylcellulose (CMC), polyethylene glycols (PEG) and products related to PEG in immediate hypersensitivity reactions (IHRs); and propylene glycol (PG), in delayed hypersensitivity reactions (DHRs). Complete evaluation of a suspected excipient reaction requires detailed information from the product monograph and package insert to identify all ingredients that are present and to understand the function and structure for these chemicals. This knowledge helps develop a management plan that may include allergy testing to identify the implicated component and to give patients detailed information for future avoidance of relevant foods, drugs and vaccines. Excipient reactions should be particularly considered for specific classes of drugs where they have been commonly found to be the culprit (e.g. corticosteroids, injectable hormones, immunotherapies, monoclonal antibodies, and vaccines). We provide a review of the evidence-based literature outlining epidemiology and mechanisms of excipient reactions and provide strategies for heightened recognition and allergy testing. |
The Journal of Allergy and Clinical Immunology: In Practice. 2021 Mar 15 | Drugs; medical products; gelatin |
| Cabezas Cruz A, Valdés JJ, De La Fuente J. | 2016 | Control of vector-borne infectious diseases by human immunity against α-Gal. The World Health Organization estimates that 1 billion individuals suffer from vector-borne diseases (VBDs), accounting for 17% of all infectious diseases worldwide, and 1 million of these individuals die annually due to VBDs. In addition, recent reports highlight a disturbing picture regarding the current situation of VBDs in the continental Europe [1], UK [2], and China [3]. These diseases are caused by pathogens transmitted by arthropod vectors such as ticks (e.g. Lyme disease caused by Borrelia burgdorferi, human granulocytic anaplasmosis caused by Anaplasma phagocytophilum, and tick-borne encephalitis (TBE) caused by TBE virus), mosquitoes (e.g. malaria caused by Plasmodium spp. and dengue fever caused by dengue virus), phlebotomine sand flies (e.g. various forms of human leishmaniasis caused by Leishmania spp.), tsetse flies (e.g. sleeping sickness caused by Trypanosoma brucei), and Triatomine bugs (e.g. Chagas disease caused by Trypanosoma cruzi) [4,5]. Effective vaccination strategies to control most of the VBDs have not been successfully developed or implemented, and the use of insecticides and/or chemotherapy has resulted in an increasing number of insecticide-resistant vectors and drug-resistant pathogens [4]. Therefore, alternative strategies for control of VBDs are urgently needed. In the context of the increasing burden of emerging VBDs worldwide, we propose the use of probiotics composed of bacteria producing the carbohydrate α-Gal as dietary supplements to control VBDs. Although previous studies have shown that anti-α-Gal antibodies in human serum do not induce 100% killing of Plasmodium [22], the use of probiotics containing bacteria-producing α-Gal may alter host natural response to this carbohydrate resulting in increased protection to parasite infection. Considering the results of previous studies [11,19,20], while probiotics such as Lactobacillus spp. may constitute the appropriate carrier of α-Gal in probiotic-based vaccines against vector-borne pathogens, the combination with TLR4 agonists may be needed to develop a potent and protective immune response against this carbohydrate. Future studies should focus on the characterization of the mechanisms involved in the immune response to α-Gal. This antibody response may be effective against different vector-borne pathogens that contain α-Gal on their surface. Therefore, the probiotics-based vaccines exploiting this major evolutionary adaptation may constitute an effective strategy to reduce the impact of VBDs on human health. Although the road to probiotic-based vaccines appears to be challenging, the rational design of vaccines exploiting the special immunity of human to α-Gal may be our best strategic move to win our battle against VBDs. |
Expert Review of Vaccines. 2016 Apr 19;15(8) 953-5. | |
| Cabezas-Cruz A, de la Fuente J, Fischer J, Hebsaker J, Lupberger E, Blumenstock G, Aichinger E, Yazdi AS, Enkel S, Oehme R, Biedermann T. | 2017 | Prevalence of type I sensitization to alpha-gal in forest service employees and hunters: Is the blood type an overlooked risk factor in epidemiological studies of the alpha-Gal syndrome? Comment on: Prevalence of type I sensitization to alpha-gal in forest service employees and hunters. Fischer J, Lupberger E, Hebsaker J, Blumenstock G, Aichinger E, Yazdi AS, Reick D, Oehme R, Biedermann T. Allergy. 2017 Oct;72(10):1540-1547. doi: 10.1111/all.13156. Epub 2017 May 10. PMID: 28273338 |
Allergy 2017; 72(12): 2044-2047. | |
| Cabezas-Cruz A, de la Fuente J. | 2020 | Immunity to α-Gal: toward a single-antigen pan-vaccine to control major infectious diseases. Infectious diseases constitute a growing burden for human health worldwide. In particular, vector-borne diseases account for 17% of all infectious diseases and kill about 1 million people annually.(1) These diseases are caused by a diverse group of pathogens including viruses, bacteria, and protozoa that are transmitted by arthropod vectors such as ticks, mosquitoes, sandflies, kissing bugs, and tsetse flies.(1) Among the nonviral vector-borne diseases, malaria, leishmaniasis, Chagas disease, sleeping sickness, and Lyme disease represent the highest burden to human health. Further, vaccines are not available for the prevention and control of these diseases.(2) Among non-vector-borne diseases, tuberculosis caused by mycobacteria of the Mycobacterium tuberculosis complex is one of the world’s most common causes of death from infectious diseases.(3) All pathogens producing these deadly diseases have something in common: the galactose-alpha-1,3-galactose (α-Gal) epitope exposed on their surface (Table 1). During evolution, humans lost the ability to synthesize the carbohydrate α-Gal, which resulted in an almost unique capacity to produce high antibody titers against α-Gal.(4) The immunity to α-Gal may neutralize the pathogens with α-Gal on their surface, and therefore the induction of this protective immune response may constitute an effective intervention for the prevention and control of infectious diseases.(5) The study of the anti-α-Gal immunity will provide the basis to develop a single-antigen “pan-vaccine” to control major infectious diseases. |
ACS Central Science. 2017; 3(11): 1140-2. | pan-vaccine |
| Cabezas-Cruz A, de la Fuente, J. | 2017 | Immunity to α-Gal: The Opportunity for Malaria and Tuberculosis Control. Among all infectious diseases, malaria and tuberculosis constitute leading causes of morbidity and mortality of human populations in developed and undeveloped countries. In 2015, the WHO reported that 10.4 million people had tuberculosis and 1.8 million of them died from the disease. Despite a reduction of malaria cases between 2000 and 2015, the WHO reported 212 million cases and 429,000 deaths due to this disease in 2015 alone. Drug resistance to first-line antimalarial drugs (e.g., chloroquine, sulfadoxine–pyrimethamine, and artemisinin) is a major constrain of malaria control Sub-Saharan Africa. Likewise, multidrug-resistant tuberculosis is a growing problem worldwide. Thus, the control of these diseases is among the most challenging tasks of public health worldwide. Drug overuse and misuse are recognized as the main drivers of drug resistance in parasites and pathogenic bacteria. The identification of genetic factors affecting the susceptibility to these infectious diseases is essential toward reducing drug overuse and inappropriate treatment regimes. In this opinion, we propose that blood groups, a major driver of anti-α-Gal immunity and malaria and tuberculosis incidence, can be used to tailor anti-malaria and anti-tuberculosis vaccination. Blood group A and O individuals, that can potentially develop strong anti-α-Gal immunity, could be immunized with probiotic-based vaccines to enhance the natural levels of anti-α-Gal antibodies. This immunity could lead to protection against these diseases which in turn would reduce the use of anti-malaria and anti-tuberculosis drugs. |
Frontiers in immunology. 2017 Dec;8:1733. | |
| Cabezas-Cruz A, Espinosa PJ, Alberdi P, Šimo L, Valdés JJ, Mateos-Hernández L, Contreras M, Rayo MV, de la Fuente J. | 2018 | Tick galactosyltransferases are involved in alpha-Gal synthesis and play a role during Anaplasma phagocytophilum infection and Ixodes scapularis tick vector development. The carbohydrate Gal alpha 1-3Gal beta 1-(3)4GlcNAc-R (alpha-Gal) is produced in all mammals except for humans, apes and old world monkeys that lost the ability to synthetize this carbohydrate. Therefore, humans can produce high antibody titers against alpha-Gal. Anti-alpha-Gal IgE antibodies have been associated with tick-induced allergy (i.e. alpha-Gal syndrome) and anti-alpha-Gal IgG/IgM antibodies may be involved in protection against malaria, leishmaniasis and Chagas disease. The alpha-Gal on tick salivary proteins plays an important role in the etiology of the alpha-Gal syndrome. However, whether ticks are able to produce endogenous alpha-Gal remains currently unknown. In this study, the Ixodes scapularis genome was searched for galactosyltransferases and three genes were identified as potentially involved in the synthesis of alpha-Gal. Heterologous gene expression in alpha-Gal-negative cells and gene knockdown in ticks confirmed that these genes were involved in alpha-Gal synthesis and are essential for tick feeding. Furthermore, these genes were shown to play an important role in tick-pathogen interactions. Results suggested that tick cells increased alpha-Gal levels in response to Anaplasma phagocytophilum infection to control bacterial infection. These results provided the molecular basis of endogenous alpha-Gal production in ticks and suggested that tick galactosyltransferases are involved in vector development, tick-pathogen interactions and possibly the etiology of alpha-Gal syndrome in humans. |
Scientific reports. 2018;8(1):1-8. | |
| Cabezas-Cruz A, Hodžić A, Mateos-Hernández L, Contreras M, de la Fuente J. | 2021 | Tick–human interactions: from allergic klendusity to the α-Gal syndrome. Ticks and the pathogens they transmit, including bacteria, viruses, protozoa, and helminths, constitute a growing burden for human and animal health worldwide. The ability of some animal species to acquire resistance to blood-feeding by ticks after a single or repeated infestation is known as acquired tick resistance (ATR). This resistance has been associated to tick-specific IgE response, the generation of skin-resident memory CD4+ T cells, basophil recruitment, histamine release, and epidermal hyperplasia. ATR has also been associated with protection to tick-borne tularemia through allergic klendusity, a disease-escaping ability produced by the development of hypersensitivity to an allergen. In addition to pathogen transmission, tick infestation in humans is associated with the α-Gal syndrome (AGS), a type of allergy characterized by an IgE response against the carbohydrate Galα1-3Gal (α-Gal). This glycan is present in tick salivary proteins and on the surface of tick-borne pathogens such as Borrelia burgdorferi and Anaplasma phagocytophilum, the causative agents of Lyme disease and granulocytic anaplasmosis. Most α-Gal-sensitized individuals develop IgE specific against this glycan, but only a small fraction develop the AGS. This review summarizes our current understanding of ATR and its impact on the continuum α-Gal sensitization, allergy, and the AGS. We propose that the α-Gal-specific IgE response in humans is an evolutionary adaptation associated with ATR and allergic klendusity with the trade-off of developing AGS. |
Biochemical Journal. 2021 May 14;478(9):1783-94. | |
| Cabezas-Cruz A, Hodžić A, Román-Carrasco P, Mateos-Hernández L, Duscher GG, Sinha DK, Hemmer W, Swoboda I, Estrada-Peña A, De La Fuente J. | 2019 | Environmental and Molecular Drivers of the alpha-Gal Syndrome. The alpha-Gal syndrome (AGS) is a type of allergy characterized by an IgE antibody (Ab) response against the carbohydrate Galalpha1-3Galbeta1-4GlcNAc-R (alpha-Gal), which is present in glycoproteins from tick saliva and tissues of non-catarrhine mammals. Recurrent tick bites induce high levels of anti-alpha-Gal IgE Abs that mediate delayed hypersensitivity to consumed red meat products in humans. This was the first evidence that tick glycoproteins play a major role in allergy development with the potential to cause fatal delayed anaphylaxis to alpha-Gal-containing foods and drugs and immediate anaphylaxis to tick bites. Initially, it was thought that the origin of tick-derived alpha-Gal was either residual blood meal mammalian glycoproteins containing alpha-Gal or tick gut bacteria producing this glycan. However, recently tick galactosyltransferases were shown to be involved in alpha-Gal synthesis with a role in tick and tick-borne pathogen life cycles. The tick-borne pathogen Anaplasma phagocytophilum increases the level of tick alpha-Gal, which potentially increases the risk of developing AGS after a bite by a pathogen-infected tick. Two mechanisms might explain the production of anti-alpha-Gal IgE Abs after tick bites. The first mechanism proposes that the alpha-Gal antigen on tick salivary proteins is presented to antigen-presenting cells and B-lymphocytes in the context of Th2 cell-mediated immunity induced by tick saliva. The second mechanism is based on the possibility that tick salivary prostaglandin E2 triggers Immunoglobulin class switching to anti-alpha-Gal IgE-producing B cells from preexisting mature B cells clones producing anti-alpha-Gal IgM and/or IgG. Importantly, blood group antigens influence the capacity of the immune system to produce anti-alpha-Gal Abs which in turn impacts individual susceptibility to AGS. The presence of blood type B reduces the capacity of the immune system to produce anti-alpha-Gal Abs, presumably due to tolerance to alpha-Gal, which is very similar in structure to blood group B antigen. Therefore, individuals with blood group B and reduced levels of anti-alpha-Gal Abs have lower risk to develop AGS. Specific immunity to tick alpha-Gal is linked to host immunity to tick bites. Basophil activation and release of histamine have been implicated in IgE-mediated acquired protective immunity to tick infestations and chronic itch. Basophil reactivity was also found to be higher in patients with AGS when compared to asymptomatic alpha-Gal sensitized individuals. In addition, host resistance to tick infestation is associated with resistance to tick-borne pathogen infection. Anti-alpha-Gal IgM and IgG Abs protect humans against vector-borne pathogens and blood group B individuals seem to be more susceptible to vector-borne diseases. The link between blood groups and anti-alpha-Gal immunity which in turn affects resistance to vector-borne pathogens and susceptibility to AGS, suggests a trade-off between susceptibility to AGS and protection to some infectious diseases. The understanding of the environmental and molecular drivers of the immune mechanisms involved in AGS is essential to developing tools for the diagnosis, control, and prevention of this growing health problem. |
Front Immunology 2019; 10: 1210. | |
| Cabezas-Cruz A, Mateos-Hernández L, Alberdi P, Villar M, Riveau G, Hermann E, Schacht AM, Khalife J, Correia-Neves M, Gortazar C, De La Fuente J. | 2017 | Effect of blood type on anti-alpha-Gal immunity and the incidence of infectious diseases. The identification of factors affecting the susceptibility to infectious diseases is essential toward reducing their burden on the human population. The ABO blood type correlates with susceptibility to malaria and other infectious diseases. Due to the structural similarity between blood antigen B and Gal alpha 1-3Gal beta 1-(3)4GlcNAc-R (alpha-Gal), we hypothesized that self-tolerance to antigen B affects the immune response to alpha-Gal, which in turn affects the susceptibility to infectious diseases caused by pathogens carrying alpha-Gal on their surface. Here we found that the incidence of malaria and tuberculosis, caused by pathogens with alpha-Gal on their surface, positively correlates with the frequency of blood type B in endemic regions. However, the incidence of dengue fever, caused by a pathogen without alpha-Gal, was not related to the frequency of blood type B in these populations. Furthermore, the incidence of malaria and tuberculosis was negatively correlated with the anti-alpha-Gal antibody protective response. These results have implications for disease control and prevention. |
Experimental & molecular medicine 2017; 49(3): e301. | |
| Cabezas-Cruz A, Mateos-Hernández L, Chmelař J, Villar M, de la Fuente J. | 2017 | Salivary Prostaglandin E2: Role in Tick-Induced Allergy to Red Meat. Tick-induced allergy to red meat is associated with anti-alpha-Gal IgE antibody levels. We propose that tick salivary prostaglandin E2 triggers antibody class switching in mature B cells, increasing the levels of anti-alpha-Gal IgE antibodies. Immune tolerance to alpha-Gal in blood type B individuals might reduce the risk to this allergy. |
Trends Parasitol 2017; 33(7): 495-498. | |
| Cabezas-Cruz A, Mateos-Hernández L, Pérez-Cruz M, Valdés JJ, De Mera IGF, Villar M, de la Fuente J. | 2015 | Regulation of the Immune Response to alpha-Gal and Vector-borne Diseases. Vector-borne diseases (VBD) challenge our understanding of emerging diseases. Recently, arthropod vectors have been involved in emerging anaphylactic diseases. In particular, the immunoglobulin E (IgE) antibody response to the carbohydrate Galalpha1-3Galbeta1-(3)4GlcNAc-R (alpha-gal) following a tick bite was associated with allergies to red meat, cetuximab, and gelatin. By contrast, an anti-alpha-gal IgM antibody response was shown to protect against mosquito-borne malaria. Herein, we highlight the interplay between the gut microbiota, vectors, transmitted pathogens, and the regulation of the immune response as a model to understand the protective or allergic effect of alpha-gal. Establishing the source of alpha-gal in arthropod vectors and the immune response to vector bites and transmitted pathogens will be essential for diagnosing, treating, and ultimately preventing these emerging anaphylactic and other vector-borne diseases. |
Trends Parasitol 2015; 31(10): 470-476. | |
| Cabezas-Cruz A, Valdés J, de la Fuente J. | 2014 | Cancer research meets tick vectors for infectious diseases. Continuous human exploitation of environmental resources and an increase in human outdoor activities have led to more contact with arthropod vectors, promoting an emergence and resurgence of tick-borne pathogens. Clinical trials of cetuximab, a monoclonal antibody that inhibits epidermal growth factor receptor used for treatment of metastatic colorectal cancer, have shown that the drug produces more hypersensitivity than expected, with some fatal cases. Patients who developed these hypersensitivity reactions were deemed to have pre-existing IgE antibodies specific to the alpha-gal present in the variable portion of cetuximab. |
The Lancet. Infectious diseases. 2014 Oct;14(10):916. | |
| Caglayan-Sozmen S, Santoro A, Cipriani F, Mastrorilli C, Ricci G, Caffarelli C. | 2019 | † Hazardous Medications in Children with Egg, Red Meat, Gelatin, Fish, and Cow's Milk Allergy. Childhood food allergies are a growing public health problem. Once the offending food allergens have been identified, a strict elimination diet is necessary in treatment or prevention of most of the allergic reactions. Accidental food ingestion can lead to severe anaphylaxis. Food- derived substances can be used in medications at various stages of the manufacturing process. In this review, the possible roles of medications which may contain egg, red meat, gelatin, and fish allergens on allergic reactions in children with food allergy were evaluated. |
Medicina-Lithuania 2019; 55(8) 501. | Medication; pharmaceutical; pharmacy; vaccination; vaccine; review article; primary care physician; pharmacy; pharmacist; perioperative care |
| Calafiore AM, Haverich A, Gaudino M, Di Mauro M, Fattouch K, Prapas S, Zilla P. | 2022 | Immunoreaction to xenogenic tissue in cardiac surgery: alpha-Gal and beyond. > The ability of the immune system to distinguish self from non-self, reacting only to non-self, is essential for immune homeostasis. The mechanisms by which the immune system recognizes and responds to xenogenic tissue heart valves likely involve the initial activation of the innate immune system, with subsequent adaptive immune activation. The antigenicity of xenogeneic tissue constructs, primarily of porcine and bovine origin, has been extensively investigated and several antigenic epitopes have been identified. Some of them have been more exhaustively studied to avoid or at least reduce the immunoreaction triggered by their presence. |
European Journal of Cardio-Thoracic Surgery. 2022 Feb 25. | Cardiac surgery; bioprosthetic heart valve, xenotransplantation |
| Calamari AM, Poppa M, Villalta D, Pravettoni V. | 2015 | Alpha-gal anaphylaxis: the first case report in Italy. We report the case of a 55-year-old man who went into anaphylactic shock six hours after eating a meal containing meat. He reported having had several tick bites in months before the reaction. The serum specific IgE showed strong positivity to alpha-gal. This is clearly alpha-gal anaphylaxis with delayed onset after meat ingestion caused by tick bite, confirmed by alpha-gal IgE positivity. |
European annals of allergy and clinical immunology. 2015 Sep;47(5):161-2. | Europe; Italy |
| Campbell E, Peebles S, Stone C, Zhang J, Hadadianpour A, Doyle J, Smith S. | 2021 | Evaluation of alpha gal in vaccines and medications using a human monoclonal IgE antibody. |
Journal of Allergy and Clinical Immunology. 2021 Feb 1;147(2):AB7. | medical products; vaccine; |
| Caponetto P, Biedermann T, Yazdi AS, Fischer J. | 2015 | Panitumumab: A safe option for oncologic patients sensitized to galactose-alpha-1,3-galactose. This case describes the treatment with panitumumab of a patient who is highly sensitized to galactose-α-1,3-galactose but also in need of a treatment with an anti–epidermal growth factor receptor mAb due to chemotherapy-refractory metastatic colorectal cancer. |
Journal of Allergy and Clinical Immunology-in Practice 2015; 3(6): 982-983. | biologic; biological agent; monoclonal antibody; mAb; oncology; colon cancer |
| Caponetto P, Fischer J, Biedermann T. | 2013 | * Gelatin-containing sweets can elicit anaphylaxis in a patient with sensitization to galactose-α-1,3-galactose. Gelatin-containing sweets can elicit anaphylaxis in mammalian meat allergic patients. A warning regarding gelatin-containing foods and medical products should be included in recommendations for patients with IgE recognizing Galactose-α-1,3-Galactose. |
The Journal of Allergy and Clinical Immunology: In Practice. 2013 May 1;1(3):302-3. | oral consumption of gelatin; gelatine; food; organs; intestines; tachycardia; dizziness; prick-to-prick test |
| Carlson JC. | 2023 | Alpha-gal syndrome is an immunoparasitologic disease. |
Annals of Allergy, Asthma & Immunology. 2023 Apr 1;130(4):405-6. | vectors; avoidance |
| Carlsson M, Braddock M, Li Y, Wang J, Xu W, White N, Megally A, Hunter G, Colice G. | 2019 | Evaluation of antibody properties and clinically relevant immunogenicity, anaphylaxis, and hypersensitivity reactions in two phase III trials of tralokinumab in severe, uncontrolled asthma. Introduction: Tralokinumab is a monoclonal antibody (mAb) that neutralizes interleukin (IL)-13, a cytokine involved in the pathogenesis of asthma. Objective: The objectives of this study were to characterize the potential immunogenic properties of tralokinumab and report data for anti-drug antibodies (ADAs) and hypersensitivity reactions from two phase III clinical trials. Methods: The oligosaccharide structure of tralokinumab, Fab-arm exchange, and ADAs were characterized by standard techniques. Hypersensitivity adverse events (AEs) were evaluated in two pivotal clinical trials of tralokinumab in severe, uncontrolled asthma: STRATOS 1 and 2 (NCT02161757 and NCT02194699). Results: No galactose-α-1,3-galactose (α-Gal) epitopes were found in the Fab region of tralokinumab and only 4.5% of glycoforms contained α-Gal in the Fc region. Under non-reducing conditions, Fab-arm exchange did not take place with another immunoglobulin (Ig) G4 mAb (mavrilimumab). However, following glutathione reduction, a hybrid antibody with monovalent bioactivity was detected. ADA incidences (titers) were as follows: STRATOS 1—every 2 weeks (Q2 W) 0.8% (26.0), every 4 weeks (Q4 W) 0.5% (26.0), placebo 0.8% (52.0); STRATOS 2—Q2 W 1.2% (39.0), placebo 0.8% (13.0). Participant-reported hypersensitivity AE rates were as follows: STRATOS 1—Q2 W 25.9%, Q4 W 25.0%, placebo 25.5%; STRATOS 2—Q2 W 13.2%, placebo 9.0%. External evaluation for anaphylaxis by Sampson criteria found no tralokinumab-related severe hypersensitivity or anaphylaxis reactions. Conclusion: Preclinical assessments suggested a low likelihood of immunogenicity for tralokinumab. In STRATOS 1 and 2, ADA incidence was low, no differences were found between tralokinumab-treated and placebo groups in reporting of hypersensitivity reactions, and there were no Sampson criteria-evaluated anaphylaxis events with tralokinumab treatment. Together, the results suggest that tralokinumab treatment would not increase the risk for severe hypersensitivity or anaphylactic reactions. |
Drug safety. 2019 Jun 4;42(6):769-84. | pharmacy; pharmaceutical; biologic; biological agent; monoclonal antibody; mAb; tralokinumab; asthma; atopic dermatitis; ulcerative colitis |
| Carlstrom L, Akhter A, Macielak R, Callejas C, Eickstaedt J, Brooks C, VanKoevering KK, Schoo D, Wu KC, Prevedello D. | 2024 | Neurosurgical Management of Patients with Alpha-Gal Syndrome |
Journal of Neurological Surgery Reports 2024. | perioperative; neurology; neurosurgery |
| Caron L, Ortolani VG, Bono E, Ratti CP, Iemoli E. | 2022 | Alpha-gal syndrome and delayed anaphylaxis after ingestion of red meat: A case report. |
Allergologie Select. 2022;6:299. | Europe; Italy |
| Carpenter A, Drexler NA, McCormick DW, Thompson JM, Kersh G, Commins SP, Salzer JS. | 2023 | Health care provider knowledge regarding alpha-gal syndrome—United States, March–May 2022. Alpha-gal syndrome (AGS) is an emerging, tick bite–associated immunoglobulin E–mediated allergic condition characterized by a reaction to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal), which is found in mammalian meat and products derived from mammals, including milk, other dairy products, and some pharmaceutical products. Symptoms range from mild (e.g., a rash or gastrointestinal upset) to severe (anaphylaxis); onset typically occurs ≥2 hours after exposure to alpha-gal. No treatment or cure is currently available. Despite the potential life-threating reactions associated with AGS, most patients perceive that health care providers (HCPs) have little or no knowledge of AGS. A U.S. web-based survey of 1,500 HCPs revealed limited knowledge of AGS, identified areas for continuing medical education, and described self-reported diagnostic and management practices. Overall, 42% of surveyed HCPs had never heard of AGS, and among those who had, fewer than one third knew how to diagnose the condition. Two thirds of respondents indicated that guidelines for the diagnosis and management of AGS would be useful clinical resources. Limited awareness and knowledge of AGS among HCPs likely contributes to underdiagnosis of this condition and inadequate patient management, and underestimates of the number of AGS patients in the United States, which currently relies on laboratory testing data alone. |
MMWR. Morbidity and Mortality Weekly Report. 2023;72. | HCP; provider awareness; physician awareness; education; underdiagnosis; |
| Carroll JF. | 2003 | A cautionary note: survival of nymphs of two species of ticks (Acari: Ixodidae) among clothes laundered in an automatic washer. |
Journal of medical entomology. 2003 Sep 1;40(5):732-6. | vector; lone star tick; prevention; laundry; dryer |
| Carson AS, Gardner A, Iweala OI. | 2022 | Where’s the Beef? Understanding Allergic Responses to Red Meat in Alpha-Gal Syndrome. Alpha-gal syndrome (AGS) describes a collection of symptoms associated with IgE-mediated hypersensitivity responses to the glycan galactose-alpha-1,3-galactose (alpha-gal). Individuals with AGS develop delayed hypersensitivity reactions, with symptoms occurring >2 h after consuming mammalian (“red”) meat and other mammal-derived food products. The mechanisms of pathogenesis driving this paradigm-breaking food allergy are not fully understood. We review the role of tick bites in the development of alpha-gal–specific IgE and highlight innate and adaptive immune cells possibly involved in alpha-gal sensitization. We discuss the impact of alpha-gal glycosylation on digestion and metabolism of alpha-gal glycolipids and glycoproteins, and the implications for basophil and mast cell activation and mediator release that generate allergic symptoms in AGS. |
The Journal of Immunology. 2022 Jan 15;208(2):267-77. | review |
| Carter B, Chau T, Underhill C, Stackhouse C, Kamran A. | 2024 | Consider Alpha-gal Syndrome in Patients with Delayed Allergic Reactions after Tick Exposure. |
Emergency Medicine News. 2024 Jun 25;46(6C):10-97. | first responder; emergency medicince; Emergency department |
| Carter MC, Akin C, Castells MC, Scott EP, Lieberman P. | 2020 | Idiopathic anaphylaxis yardstick: Practical recommendations for clinical practice. Anaphylaxis is considered idiopathic when there is no known trigger. The signs and symptoms of idiopathic anaphylaxis (IA) are identical to those of anaphylaxis because of a known cause and can include cutaneous, circulatory, respiratory, gastrointestinal, and neurologic symptoms. Idiopathic anaphylaxis can be a frustrating disease for patients and health care providers. Episodes are unpredictable, and differential diagnosis is challenging. Current anaphylaxis guidelines have little specific guidance regarding differential diagnosis and long-term management of IA. Therefore, the objective of the Idiopathic Anaphylaxis Yardstick is to use published data and the authors' combined clinical experience to provide practical recommendations for the diagnosis and management of patients with IA. |
Annals of Allergy, Asthma & Immunology. 2020 Jan 1;124(1):16-27. | iodpathic anaphylaxis; IA |
| Carter MC, Ruiz‐Esteves KN, Workman L, Lieberman P, Platts‐Mills TAE, Metcalfe DD. | 2018 | Identification of alpha-gal sensitivity in patients with a diagnosis of idiopathic anaphylaxis. IgE antibodies (Ab) specific to galactose-α-1,3-galactose (alpha-gal) are responsible for a delayed form of anaphylaxis that occurs 3-6 hours after red meat ingestion. In a unique prospective study of seventy participants referred with a diagnosis of idiopathic anaphylaxis (IA), six (9%) were found to have IgE to alpha-gal. Upon institution of a diet free of red meat, all patients had no further episodes of anaphylaxis. Two of these individuals had indolent systemic mastocytosis (ISM). Those with ISM had more severe clinical reactions but lower specific IgE to alpha-gal and higher serum tryptase levels, reflective of the mast cell burden. The identification of alpha-gal syndrome in patients with IA supports the need for routine screening for this sensitivity as a cause of anaphylaxis, where reactions to alpha-gal are delayed and thus may be overlooked. |
Allergy 2018; 73(5): 1131-1134. | |
| Chakrapani N, Fischer J, Swiontek K, Codreanu-Morel F, Hannachi F, Morisset M, Mugemana C, Bulaev D, Blank S, Bindslev-Jensen C, Biedermann T. | 2022 | α-Gal present on both glycolipids and glycoproteins contributes to immune response in meat-allergic patients. Background: The α-Gal syndrome is associated with the presence of IgE directed to the carbohydrate galactose-α-1,3-galactose (α-Gal) and is characterized by a delayed allergic reaction occurring 2 to 6 hours after ingestion of mammalian meat. On the basis of their slow digestion and processing kinetics, α-Gal–carrying glycolipids have been proposed as the main trigger of the delayed reaction. Objective: We analyzed and compared the in vitro allergenicity of α-Gal–carrying glycoproteins and glycolipids from natural food sources. Methods: Proteins and lipids were extracted from pork kidney (PK), beef, and chicken. Glycolipids were purified from rabbit erythrocytes. The presence of α-Gal and IgE binding of α-Gal–allergic patient sera (n = 39) was assessed by thin-layer chromatography as well as by direct and inhibition enzyme-linked immunosorbent assay. The in vitro allergenicity of glycoproteins and glycolipids from different meat extracts was determined by basophil activation test. Glycoprotein stability was evaluated by simulated gastric and intestinal digestion assays. Results: α-Gal was detected on glycolipids of PK and beef. Patient IgE antibodies recognized α-Gal bound to glycoproteins and glycolipids, although binding to glycoproteins was more potent. Rabbit glycolipids were able to strongly activate patient basophils, whereas lipid extracts from PK and beef were also found to trigger basophil activation, but at a lower capacity compared to the respective protein extracts. Simulated gastric digestion assays of PK showed a high stability of α-Gal–carrying proteins in PK. Conclusion: Both α-Gal–carrying glycoproteins and glycolipids are able to strongly activate patient basophils. In PK and beef, α-Gal epitopes seem to be less abundant on glycolipids than on glycoproteins, suggesting a major role of glycoproteins in delayed anaphylaxis upon consumption of these food sources. |
Journal of Allergy and Clinical Immunology. 2022 Apr 19. | glycolipid; glycoprotein; glycolipid hypothesis |
| Chakrapani N, Swiontek K, Hübschen JM, Fischer J, Ruiz-Castell M, Codreanu-Morel F, Hannachi F, Morisset M, Ollert M, Kuehn A, Muller CP. | 2024 | Recurrent tick bites induce high IgG1 antibody responses to α-Gal in sensitized and non-sensitized forestry employees in Luxembourg. |
Clinical and translational allergy. 2024 Oct;14(10):e12396. | Europe; Luxembourg; foresters; occupational risk; IgG; IgG 1 |
| Chan GC, Chan CM. | 2022 | Anti-GD2 Directed Immunotherapy for High-Risk and Metastatic Neuroblastoma. |
Biomolecules. 2022 Feb 24;12(3):358. | pharmaceutical; drugs and medical products; biologic; monoclonal antibody; dinutuximab; dinutuximab beta |
| Chandrasekhar J, Cox K, Loo W, Tung K, Erickson L. | 2018 | Development of a novel mouse model to study tick-borne onset of red meat allergy. Bites from Amblyomma americanum, also known as the lone star tick, cause a life-threatening food allergy that induces IgE-mediated allergic reactions in affected individuals after eating dietary ‘red’ meat such as beef, pork, and lamb. Currently, there is no treatment to prevent or cure red meat allergy. Thus, establishing how lone star ticks cause red meat allergy is important for protecting individuals against this allergy. Our lab has successfully developed a novel mouse model of hypersensitivity to tick exposure to better understand how bites from the lone star tick sensitize the host to produce and maintain allergic IgE. Using this model, we identified increased T follicular helper cell and germinal center B cell responses and elevated serum titers of tick-specific IgE and IgG1 in mice exposed to lone star ticks subcutaneously. Furthermore, these mice generate a hypersensitivity response after oral challenge with red meat, as measured by basophil activation. Finally, we found that both the formation of inflammatory skin lesions at the site of tick exposure and the production of IgE were dependent on CD4+ helper T cells. These findings suggest that contained within the tick are factors that markedly influence priming of CD4+ T cells leading to the production of allergic IgE. Based on these data, we propose that manipulation of the factors within lone star ticks that drive CD4+ helper T cell activity could be used locally in the skin at the tick bite site to prevent the onset of meat allergy and systemically to stop an allergic reaction from progressing to a state of severe hypersensitivity. |
The Journal of Immunology 2001; 104.106. | |
| Chandrasekhar JL, Cox KM, Erickson LD. | 2020 | B Cell Responses in the Development of Mammalian Meat Allergy. Studies of meat allergic patients have shown that eating meat poses a serious acute health risk that can induce severe cutaneous, gastrointestinal, and respiratory reactions. Allergic reactions in affected individuals following meat consumption are mediated predominantly by IgE antibodies specific for galactose-α-1,3-galactose (α-gal), a blood group antigen of non-primate mammals and therefore present in dietary meat. α-gal is also found within certain tick species and tick bites are strongly linked to meat allergy. Thus, it is thought that exposure to tick bites promotes cutaneous sensitization to tick antigens such as α-gal, leading to the development of IgE-mediated meat allergy. The underlying immune mechanisms by which skin exposure to ticks leads to the production of α-gal-specific IgE are poorly understood and are key to identifying novel treatments for this disease. In this review, we summarize the evidence of cutaneous exposure to tick bites and the development of mammalian meat allergy. We then provide recent insights into the role of B cells in IgE production in human patients with mammalian meat allergy and in a novel mouse model of meat allergy. Finally, we discuss existing data more generally focused on tick-mediated immunomodulation, and highlight possible mechanisms for how cutaneous exposure to tick bites might affect B cell responses in the skin and gut that contribute to loss of oral tolerance. |
Frontiers in Immunology. 2020;11. | Induction; mechanism; b cell |
| Chandrasekhar JL, Cox KM, Loo WM, Qiao H, Tung KS, Erickson LD. | 2019 | Cutaneous Exposure to Clinically Relevant Lone Star Ticks Promotes IgE Production and Hypersensitivity through CD4(+) T Cell- and MyD88-Dependent Pathways in Mice. Tick-borne allergies are a growing public health concern and have been associated with the induction of IgE-mediated food allergy to red meat. However, despite the increasing prevalence of tick bite-induced allergies, the mechanisms by which cutaneous exposure to ticks leads to sensitization and the production of IgE Abs are poorly understood. To address this question, an in vivo approach was used to characterize the IgE response to lone star tick proteins administered through the skin of mice. The results demonstrated that tick sensitization and challenge induced a robust production of IgE Abs and supported a role for IgE-mediated hypersensitivity reactions in sensitized animals following oral administration of meat. The induction of IgE responses was dependent on cognate CD4(+) T cell help during both the sensitization phase and challenge phase with cutaneous tick exposure. In addition, IgE production was dependent on B cell-intrinsic MyD88 expression, suggesting an important role for TLR signaling in B cells to induce IgE responses to tick proteins. This model of tick-induced IgE responses could be used to study the factors within tick bites that cause allergies and to investigate how sensitization to food Ags occurs through the skin that leads to IgE production. |
Journal of Immunology. 2019 Aug 15;203(4):813-24. | |
| Charlesworth M, Shelton CL. | 2019 | Should intravenous gelatins have a role in contemporary peri‐operative and critical care?. |
Anaesthesia. 2020 Feb;75(2):266-9. | pharmaceutical; pharmacy; medical products; gelatin; plasma volume expanders |
| Chauhan PS, Saxena A. | 2016 | Bacterial carrageenases: an overview of production and biotechnological applications. Carrageenan, one of the phycocolloids is a sulfated galactan made up of linear chains of galactose and 3,6-anhydrogalactose with alternating α-(1 → 3) and β-(1 → 4) linkages and further classified based on the number and the position of sulfated ester(s); κ-, ι- and λ-carrageenan. Enzymes which degrade carrageenans are called k-, ι-, and λ-carrageenases. They all are endohydrolases that cleave the internal β-(1–4) linkages of carrageenans yielding products of the oligo-carrageenans. These enzymes are produced only by bacteria specifically gram negative bacteria. Majority of the marine bacteria produce these enzymes extracellularly and their activity is in wide range of temperature. They have found potential applications in biomedical field, bioethanol production, textile industry, as a detergent additive and for isolation of protoplast of algae etc. A comprehensive information shall be helpful for the effective understanding and application of these enzymes. In this review exhaustive information of bacterial carrageenases reported till date has been done. All the aspects like sources, production conditions, characterization, cloning and- biotechnological applications are summarized. |
3 Biotech. 2016 Dec 1;6(2):146. | carrageenan |
| Che L, Li X, Zhang X, Zhang YL, Yi J, Ruan X, Ma S, Huang Y. | 2021 | The nature and reported incidence of suspected perioperative allergic reactions: A cross-sectional survey. Study objective: Perioperative allergic reactions (POHs) are common and can lead to severe intraoperative instability and even mortality. In contrast to the situation in developed countries, where databases of perioperative anaphylaxis are well documented and analyzed, relevant data are lacking in China. Therefore, we aimed to conduct a national survey to explore the characteristics of perioperative allergic reactions, as well as the knowledge and attitudes toward management and reporting among anesthesiologists. Design: Cross-sectional survey. Setting: Anesthesia department. Patients: A nationally representative sample comprising anesthesiologists from 12 province-level regions was selected. Measurements: A 20-item questionnaire was designed and validated using the Delphi method. Survey distribution was performed between June 2019 and January 2020 by the Chinese Society of Anesthesiology (CSA), which is the official academic society of Chinese anesthesiologists. Responses were compiled and analyzed. Main results: We received responses from 4389 anesthesiologists across China. The estimated rate of suspected POH was 2/1000 patients (0.2%). On average, an anesthesiologist encountered 2.1 suspected POH cases per year. Neuromuscular blocking agents (NMBAs) were perceived as the most common causative agents, followed by antibiotics and succinylated gelatin. The rates of referral and allergy consultations were very low. Institutional support, including protocol development, cognitive aids, and tool kits, was not ideal. Additionally, the management of POH varied substantially. Most anesthesiologists believed that reporting and documenting POH was necessary. Conclusions: Our survey revealed that POH is commonly encountered by Chinese anesthesiologists, but few patients are referred to allergy specialists or clinics for further investigation. A standardized recommendation based on research and data derived from Chinese patients is required |
Journal of Clinical Anesthesia. 2021 Nov 1;74:110404. | Asia; China; perioperative; medical products; anesthesia; gelatin; Gelofusine |
| Chen S, Zeigler S. | 2024 | Safe Implantation of a Bovine Bioprosthetic Aortic Valve in a Patient With Galactose-α-1, 3-Galactose Allergy. |
The Annals of Thoracic Surgery. 2024 Oct 1;118(4):950-2. | cardiac; bioprosthetic valve |
| Chen YC, Lin YH, Lu CT, Yii CY, Chen PC, Yong SB. | 2024 | Correspondence to" Oral immunotherapy in alpha-gal red meat allergy: Could specific IgE be a potential biomarker in monitoring management?". |
Allergy. 2024 Feb 10. | |
| Ching SJ, Susi A, Ailsworth SM, Workman LJ, Platts-Mills TA, Wilson JM, Nylund CM. | 2024 | Incidence of Alpha-Gal IgE Sensitization in 3000 Military Personnel, Assessing Sex, Race, Installation, and Occupational Impacts. |
Journal of Clinical Medicine. 2024 Nov 26;13(23):7162. | risk factors; race; ethnicity |
| Chinuki Y, Ishiwata K, Yamaji K, Takahashi H, Morita E. | 2016 | Haemaphysalis longicornis tick bites are a possible cause of red meat allergy in Japan. Recent studies revealed that Amblyomma or Ixodes tick bites may cause red meat allergy, in which galactose-alpha-1,3-galactose (alpha-Gal) is a major IgE-binding epitope. The incidence of red meat allergy is high in Shimane Prefecture, as is tick-transmitted Japanese spotted fever. Therefore, we speculated that tick bites may cause these meat allergies. The carbohydrate alpha-Gal was detected in the salivary gland protein of Haemaphysalis longicornis (H. longicornis), the vector for Japanese spotted fever, by immunoblotting using anti-alpha-Gal antibody. H. longicornis salivary gland protein-specific IgE was detected in the sera of 24 of 30 patients with red meat allergies. Sensitization to tick salivary gland protein containing alpha-Gal is possibly a major etiology of red meat allergy; the carbohydrate plays a crucial role in its allergenicity. These results further indicate that the alpha-Gal epitope is present not only in Amblyomma or Ixodes, but also in Haemaphysalis. |
Allergy. 2016 Mar;71(3):421-5. | Asia; Japan; vector; tick species; Haemaphysalis longicornis |
| Chinuki Y, Ito K, Morita E. | 2019 | 128 Measurement of galactose-alpha-1,3-galactose-related specific IgE before the first administration of cetuximab can reduce the incidence of cetuximab-induced anaphylactic shock. It is known that the main causative antigenic epitope of cetuximab allergy is galactose-alpha-1,3-galactose (alpha-Gal). In 2013, 13 patients with head and neck cancer received the first administration of cetuximab at Matsue Red Cross Hospital in the western part of Japan, and four of them developed anaphylactic shock (Incidence rate was 31%). In the sera of these patients, both alpha-Gal specific IgE by CAP-FEIA and cetuximab specific IgE by western blotting were detected. Both sensitivity and specificity in 13 patients of these tests were 100%. We therefore aimed to prevent cetuximab-induced anaphylactic shock by performing these tests before the administration. We measured alpha-Gal specific IgE by CAP-FEIA and cetuximab specific IgE by western blotting before the first administration of cetuximab in 206 patients with head and neck cancer, and gave the first dose of cetuximab to the patients who showed either on these two tests. As a result, alpha-Gal-specific IgE was detected in 15 of 206, and cetuximab-specific IgE was detected in 12 of 206. Nine patients showed positive on both tests. Thirty nine of the 188 patients who showed negative either on these two tests have received cetuximab so far, and two of them developed anaphylactic shock (Incidence rate was 5%). Although the incidence rate did not reach to 0%, cetuximab-induced anaphylactic shock could be significantly reduced by prior measurement of alpha-Gal-related specific IgE. The reason why the incidence rate could not be 0% may be because the cutoff value (<0.35kUA/L) we decided was high. |
Journal of Investigative Dermatology. 2019 Sep 1;139(9):S236. | Asia; Japan |
| Chinuki Y, Morita E. | 2019 | Alpha-Gal-containing biologics and anaphylaxis. Cetuximab, the IgG1 subclass chimeric mouse-human monoclonal antibody biologic that targets the epidermal growth factor receptor (EGFR), is used worldwide for the treatment of EGFR-positive unresectable progressive/recurrent colorectal cancer and head and neck cancer. Research has shown that the principal cause of cetuximab-induced anaphylaxis is anti-oligosaccharide IgE antibodies specific for galactose-alpha-1,3-galactose (alpha-Gal) oligosaccharide present on the mouse-derived Fab portion of the cetuximab heavy chain. Furthermore, it has been revealed that patients who are allergic to cetuximab also develop an allergic reaction to mammalian meat containing the same alpha-Gal oligosaccharide owing to cross-reactivity, and the presumed cause of sensitization is tick bites: Amblyomma in the United States, Ixodes in Australia and Europe, and Haemaphysalis in Japan. The alpha-Gal-specific IgE test (bovine thyroglobulin-conjugated ImmunoCAP) or CD63-expression-based basophil activation test may be useful to identify patients with IgE to alpha-Gal in order to predict risk for cetuximab-induced anaphylactic shock. Investigations of cetuximab-related anaphylaxis have revealed three novel findings that improve our understanding of immediate-type allergy: 1) oligosaccharide can serve as the main IgE epitope of anaphylaxis; 2) because of the oligosaccharide epitope, a wide range of cross-reactivity with mammalian meats containing alpha-Gal similar to cetuximab occurs; and 3) tick bites are a crucial factor of sensitization to the oligosaccharide. Nonetheless, taking a medical history of tick bites and beef allergy may be insufficient to prevent cetuximab-induced anaphylaxis, and therefore blood testing with an alpha-Gal-specific IgE test, with high sensitivity and specificity, is necessary to detect sensitization to alpha-Gal. |
Allergology International. 2019;68(3):296-300. | |
| Chinuki Y, Takahashi H, Morita E. | 2022 | IgE antibodies to galactose-α-1, 3-galactose, an epitope of red meat allergen, cross-react with a novel flounder roe allergen. Sensitization to galactose-α-1,3-galactose (alpha-Gal) due to tick bites causes allergies to various red meats and cetuximab [1]. The alpha-Gal syndrome cases have been reported in different countries and the identity of implicated tick species varies geographically [1–4]. We previously described 30 individuals with red meat allergy, 24 of whom were found to have IgE against -Gal-containing water-soluble salivary gland proteins of Haemaphysalis longicornis[4]. Interestingly, most of the patients also experienced allergic reactions after ingesting flounder in winter [5]. In this study, we aimed to clarify the mechanism of flounder allergy found in the patients allergic to red meat. |
J Investig Allergol Clin Immunol. 2022;32(4). | non-mammalian vertebrates; fish; founder eggs roe; cross-react |
| Chinuki Y, Takahashi H, Morita E. | 2013 | *Clinical and biochemical evaluation of twenty patients with red meat allergies. Note: 75% of people who reacted to beef also reacted to flounder eggs. |
Jpn J Dermatol. 2013;123(1807):e14. | flounder; allergen; cross-reactivity; cross-reaction; flounder roe; sushi |
| Chitnavis M, Stein DJ, Commins S, Schuyler AJ, Behm B. | 2017 | First-dose anaphylaxis to infliximab: a case of mammalian meat allergy. Letter to the editor: IgE antibodies to galactose-α-1,3-galactose, identified in patients with mammalian meat allergy, can cross-react with a glycosylated component of infliximab, resulting in anaphylaxis in patients who receive this therapy. |
The Journal of Allergy and Clinical Immunology: In Practice. 2017 Sep 1;5(5):1425-6. | |
| Chiu CY, Henao-Martínez AF, Higuita NI. | 2024 | Incidence of Anaphylaxis in Patients with Alpha-Gal Syndrome Receiving Gelatin-Containing Vaccines: A Large Database Analysis. In our study, the anaphylaxis rate did not differ between gelatin-containing (except live intranasal influenza vaccine) and gelatin-free vaccines in patients with confirmed alpha-gal syndrome. Some studies have shown that gelatin content in vaccines is relevant to serum alpha-gal IgE. Most importantly, not all patients with alpha-gal syndrome will react to gelatin-containing vaccines. Future research could explore whether skin tests or serum alpha-gal IgE values can help predict vaccine safety in patients with alpha-gal syndrome. |
The Journal of Allergy and Clinical Immunology: In Practice. 2024 Nov 22. PRE-PRINT | drugs and medical devices; medical products; vaccines; gelatin; anaphylaxis |
| Choi GS, Kim JH, Lee HN, Sung JM, Lee JW, Park HS. | 2009 | Occupational asthma caused by inhalation of bovine serum albumin powder. Bovine serum albumin (BSA), which is present in bovine plasma, is one of the major allergens affecting patients with food allergies induced by milk and meat. It is also commonly used in research laboratories. Although some reports have documented food allergies associated with BSA, BSA-induced occupational asthma has not been reported. We report a case of occupational asthma and rhinitis in a laboratory worker caused by the inhalation of BSA powder, in which an IgE-mediated response was suggested as the pathogenic mechanism. |
Allergy, asthma & immunology research. 2009 Oct 1;1(1):45-7. | airborne |
| Choudhary S, Commins S, Karim S. | 2022 | Tick salivary gland extract may act as an adjuvant to induce alpha-gal syndrome in alpha-gal deficient mice. Bites from the lone star tick, Amblyomma americanum (Aa), are associated with the development of alpha-gal specific IgE (sIgE) in humans and alpha-gal deficient (AGKO) mice. We have recently reported the presence of alpha-gal in the saliva of Aa and Ixodes scapularis (Is) but not in not in Amblyomma maculatum (Am). Since Am ticks do not contain endogenous alpha-gal, we used this species to test whether feeding Am ticks an alpha-gal-containing blood meal could sensitize AGKO mice and produce alpha-gal syndrome (AGS). |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB52. | pathogenesis; tick salivary gland |
| Choudhary S, Commins SP. | 2018 | Detection of antigen-specific IgE-expressing B cells in food allergy is feasible and inversely associated with dietary antigen exposure. RATIONALE: To understand the regulation of IgE production in the recently described alpha-gal mammalian meat food allergy, we have focused on IgE-expressing (IgE+) B cells. These cells typically circulate in low abundance and are generally difficult to detect. Recent improvements in technical methods have made their analysis more feasible. Once identified, we asked whether circulating alpha-gal-specific IgE+ B cell populations were affected by ongoing dairy consumption as others have shown that B cell receptor (BCR) signaling negatively regulates IgE responses. METHODS: PBMCs were isolated from controls and subjects with alphagal allergy and stained for surface markers CD19, CD38, CD27, CD138, and membrane IgM, IgG, IgD and IgE as well as fluorochrome-labeled alpha-gal. RESULTS: We found that SHIP-1 is phosphorylated at each step of DS, more importantly it is more phosphorylated at early steps, statistically higher at step 3 (P<0.05), at the time when the doses cannot induce bhexosaminidase release. As opposed to Syk and p38 MAPK which are only phosphorylated at activating doses. Of the 11 DS doses, steps 2 and 3 showed significantly higher SHIP-1 phosphorylation when antigen given cumulatively as compared to single doses (P<0.05 and P<0.01, respectively). CONCLUSIONS: DS takes advantage of SHIP-1 at the early steps when low doses cannot induce b-hexosaminidase release to dominate the inhibitory signals over activating molecules as Syk kinase. |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB192. | |
| Choudhary S, Iweala OI, Addison CT, & Commins SP. | 2019 | Tick Salivary Gland Extract Induces Alpha-Gal Allergy in Alpha-Gal Deficient Mice. RATIONALE: Recent retrospective research associated early life acid suppressive medication with food allergies. We sought to prospectively evaluate the association between acid suppressive medication in infancy and development of IgE-mediated food allergy in early childhood. METHODS: The Gastrointestinal Microbiome and Allergic Proctocolitis (GMAP) Study is an ongoing prospective observational cohort study of 1003 healthy newborn infants designed to evaluate the development of food allergies in their first 3 years of life. IgE-mediated food allergy was determined by independent agreement of two allergist reviewers based on clinical reactivity and documented IgE sensitivity. RESULTS: Compared to controls, mice treated with TSGE had elevated total IgE and IgG at day 56 (0.6060.12 ng/mL vs 113.2624.77 ng/mL, p<0.0001; 98.07610.32 mg/mL vs 253.4638.93 mg/mL, p<0.0001, respectively). Alpha-gal sIgE was increased in response to TSGE treatment (undetected vs 40.3 pg/mL). Core body temperature decreased following pork challenge with maximal decrease at 30 minutes in the TSGE-treated mice (34.3960.568C) but not in control mice. Interestingly, female mice had higher total IgE responses to TSGE treatment (179.1639.86 vs 56.98617.45 ng/ml) but male mice had larger declines in mean body temperature (-4.9960.6 vs -3.1860.828C). CONCLUSIONS: AGKO mice treated with TSGE recapitulate the delayed allergy to red meat seen in humans and establish the central role of tick bites. In addition, our model serves as a platform for mechanistically studying this new food allergy – already revealing potentially important sex-related differences. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB252. | pathogenesis; tick salivary gland |
| Choudhary S, Jerath MR, Commins SP. | 2018 | Venom allergy is increased in alpha-gal allergy: shared environmental or immunologic factors? RATIONALE: Expansion of tick populations has been associated with environmental change. We now face a global increasing incidence of mammalian meat food allergy due to alpha-gal sIgE, which has been associated with tick bites. Since patients with alpha-gal allergy frequent the outdoor environment, we sought to determine whether rates of stinging insect venom allergy, another environmentally-influenced condition, are increased in these patients. METHODS: Patients (n5109) presenting to the University of North Carolina allergy clinic with possible alpha-gal allergy were interviewed regarding reactions to stinging insects. Sera were later assayed for sIgE to alpha-gal and mammalian allergens as well as venoms (honey bee, whitefaced hornet, common wasp, paper wasp and fire ant) using Phadia ImmunoCAP platform. Control subjects (n526) were also enrolled for comparison. RESULTS: Subjects with alpha-gal allergy reported a higher rate nonlocal reactions following insect sting and were 5 times more likely to be sensitized (>0.35) to any of five venom allergens compared to controls (Chi-square prob50.0244). Among alpha-gal allergic subjects sensitization to common wasp was most frequent (30.3%), whereas among controls it was fire ant (15.4%). Notably, having alpha-gal allergy was associated with a 3.6-fold increased risk of sensitization to multiple venom sIgE (95% CI 1.02-12.78) compared to controls. Total IgE was not different between the groups. CONCLUSIONS: Development of IgE following ecto-parasitic tick bites and stinging insect envenomations may have a shared immunologic determinant or predisposition, other than just atopy. Given that both conditions are influenced by environmental exposures, ongoing climate change is likely to make these allergic conditions more common |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB199. | venom; wasp; stinging insect |
| Choudhary S, Sharma S, Karim S, Vorobiov J, Commins S. | 2024 | Infestation of alpha-gal knockout mice with Amblyomma americanum caused induction of Th2 polarization genes, production of alpha-gal specific antibody and red meat allergy. |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB254. | vector, ticks, Amblomma americanum, lone star tick; Amblyomma maculatum |
| Choudhary S. | 2020 | Transcriptional analysis of B cells from patients with alpha-gal allergy. RATIONALE: Patients who develop alpha-gal allergy have tolerated mammalian meat and products for years. Understanding the shift in transcriptional programming of alpha-gal IgE-producing B cells is critical to elucidating the switch from immune tolerance to allergen reactivity. . . METHODS: B cells were enriched from alpha-gal allergic and control subjects by negative selection and sorted for CD27highCD38highIgE+ aGal+ CD138- plasmabast, one cell/well into a 96- well BD precise plate. Target genes were amplified, sequenced and data were analyzed using BD genomic data view software. In conjunction, additional enriched B cell preparations from control and alpha-gal-allergic subjects were analyzed for targeted gene expression using digital barcoded platform. . . RESULTS: We detected AG+ IgE+ plasmablast in the blood of recent tick bitten subject with median percentage of 0.054 (25% Percentile 0.013, 75th percentile 0.105, N513). Further a positive correlation was observed between alpha-gal sIgE and alpha-gal+ IgE+ plasmablast. Projection of data with tSNE plot suggested that genes from subjects with high sIgE annotated together. An increase in gene expression of transcription factors and pseudogenes involved in transcriptional regulation were observed in subjects with high sIgE. Upregulation of TNF gene expression as well as other inflammation-related products was found in alpha-gal allergic subjects without influence of alpha-gal sIgE titer. . . CONCLUSIONS: Subjects with alpha-gal allergy appear to have a strikingly higher percentage of circulating plasmablasts than control subjects. Moreover, these plasmablasts express a distinct transcriptional repertoire consistent with a robust inflammatory stimulus which likely explains the shift from immune tolerance of red meat to clinical food allergy. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB158. | |
| Choudhary SK, Commins SP. | 2015 | Association of Alpha-gal Red Meat Allergy Severity with Concentration of Antigen in Basophil Activation. RATIONALE: IgE to galactose-alpha-1,3,-galactose has been associatedwith delayed allergic reactions to red meat and appears to developfollowing bites from ecto-parasitic ticks. METHODS: Patients who presented to the University of North Carolinaallergy clinic with histories compatible with delayed reactions to red meat had sera were assayed for IgE antibodies, total IgE and basophil activation titration. RESULTS: IgE was measured to alpha-gal and mammalian allergens aswell as venoms. The presence of IgE antibodies to venom allergens wasincreased in those subjects allergic to alpha-gal. Severity of reactionswas not associated with the titer of IgE antibodies to alpha-gal but waspositive associated with lower antigen concentration leading to basophilactivation. In addition, the ratio of alpha-gal IgE to total IgE nor IgGantibodies to alpha-gal were correlated to titration of basophil activation.The severity of reactions was not related to age of onset or delay beforereactions. CONCLUSIONS: Patients with delayed anaphylaxis to red meat present a novel disease with late onset break in oral tolerance, no immediatesymptoms of food allergy, and a very high incidence of previous exposure to ticks. Atopy was not a predictor of IgE responses or food reactions but basophil activation at low antigen concentration appears to be a predictor of clinical reaction severity. |
Journal of Allergy and Clinical Immunology. 2017 Feb 1;139(2):AB125. | |
| Choudhary SK, Commins SP. | 2017 | Association of Alpha-gal Red Meat Allergy Severity with Concentration of Antigen in Basophil Activation. RATIONALE: IgE to galactose-alpha-1,3,-galactose has been associated with delayed allergic reactions to red meat and appears to develop following bites from ecto-parasitic ticks. METHODS: Patients who presented to the University of North Carolina allergy clinic with histories compatible with delayed reactions to red meat had sera were assayed for IgE antibodies, total IgE and basophil activation titration. RESULTS: IgE was measured to alpha-gal and mammalian allergens as well as venoms. The presence of IgE antibodies to venom allergens was increased in those subjects allergic to alpha-gal. Severity of reactions was not associated with the titer of IgE antibodies to alpha-gal but was positive associated with lower antigen concentration leading to basophil activation. In addition, the ratio of alpha-gal IgE to total IgE nor IgG antibodies to alpha-gal were correlated to titration of basophil activation. The severity of reactions was not related to age of onset or delay before reactions. CONCLUSIONS: Patients with delayed anaphylaxis to red meat present a novel disease with late onset break in oral tolerance, no immediate symptoms of food allergy, and a very high incidence of previous exposure to ticks. Atopy was not a predictor of IgE responses or food reactions but basophil activation at low antigen concentration appears to be a predictor of clinical reaction severity. |
Journal of Allergy and Clinical Immunology. 2017 Feb 1;139(2):AB125. | |
| Chung BY, Cho YS, Kim HO, Park CW. | 2015 | Food Allergy in Korean Patients with Chronic Urticaria. Background: The etiology of chronic urticaria (CU) remains unknown in most patients. Possible causes in some cases include food, but the role of allergy to food antigens in patients with CU remains controversial. Objective: The aim of this study was to evaluate the association between food allergy and CU. Methods: Korean patients with CU were assessed for a previous history of food allergy that caused symptoms of CU. Blood samples were taken from 350 patients to measure food allergen-specific IgE. Based on history and laboratory results, open oral food challenge (OFC) tests were performed. Results: Of 350 participants, 46 (13.1%) claimed to have experienced previous food hypersensitivity. Pork (n=16) was the main food mentioned, followed by beef (n=7), shrimp (n=6), and mackerel (n=6). We found that 73 participants (20.9%) had elevated levels of food-specific IgE, with pork (n=30), wheat (n=25), and beef (n=23) being the most common. However, when the open OFC tests were conducted in 102 participants with self-reported food hypersensitivity or raised levels of food-specific IgE, only four participants showed a positive reaction to pork (n=3) or crab (n=1). Conclusion: Although some participants claimed to have a history of CU related to food intake, when an open OFC test was conducted, few of them had positive results. We therefore conclude that food allergy is an uncommon cause of chronic CU. |
Annals of Dermatology. 2016 Oct 1;28(5):562-8. | Asia; Korea; pork allergy; prevalence |
| Chung CH, Mirakhur B, Chan E, Le QT, Berlin J, Morse M, Murphy BA, Satinover SM, Hosen J, Mauro D, Slebos RJ, Zhou Q, Gold D, Hatley T, Hicklin DJ, Platts-Mills TAE. | 2008 | *Cetuximab-induced anaphylaxis and IgE specific for galactose-alpha-1,3-galactose. BACKGROUND: Cetuximab, a chimeric mouse-human IgG1 monoclonal antibody against the epidermal growth factor receptor, is approved for use in colorectal cancer and squamous-cell carcinoma of the head and neck. A high prevalence of hypersensitivity reactions to cetuximab has been reported in some areas of the United States. METHODS: We analyzed serum samples from four groups of subjects for IgE antibodies against cetuximab: pretreatment samples from 76 case subjects who had been treated with cetuximab at multiple centers, predominantly in Tennessee, Arkansas, and North Carolina; samples from 72 control subjects in Tennessee; samples from 49 control subjects with cancer in northern California; and samples from 341 female control subjects in Boston. RESULTS: Among 76 cetuximab-treated subjects, 25 had a hypersensitivity reaction to the drug. IgE antibodies against cetuximab were found in pretreatment samples from 17 of these subjects; only 1 of 51 subjects who did not have a hypersensitivity reaction had such antibodies (P<0.001). IgE antibodies against cetuximab were found in 15 of 72 samples (20.8%) from control subjects in Tennessee, in 3 of 49 samples (6.1%) from northern California, and in 2 of 341 samples (0.6%) from Boston. The IgE antibodies were shown to be specific for an oligosaccharide, galactose-alpha-1,3-galactose, which is present on the Fab portion of the cetuximab heavy chain. CONCLUSIONS: In most subjects who had a hypersensitivity reaction to cetuximab, IgE antibodies against cetuximab were present in serum before therapy. The antibodies were specific for galactose-alpha-1,3-galactose. |
New England journal of medicine. 2008 Mar 13;358(11):1109-17. | prevalence; medical products; biologic; monoclonal antibody; cetuximab |
| Chung J, Goonetilleke N, Wickramatunga I, Sirisena T, Kamaladasa K. | 2023 | Diagnosis and Management Dilemma of Vasospastic Angina in Alpha-Gal Syndrome and Lactose Intolerance. Vasospastic angina, also known as Prinzmetal or variant angina, is a cause of chest pain resulting from coronary artery vasospasm. This case report details the presentation of a 66-year-old with vasospastic angina on a background of alpha-gal syndrome and lactose intolerance. |
Heart, Lung and Circulation. 2023 Jul 1;32:S279. | |
| Cocco RR, Ensina LF, Aranda CS, Solé D. | 2016 | Galactose-α-1, 3-Galactose (alphagal) allergy without anaphylaxis: a case report in Brazil. Background: Several studies suggest that tick bites are a cause of IgE antibody responses to alpha-gal in the United States, Europe, Asia and Australia. Delayed-onset reactions, especially anaphylaxis, have beenreported to happen 3 to 6 hours after ingestion of mammalian food products. Hereby we describe the first case of alpha gal allergy in Brazil in a male farmer, who presents with no other symptoms than urticaria. Report: A 55 year-old cattle breeder from North of Brazil (Rondonia) with no previous allergies refer to presenting with a daily scattered and pruritic papules for five years. Symptoms used to show up mostly inthe late afternoon and were closely related to the ingestion of meat (lamb, bovine, pork, chicken) during lunch time. When questioned about tick bites, he clearly described multiple lesions in his body secondaryto his job with animals and farm. Specific serum IgE revealed: bovine meat: 38.80 kU/L; pork meat: 28.60 kU/L; cow’s milk: 9.7 kU/L; serum bovine albumin: 1.51 kU/L; alpha gal: 70.7 kU/L; total IgE 888UI/mL. After orientation to restrict all meats, his symptoms have disappeared. Clinical Relevance: Although most of reports about alpha-gal allergy involve anaphylaxis, this patient presented only with urticaria. The only route of sensitization was through tick bites, since he never hadcontact to cetuximab. Chronic urticaria in farmers or environment with ticks, which can be very often in Brazil, should be investigated for alpha gal allergy. |
Poster presented at 4th Food Allergy and Anaphylaxis Meeting. 2016. | Latin America; Brazil; occupational medicine |
| Coker HB, Jakes ME, Mountcastle EA. | 2013 | Delayed urticaria to beef ingestion. To the Editor: A 50-year-old man presented with a 5-year history of urticaria developing approximately 3 hours after eating ground beef. The eruption cleared with diphenhydramine. In the next 4 years, the patient experienced similar eruptions every time he ate ground beef. Recently, he had awoken with urticaria about 4 hours after consuming a large steak. He reported no problems with chicken, other fowl, or fish ingestion. IgE level to galactose-alpha-1,3-galactose (alpha-gal) was 47 kU/L (normal <0.35 kU/L). The onset of these episodes followed within a few months of a tick bite. The patient could not identify the specific type of tick, but he lived in the southeastern United States where exposure to ticks is common. |
Journal of the American Academy of Dermatology. 2013 Mar 1;68(3):e101. | Alabama |
| Coley K | 2015 | Identification Guide to Larval Stages of Ticks of MedicalImportance in the USA | Honors thesis | vector; tick; lone star tick; larvae; larval; tick ID |
| Commins S, Choudhary S. | 2022 | Simultaneous measurement of surface proteins and single cell mRNA expression profiling of circulating immune cells in alpha-gal syndrome. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB93. | Immunological phenotyping; B cells; cell subsets; B cell populations; inflammation; atherosclerosis; Rhapsody; IL-8 |
| Commins SP, Crispell G, Karim S, Choudhary S, Iweala OI, Addison CT, Choudhary S. | 2019 | Red Meat Allergy May Develop Independent of Tick Blood Meal Status. RATIONALE: Alpha-gal syndrome (AGS) is a paradigm-shifting food allergy characterized by delayed reactions to non-primate mammalian meat and derived products. Evidence continues to suggest that AGS develops following tick bites and multiple species have been implicated globally. Tick saliva may contain alpha-gal from prior blood meal or may act as an adjuvant to induce IgE. This study assessed whether tick salivary gland extract (TSGE) could activate alpha-gal-sensitized basophils directly and if IgE reactivity was present in tick saliva. METHODS: PBMCs containing basophils from a non-alpha-gal allergic control subject were stripped of IgE; primed with plasma from subjects with and without alpha-gal allergy; stimulated for 30 minutes with TSGE from 4 species of ticks; and assessed for basophil activation by FACS. IgE reactivity was assessed by immunoassay using TSGE, tick larvae extract and tick saliva. RESULTS: The frequency of CD63+ basophils was 40-fold higher when alpha-gal IgE-sensitized basophils were stimulated with TSGE from Lone Star ticks compared to baseline. Extract from Ixodes scapularis but not the Gulf Coast tick, Amblyomma maculatum, also increased basophil activation. IgE reactivity was found in tick saliva (mean 23.4 IU/mL±1.9) among subjects with AGS but not larval tick or partially fed TSGE. CONCLUSIONS: IgE from subjects with AGS recognizes an antigen present in ticks from some species but not all and this observation can lead to identification of the sensitizing allergen. Interestingly, IgE reactivity appears to be specifically retained in tick saliva, an important distinction that may suggest alpha-gal antigen is present in ticks independent of blood meal status. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB34. | |
| Commins SP, James H, Tran N, Kelly E, Mullins R, Lieberman P, Platts-Mills TAE. | 2010 | Testing for IgE Antibody to the Carbohydrate galactose-alpha-1,3-galactose (alpha-gal) in Patients with Recurrent, Idiopathic Anaphylaxis: How Many Cases Are We Missing? RATIONALE: Patients with idiopathic anaphylaxis are at increased risk for recurrent episodes if the etiology of anaphylaxis is not established. The carbohydrate, galactose-a-1,3-galactose (alpha-gal), has recently been described as a novel food allergen and patients who have IgE to alpha-gal report delayed anaphylaxis or urticaria occurring 3-6 hours after eating mammalian meat. METHODS: Sera from patients with recurrent, idiopathic anaphylaxis diagnosed in three clinical sites: Tennessee, Virginia and Canberra, Australia were tested for the presence of IgE to alpha-gal. RESULTS: We identified 60 patients diagnosed with idiopathic anaphylaxis. Analysis of sera from patients (n 5 20) in the Tennessee clinic revealed that 5 of 20 (25%) had >1.0 IU/mL of IgE to alpha-gal. Results from the Virginia and Canberra sites showed a higher level of positive responses to alpha-gal (50%). Specifically, 11 of 22 sera from Virginia had >1.0 IU/mL of IgE to alpha-gal, whereas 9 of 18 from Australia were positive. The geometric mean total IgE from sera of patients with recurrent, idiopathic anaphylaxis who tested positive for IgE to alpha-gal from Tennessee, Virginia and Canberra was 325.7, 90.2 and 262.2 IU/mL, respectively. Those patients negative for IgE to alpha-gal had mean total IgE of 80.3, 33.2 and 155.9 IU/mL in Tennessee, Virginia and Canberra. Analysis of other allergens in this population did not reveal a pattern of sIgE to explain the other cases of anaphylaxis. CONCLUSIONS: IgE to galactose-a-1,3-galactose is an important, under-recognized cause of recurrent, ‘‘idiopathic’’ anaphylaxis and should be included in the work-up of patients in the southeastern US and southern Australia. |
Journal of Allergy and Clinical Immunology. 2010 Feb 1;125(2):AB119. | |
| Commins SP, James HR, Kelly LA, Pochan SL, Workman, LJ, Perzanowski MS, Kocan KM, Fahy JV, Nganga LW, Ronmar E, Cooper PJ. | 2011 | The relevance of tick bites to the production of IgE antibodies to the mammalian oligosaccharide galactose-α-1,3-galactose. BACKGROUND: In 2009, we reported a novel form of delayed anaphylaxis to red meat that is related to serum IgE antibodies to the oligosaccharide galactose-α-1,3-galactose (alpha-gal). Most of these patients had tolerated meat for many years previously. The implication is that some exposure in adult life had stimulated the production of these IgE antibodies. OBJECTIVES: We sought to investigate possible causes of this IgE antibody response, focusing on evidence related to tick bites, which are common in the region where these reactions occur. METHODS: Serum assays were carried out with biotinylated proteins and extracts bound to a streptavidin ImmunoCAP. RESULTS: Prospective studies on IgE antibodies in 3 subjects after tick bites showed an increase in levels of IgE to alpha-gal of 20-fold or greater. Other evidence included (1) a strong correlation between histories of tick bites and levels of IgE to alpha-gal (χ2=26.8, P<.001), (2) evidence that these IgE antibodies are common in areas where the tick Amblyomma americanum is common, and (3) a significant correlation between IgE antibodies to alpha-gal and IgE antibodies to proteins derived from A. americanum (rs=0.75, P<.001). CONCLUSION: The results presented here provide evidence that tick bites are a cause, possibly the only cause, of IgE specific for alpha-gal in this area of the United States. Both the number of subjects becoming sensitized and the titer of IgE antibodies to alpha-gal are striking. Here we report the first example of a response to an ectoparasite giving rise to an important form of food allergy. |
Journal of Allergy and Clinical Immunology. 2011 May 1;127(5):1286-93. | ectoparasite; parasite; non-tick vector; helminth |
| Commins SP, James HR, Pochan SL, Workman LJ, Platts-Mills TA. | 2011 | IgE to Alpha-Gal: Clinical and In Vitro Evidence of a Delayed Reaction to Mammalian Meat. RATIONALE: A novel mammalian meat allergy attributed to an IgE abagainst the carbohydrate galactose-a-1,3-galactose (alpha-gal) is nowcommon in central Virginia. Patients who develop these reactions reportonset of urticaria that is consistently delayed by 3-6 hours. However, wehave previously shown that basophils from these patients will activate invitro within 30 minutes. METHODS: Following IRB approval, informed consent was obtainedfrom a subject who reported urticaria 4-5 hours after eating mammalianmeat. After an intravenous catheter was placed and baseline blood workobtained, a food challenge with 35 grams of prosciutto was performed.Hourly blood was obtained to assess for basophil activation and serummarkers of allergic response. RESULTS: Serum analysis revealed a total IgE of 102 IU/mL and IgE toalpha-gal of 22.8 IU/mL. Four hours and fifteen minutes after eating 35grams of prosciutto, pruritus was reported and urticaria appeared. Hivesprogressed over the ensuing 30 minutes until treatment with diphenhydramine. Assessment of basophils showed increased surface expression of theactivation marker CD63 of 12.9 and 11.7% at hours 4 and 5, compared to1.8% at baseline and 2.5, 3.8, and 2.8% at 1, 2 and 3 hours, respectively. CONCLUSIONS: This represents the first, clinically-documented in vivodemonstration of a delayed urticarial reaction to mammalian meat associated with IgE to alpha-gal. Moreover, basophil CD63 expression was increased at 4-5 hours post-challenge, corresponding to the appearance ofhives. The implication is that the form of alpha-gal that causes basophil activation and urticaria takes 4 hours to enter the bloodstream. |
Journal of Allergy and Clinical Immunology. 2011 Feb 1;127(2):AB245. | |
| Commins SP, James HR, Stevens W, Pochan SL, Land MH, King C, Mozzicato S, Platts-Mills TAE. | 2014 | Delayed clinical and ex vivo response to mammalian meat in patients with IgE to galactose-alpha-1,3-galactose. BACKGROUND: In 2009, we reported a novel form of delayed anaphylaxis to red meat related to serum IgE antibodies to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal). Although patients were remarkably consistent in their description of a 3- to 6-hour delay between eating mammalian meat and the appearance of symptoms, this delay has not been demonstrated under observed studies. OBJECTIVES: We sought to formally document the time course of clinical symptoms after the ingestion of mammalian meat in subjects with IgE to alpha-gal and to monitor ex vivo for the appearance of markers of an allergic reaction. METHODS: Open food challenges were performed with mammalian meat in 12 subjects with a history of severe urticarial reactions 3 to 6 hours after eating beef, pork, or lamb, as well as in 13 control subjects. Blood samples were taken hourly during each challenge. RESULTS: Ten of 12 subjects with IgE to alpha-gal had clinical evidence of a reaction during the food challenge (vs none of the control subjects, P < .001). The reactions occurred 3 to 7 hours after the initial ingestion of mammalian meat and ranged from urticaria to anaphylaxis. Tryptase levels were positive in 3 challenges. Basophil activation, as measured by increased expression of CD63, correlated with the appearance of clinical symptoms. CONCLUSION: The results presented provide clear evidence of an IgE-mediated food allergy that occurs several hours after ingestion of the inciting allergen. Moreover, here we report that in vivo basophil activation during a food challenge occurs in the same time frame as clinical symptoms and likely reflects the appearance of the antigen in the bloodstream. |
J Allergy Clin Immunol 2014; 134(1): 108-115. | |
| Commins SP, Jerath MR, Cox K, Erickson LD, Platts-Mills TAE. | 2016 | Delayed anaphylaxis to alpha-gal, an oligosaccharide in mammalian meat. IgE-mediated hypersensitivity refers to immune reactions that can be rapidly progressing and, in the case of anaphylaxis, are occasionally fatal. To that end, identification of the associated allergen is important for facilitating both education and allergen avoidance that are essential to long-term risk reduction. As the number of known exposures associated with anaphylaxis is limited, discovery of novel causative agents is crucial to evaluation and management of patients with idiopathic anaphylaxis. Within the last 10 years several apparently separate observations were recognized to be related, all of which resulted from the development of antibodies to a carbohydrate moiety on proteins. Interestingly, the exposure differed from airborne allergens but was nevertheless capable of producing anaphylactic and hypersensitivity reactions. Our recent work has identified these responses as being due to a novel IgE antibody directed against a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose ("alpha-gal"). This review will present the historical summary of the identification of cetuximab hypersensitivity due to alpha-gal IgE and discuss the non-primate mammalian meat food allergy as well as current goals and directions of our research programs. |
Allergol Int 2016; 65(1): 16-20. | review article |
| Commins SP, Jerath MR, Platts-Mills T. | 2016 | The glycan did it: how the α-gal story rescued carbohydrates for allergists — a US perspective. IgE antibodies to carbohydrate epitopes on allergens are thought to be less common than IgE antibodies to protein epitopes and also of much less clinical significance. Our recent work, however, has identified a novel IgE antibody response to a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal). IgE to alpha-gal has been associated with two distinct forms of anaphylaxis including delayed allergic reactions after eating beef, pork or lamb. IgE antibody responses to alpha-gal have now been found globally. Therefore, establishing the mechanism of the specific IgE antibody response to alpha-gal will be an important aspect to address as this area of research continues. |
Allergo Journal. 2016 Mar 1;25(2):24-8. | |
| Commins SP, Karim S. | 2017 | Development of a novel murine model of alpha-gal meat allergy. Rationale: Specific IgE (sIgE) galactose-alpha-1,3-galactose (alpha-gal) has been associated with delayed reactions to beef, pork or lamb. Development of alpha-gal sIgE and red meat allergy appears to occur following tick bites and alpha-gal has been reported in the gastrointestinal tract of Ixodes ricinusticks. In this study, we examined whether mice treated with tick salivary proteins would develop an alpha-gal IgE response and allergic reaction to red meat. Methods: Wild type (WT) mice were given either Amblyomma americanum (Aa) tick salivary gland extract intradermally (50μg) or saline on days 0, 7 and 21. IgE was assessed on day 28 by ELISA and mice were challenged orally with 10mg pork meat on day 30. Core body temperature was monitored during pork challenge and murine mast cell protease levels (mMCP-1) were assessed. Results: Compared to controls, mice treated with Aa tick extract had elevated alpha-gal sIgE at day 30 (207 IU/mL ± 38.1 vs 3.76 IU/mL ± 1.12, p<0.001). Core body temperature decreased following pork challenge with maximal decrease at 135 minutes in the Aa treated mice (35.6°C ± 2.8), whereas body temperature of control mice did not change. An increase in mMCP-1 was noted in serum of Aa treated mice at the conclusion of pork challenge compared to control mice (1247ng/mL ± 289 vs 15ng/mL ± 5.4). Conclusions: Mice treated with Aa tick extract develop alpha-gal sIgE and exhibit a delayed allergic response to pork meat on oral challenge. This murine model described may provide an important platform for mechanistically studying this new food allergy. |
Journal of Allergy and Clinical Immunology 2017; 139(2, Suppl. S): AB193. | vector; tick; tick saliva; sensitization |
| Commins SP, Kelly LA, Rönmark E, James HR, Pochan SL, Peters EJ, Lundbäck B, Nganga LW, Cooper PJ, Hoskins JM, Eapen SS. | 2012 | Galactose-alpha-1,3-galactose-specific IgE is associated with anaphylaxis but not asthma. RATIONALE: IgE antibodies to the mammalian oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) are common in the southeastern United States. These antibodies, which are induced by ectoparasitic ticks, can give rise to positive skin tests or serum assays with cat extract. OBJECTIVES: To evaluate the relationship between IgE antibodies to alpha-gal and asthma, and compare this with the relationship between asthma and IgE antibodies to Fel d 1 and other protein allergens. METHODS: Patients being investigated for recurrent anaphylaxis, angioedema, or acute urticaria underwent spirometry, exhaled nitric oxide, questionnaires, and serum IgE antibody assays. The results were compared with control subjects and cohorts from the emergency department in Virginia (n = 130), northern Sweden (n = 963), and rural Kenya (n = 131). MEASUREMENTS AND MAIN RESULTS: Patients in Virginia with high-titer IgE antibodies to alpha-gal had normal lung function, low levels of exhaled nitric oxide, and low prevalence of asthma symptoms. Among patients in the emergency department and children in Kenya, there was no association between IgE antibodies to alpha-gal and asthma (odds ratios, 1.04 and 0.75, respectively). In Sweden, IgE antibodies to cat were closely correlated with IgE antibodies to Fel d 1 (r = 0.83) and to asthma (P < 0.001). CONCLUSIONS: These results provide a model of an ectoparasite-induced specific IgE response that can increase total serum IgE without creating a risk for asthma, and further evidence that the main allergens that are causally related to asthma are those that are inhaled. |
American journal of respiratory and critical care medicine. 2012 Apr 1;185(7):723-30. | |
| Commins SP, Lucas S, Hosen J, Satinover SM, Borish L, Platts-Mills TAE. | 2008 | Anaphylaxis and IgE antibodies to galactose-alpha-1,3-galactose (alphaGal): Insight from the identification of novel IgE ab to carbohydrates on mammalian proteins. RATIONALE: Many cases of recurrent anaphylaxis or angioedema lack an obvious cause and are not explained by skin testing. The presence in serum of IgE ab to the xenoantigen galactose-alpha-1,3-galactose (alphaGal) may help in the understanding of these diseases. METHODS: Detailed histories were taken from patients (ages 18-75) presenting to the Allergy Clinic at the University of Virginia with recurrent anaphylaxis or angioedema. Prick tests, intradermal skin tests and serum IgE ab analysis were performed for common indoor, outdoor and food allergens. RESULTS: We identified 10 patients with similar histories and serum IgE ab profiles. These patients had serum IgE ab to beef, pork, lamb, cow’s milk, cat and dog, but were negative for turkey, chicken, and fish, and, in general, to inhaled allergens. Surprisingly, the titer of IgE ab to cat (19.1 IU/ml) and dog (18.2 IU/ml) epithelium were very similar (p 5 0.9) and the correlation between the two was highly significant, r 5 0.98, p < 0.001. In these patients, IgE ab to cat was not explained by sensitivity towards Fel d 1 (r 5 0.58, p 5 0.17). Patients describing a history of anaphylaxis or angioedema four to five hours after the ingestion of red meat reported fewer or no episodes when following an avoidance diet. Direct IgE ab and inhibition assays indicated that the pattern of sensitivity could be explained by IgE ab specific for alphaGal, a carbohydrate commonly expressed on non-primate mammalian proteins. CONCLUSIONS: IgE ab to galactose-alpha-1,3-galactose may be an important cause of recurrent anaphylaxis and angioedema that can be triggered by exposure to beef and pork. Funding: NIH |
Journal of Allergy and Clinical Immunology. 2008 Feb 1;121(2):S25. | |
| Commins SP, Mirakhur B, Platts-Mills TAE. | 2008 | Cetuximab-induced anaphylaxis and IgE specific for galactose-alpha-1,3-galactose . Reply. |
New England journal of medicine. 2008 Mar 13;358(11):1109-17. | |
| Commins SP, Platts-Mills TAE. | 2009 | Anaphylaxis syndromes related to a new mammalian cross-reactive carbohydrate determinant. Anaphylaxis is a severe allergic reaction that can rapidly progress and occasionally be fatal. In instances in which the triggering allergen is not obvious, establishing the cause of anaphylaxis is pivotal to long-term management. Assigning cause is limited, however, by the number of known exposures associated with anaphylaxis. Therefore, identification of novel causative agents can provide an important step forward in facilitating new, allergen-specific approaches to management. In contrast to the view that carbohydrate-directed IgE has minimal, if any, clinical significance, recent data suggest that IgE antibodies to carbohydrate epitopes can be an important factor in anaphylaxis that might otherwise appear to be idiopathic. Here we review the evidence relating to carbohydrates in food allergy and anaphylaxis and discuss the implications of a new mammalian cross-reactive carbohydrate determinant. |
Journal of allergy and clinical immunology. 2009 Oct 1;124(4):652-7. | review article |
| Commins SP, Platts-Mills TAE. | 2013 | Delayed Anaphylaxis to Red Meat in Patients with IgE Specific for Galactose alpha-1,3-Galactose (alpha-gal). Anaphylaxis is a severe allergic reaction that can be rapidly progressing and fatal. In instances where the triggering allergen is not known, establishing the etiology of anaphylaxis is pivotal to long-term risk management. Our recent work has identified a novel IgE antibody (Ab) response to a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal), that has been associated with two distinct forms of anaphylaxis: (1) immediate onset anaphylaxis during first exposure to intravenous cetuximab, and (2) delayed onset anaphylaxis 3-6 h after ingestion of mammalian food products (e.g., beef and pork). The results of our studies strongly suggest that tick bites are a cause, if not the only significant cause, of IgE Ab responses to alpha-gal in the southern, eastern and central United States. Patients with IgE Ab to alpha-gal continue to emerge and, increasingly, these cases involve children. This IgE Ab response cross-reacts with cat and dog but does not appear to pose a risk for asthma; however, it may impair diagnostic testing in some situations. |
Current allergy and asthma reports. 2013 Feb 1;13(1):72-7. | |
| Commins SP, Platts-Mills TAE. | 2013 | Tick bites and red meat allergy. Purpose of review: A novel form of anaphylaxis has been described that is due to IgE antibody (Ab) directed against a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal). Ongoing work regarding the cause and distribution of this IgE response is reviewed. Recent findings: Our recent work has identified a novel IgE Ab response that has been associated with two distinct forms of anaphylaxis: immediate-onset anaphylaxis during first exposure to intravenous cetuximab and delayed-onset anaphylaxis 3-6h after ingestion of mammalian food products (e.g. beef and pork). Further studies strongly suggested that tick bites were a cause, if not the only significant cause, of IgE Ab responses to alpha-gal in the United States and internationally. Summary: Large numbers of patients with IgE Ab to alpha-gal continue to be identified in the USA and globally. Clinicians should be aware of this IgE response as the reactions often appear to be idiopathic because of the significant delay between eating mammalian meat and the appearance of symptoms. |
Asia Pacific Allergy. 2015 Jan 1;5(1):3-16. | review article |
| Commins SP, Platts-Mills, TAE. | 2010 | Allergenicity of carbohydrates and their role in anaphylactic events. The IgE response to pollen allergens often includes IgE antibodies specific for glycosylation motifs on the pollen proteins. These oligosaccharides are present on many different species and are known as cross-reactive carbohydrate determinants. However, IgE antibodies to plant-derived cross-reactive carbohydrate determinants seem to have only minor clinical significance and have not been related to anaphylaxis. Recently, two novel forms of anaphylaxis have become apparent in the southeastern United States: 1) reactions during the first infusion of the monoclonal antibody cetuximab and 2) adult-onset delayed anaphylaxis to red meat. Detailed investigation of serum antibodies established that in both cases, the patients had IgE antibodies specific for the mammalian oligosaccharide galactose alpha-1, 3-galactose. Identification of these cases is helpful in avoiding infusion reactions to cetuximab or recommending specific avoidance of meat derived from mammals. However, the current evidence does not fully resolve why these IgE antibodies are so common in the Southeast or why the anaphylactic or urticarial reactions to red meat are delayed. |
Current allergy and asthma reports. 2010 Jan 1;10(1):29-33. | |
| Commins SP, Satinover SM, Hosen J, Mozena J, Borish L, Lewis BD, Woodfolk JA, Platts-Mills TA. | 2009 | Delayed anaphylaxis, angioedema, or urticaria after consumption of red meat in patients with IgE antibodies specific for galactose-α-1,3-galactose. Background: Carbohydrate moieties are frequently encountered in food and can elicit IgE responses, the clinical significance of which has been unclear. Recent work, however, has shown that IgE antibodies to galactose-α-1,3-galactose (α-gal), a carbohydrate commonly expressed on nonprimate mammalian proteins, are capable of eliciting serious, even fatal, reactions. Objective: We sought to determine whether IgE antibodies to α-gal are present in sera from patients who report anaphylaxis or urticaria after eating beef, pork, or lamb. Methods: Detailed histories were taken from patients presenting to the University of Virginia Allergy Clinic. Skin prick tests (SPTs), intradermal skin tests, and serum IgE antibody analysis were performed for common indoor, outdoor, and food allergens. Results: Twenty-four patients with IgE antibodies to α-gal were identified. These patients described a similar history of anaphylaxis or urticaria 3 to 6 hours after the ingestion of meat and reported fewer or no episodes when following an avoidance diet. SPTs to mammalian meat produced wheals of usually less than 4 mm, whereas intradermal or fresh-food SPTs provided larger and more consistent wheal responses. CAP-RAST testing revealed specific IgE antibodies to beef, pork, lamb, cow's milk, cat, and dog but not turkey, chicken, or fish. Absorption experiments indicated that this pattern of sensitivity was explained by an IgE antibody specific for α-gal. Conclusion: We report a novel and severe food allergy related to IgE antibodies to the carbohydrate epitope α-gal. These patients experience delayed symptoms of anaphylaxis, angioedema, or urticaria associated with eating beef, pork, or lamb. |
Journal of Allergy and Clinical Immunology. 2009 Feb 1;123(2):426-33. | |
| Commins SP, Schuyler AJ, Workman LJ, Matos LA, Eapen SS, Lane CJ, Rispens T, Heymann PW, Platts-Mills TF, Platts-Mills, TA. | 2015 | Delayed Urticarial and Anaphylactic Reactions to Red Meat: Age of Onset, Severity, and Immunology Among 353 Cases and 140 Controls. RATIONALE: Patients with IgE to galactose-alpha-1,3,-galactose report delayed reactions, which vary from itching or gastrointestinal distress to frank anaphylaxis. METHODS: Patients who presented to allergy clinics in Virginia with histories compatible with delayed reactions to red meat (n5353) or with recurrent urticarial or anaphylactic reactions of other types (n5140), many of which appeared to be idiopathic, completed a questionnaire. Sera were assayed for IgE antibodies, total IgE, and alpha-gal specific IgG. RESULTS: IgE was measured to alpha-gal and mammalian allergens, to six inhalant allergens, to five foods, and to two venoms. Results for IgE and IgG to alpha-gal were analyzed in relation to symptoms and related to evidence of preexisting atopy. The presence of IgE antibodies to inhalant allergens was not correlated with sensitization to alpha-gal. Severity of reactions (urticaria, n587 or anaphylaxis, n5249) was not associated with the titer of IgE antibodies to alpha-gal. In addition, neither the ratio of alpha-gal IgE to total IgE nor IgG antibodies to alpha-gal were correlated to reaction severity. Of those with anaphylaxis, 45% reported their first food reaction after age 40, and in 85% of cases the reactions started 2 hours or more after eating meat. The severity of reactions was not related to age of onset or delay before reactions. CONCLUSIONS: Patients with delayed anaphylaxis to red meat present a novel disease with late onset, delayed expression, no immediate symptoms of food allergy, and a very high incidence of previous exposure to ticks. Atopy was not a predictor of IgE responses or food reactions. |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB205. | |
| Commins SP. | 2020 | ‡ Omalizumab reduces food allergy symptoms in patients with alpha-gal syndrome. Rationale: Alpha-gal syndrome (AGS) is a unique food allergy to red meat and products containing mammalian-derived ingredients. Patients can develop AGS after decades of immunologic tolerance of beef, pork, lamb, gelatin and the allergy appears to develop following ectoparasitic tick bites. A subgroup of patients with AGS continue to remain symptomatic despite an appropriate avoidance diet and we assessed whether treatment with omalizumab could improve their symptoms. Methods: Qualifying patients with AGS had urticaria activity score summed over 7 days (UAS7) to assess the itch severity and hive count once daily before, 4 weeks after, and 12 weeks after omalizumab therapy (300 mg every 4 weeks). . Results: Over a 2 year period, fourteen patients with AGS elected to begin omalizumab treatment for chronic urticaria despite an appropriate mammalian avoidance diet. Mean UAS7 scores before treatment were 23.3 (17.8-29.4) and at 4-weeks of treatment the mean UAS7 score declined to 4.2 (1.9-7.5). By 12 weeks of omalizumab therapy, mean UAS7 scores were 0.4 (0-1.1). Patient-reported improvment in symptoms following accidental exposure to mammalian ingredients (e.g., butter, dairy) was noted in 12 of 14 (86%) cases with several noting no symptoms despite intential allergen consumption while on omalizumab. . Conclusions: Omalizumab appears to effectively treat chronic, spontaneous urticaria developing after a new-onset food allergy and may be associated with improved tolerance of accidental exposure to the relevant allergen, alpha-gal. Anti-IgE therapy could offer adjunctive treatment for food allergy when avoidance diet does not sufficiently control symptoms. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB145. | management |
| Commins SP. | 2020 | **‡ Diagnosis & management of Alpha-gal Syndrome: Lessons from 2,500 patients. Alpha-gal Syndrome (AGS) is a unique allergy to non-primate mammalian meat (and derived-products) that is associated with tick bites and is due to a specific IgE antibody to the oligosaccharide galactose-α-1,3-galactose (alpha-gal). AGS has many novel features that broaden the paradigm of food allergy, including that reactions are delayed 3–6 hours after exposure and patients have frequently tolerated red meat for many years prior to the development of allergic reactions. Due to the ubiquitous inclusion of mammal-derived materials in foods, medications, personal products and stabilizing compounds, full avoidance is difficult to achieve. |
Expert Review of Clinical Immunology. 2020 Jul 9:1-1 | expert opinion; primary care; allergist; symptoms; airborne; fume; GI variant; gastrointestinal; pruritus; joint; cofactor; co-factor; diagnosis; blood test; alpha-gal IgE; skin prick test; intradermal testing; seronegative; food challenge; management; treatment; omalizumab; antihistamine; cromolyn; metformin; food; dairy; mammalian byproduct; food additive; gelatin; carrageenan; chiggers; bees; wasps; drugs; medical product; heparin; biologic; monoclonal antibody; pancreatic enzymes; thyroid; heart valve; antivenom; antivenin; perioperative; anesthesia; surgery; hospitalization; intravenous; parenteral |
| Commins SP. | 2016 | Invited commentary: alpha-gal allergy: tip of the iceberg to a pivotal immune response. The syndrome of delayed allergic reactions to the carbohydrate galactose-alpha-1,3-galactose (“alpha-gal”) has become increasingly recognized in allergy and immunology clinics regionally throughout the southeastern USA. Due to the increasing awareness of this unique food allergy, cases have been identified in the northeastern and central USA as well as in Central and South America, Europe, Asia, Scandinavia, and Australia. Clinically, alpha-gal allergy is characterized by reactions to non-primate mammalian meat (e.g., beef, pork, lamb) that occur 3–6 h following exposure. The IgE response to alpha-gal is thought to develop after tick bites and can result in the loss of tolerance to foods that have been safely consumed for years. Although the initial description of alpha-gal allergy in 2009 was limited to red meat, this epitope is now identified in an expanded number of products, medications and foods—both labeled and unlabeled. Moreover, we are beginning to recognize that alpha-gal food allergy is the tip of the iceberg for this immune response. |
Current allergy and asthma reports. 2016 Sep 1;16(9):61. | dairy vaccine bioprosthetic heart valve atherosclerosis inflammatory bowel disease IBD irritable bowel syndrome IBS gut flora sero-negative seronegative Lyme disease |
| Commins, SP. | 2014 | Carbohydrates as Allergens. Complex carbohydrates are effective inducers of Th2 responses, and carbohydrate antigens can stimulate the production of glycan-specific antibodies. In instances where the antigen exposure occurs through the skin, the resulting antibody production can contain IgE class antibody. The glycan-stimulated IgE may be non-specific but may also be antigen specific. This review focuses on the production of cross-reactive carbohydrate determinants, the recently identified IgE antibody response to a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal), as well as discusses practical implications of carbohydrates in allergy. In addition, the biological effects of carbohydrate antigens are reviewed in setting of receptors and host recognition. |
Current allergy and asthma reports. 2015 Jan 1;15(1):492. | review article |
| Contreras M, Pacheco I, Alberdi P, Díaz-Sánchez S, Artigas-Jerónimo S, Mateos-Hernández L, Villar M, Cabezas-Cruz A, De La Fuente J. | 2020 | Allergic reactions and immunity in response to tick salivary biogenic substances and red meat consumption in the zebrafish model. Ticks are arthropod ectoparasite vectors of pathogens and the cause of allergic reactions affecting human health worldwide. In humans, tick bites can induce high levels of immunoglobulin E antibodies against the carbohydrate Galα1-3Galβ1-(3)4GlcNAc-R (α-Gal) present in glycoproteins and glycolipids from tick saliva that mediate anaphylactic reactions known as the alpha-Gal syndrome (AGS) or red meat allergy. In this study, a new animal model was developed using zebrafish for the study of allergic reactions and the immune mechanisms in response to tick salivary biogenic substances and red meat consumption. The results showed allergic hemorrhagic anaphylactic-type reactions and abnormal behavior patterns likely in response to tick salivary toxic and anticoagulant biogenic compounds different from α-Gal. However, the results showed that only zebrafish previously exposed to tick saliva developed allergic reactions to red meat consumption with rapid desensitization and tolerance. These allergic reactions were associated with tissue-specific Toll-like receptor-mediated responses in types 1 and 2 T helper cells (TH1 and TH2) with a possible role for basophils in response to tick saliva. These results support previously proposed immune mechanisms triggering the AGS and provided evidence for new mechanisms also potentially involved in the AGS. These results support the use of the zebrafish animal model for the study of the AGS and other tick-borne allergies. |
Frontiers in cellular and infection microbiology. 2020 Mar 10;10:78. | animal model; zebra fish |
| Contreras M, Vaz-Rodrigues R, Mazuecos L, Villar M, Artigas-Jerónimo S, González-García A, Shilova NV, Bovin NV, Díaz-Sánchez S, Ferreras-Colino E, Pacheco I. | 2023 | Allergic reactions to tick saliva components in zebrafish model. |
Parasites & Vectors. 2023 Dec;16(1):1-5. | ticks; tick saliva |
| Costa J, Villa C, Verhoeckx K, Cirkovic-Velickovic T, Schrama D, Roncada P, Rodrigues PM, Piras C, Martín-Pedraza L, Monaci L, Molina E. | 2021 | Are Physicochemical Properties Shaping the Allergenic Potency of Animal Allergens?. Key determinants for the development of an allergic response to an otherwise ‘harmless’ food protein involve different factors like the predisposition of the individual, the timing, the dose, the route of exposure, the intrinsic properties of the allergen, the food matrix (e.g. lipids) and the allergen modification by food processing. Various physicochemical parameters can have an impact on the allergenicity of animal proteins. Following our previous review on how physicochemical parameters shape plant protein allergenicity, the same analysis was proceeded here for animal allergens.We found that each parameter can have variable effects, ranging on an axis from allergenicity enhancement to resolution, depending on its nature and the allergen. While glycosylation and phosphorylation are common, both are not universal traits of animal allergens. High molecular structures can favour allergenicity, but structural loss and uncovering hidden epitopes can also have a similar impact. We discovered that there are important knowledge gaps in regard to physicochemical parameters shaping protein allergenicity both from animal and plant origin, mainly because the comparability of the data is poor. Future biomolecular studies of exhaustive, standardised design together with strong validation part in the clinical context, together with data integration model systems will be needed to unravel causal relationships between physicochemical properties and the basis of protein allergenicity. |
Clinical Reviews in Allergy & Immunology.2021 Jan 7;:1-36. | pork-cat syndrome; meat allergy; Animal allergens; Protein families; AllergenicityFood processing; Allergen integrity |
| Côté SD, Rooney TP, Tremblay JP, Dussault C, Waller DM. | 2004 | Ecological impacts of deer overabundance. |
Annu. Rev. Ecol. Evol. Syst.. 2004 Dec 15;35:113-47. | |
| Cox KM, Commins S, Capaldo B, Solga M, McSkimming C, Chew C, Schuyler A, Lannigan J, McNamara C, Erickson L. | 2016 | Using mass cytometry to identify novel B cell subsets in red meat allergy. Previous studies have identified a novel food allergy driven by IgE antibodies specific for galactose-α-1,3-galactose (alpha-gal), an oligosaccharide found in red meat. While it is known that B cells play an important role in allergy as the producers of IgE antibodies that drive the allergic response, little is known about the phenotype of these B cells. The number of markers used to identify the major human B cell subsets by flow cytometry has been limited to common B cell proteins and thus precludes high dimensional immune phenotyping of B cell subsets, including unique phenotypes present in allergic individuals. We have addressed this problem by using mass cytometry (CyTOF), which enables the simultaneous analysis of up to 40 markers in a single staining panel. Here we analyzed the expression of 23 cell surface markers in PBMCs from 19 alpha-gal-allergic patients and 20 non-allergic controls by CyTOF. Additionally, we combined our CyTOF data with clinical endpoints to identify markers that may correlate with allergic disease. Our data reveals substantial heterogeneity within major B cells subsets on an individual level. Furthermore, our analysis identifies a number of markers that vary significantly in their expression in allergic versus non-allergic B cells and correlate with serum alpha-gal IgE titers. We hypothesize that B cells with this phenotype play an important role in mediating alpha-gal allergy. These findings demonstrate the power of using CyTOF and analytical tools to extract a hierarchy from high dimensional cytometry data in an unsupervised manner to identify known B cell subsets as well as to find novel B cell populations that differ between alpha-gal allergic and non-allergic individuals. |
J Immunol. 2016; 191-25. | |
| Cox KM, Commins SP, Capaldo BJ, Workman LJ, Platts‐Mills TA, Amir EAD, Lannigan JA, Schuyler AJ, Erickson LD. | 2019 | An integrated framework using high-dimensional mass cytometry and fluorescent flow cytometry identifies discrete B cell subsets in patients with red meat allergy. Summary: Background B cells play a critical role in the development and maintenance of food allergy by producing allergen-specific IgE. Despite the importance of B cells in IgE-mediated food allergy, the identity of sIgE-producing human B cells and how IgE is regulated are poorly understood. Objective: To identify the immunophenotypes of circulating B cells associated with the production of galactose-alpha-1,3-galactose-specific IgE production in patients with red meat allergy. Methods: B cells in PBMC samples obtained from 19 adults with physician-diagnosed red meat allergy and 20 non-meat allergic healthy controls were assessed by mass cytometry along with a bioinformatics analysis pipeline to identify discrete B cell phenotypes that associated with serum sIgE. Fluorescent flow cytometry was then applied to sort purify discrete B cell subsets, and B cells were functionally evaluated on an individual cell level for the production of sIgE by ELISPOT. Results: Discrete B cell phenotypes abundant in meat allergic subjects compared to non-meat allergic controls were found in peripheral blood that do not share typical characteristics of classical isotype-switched memory B cells that express high levels of CD27. These B cell subsets shared higher IgD and lower IgM expression levels coupled with CXCR4, CCR6 and CD25 expression. In vitro polyclonal stimulation of purified B cell subsets from meat allergic subjects demonstrated that these subsets were enriched for cells induced to secrete sIgE. Conclusions and Clinical Relevance: Circulating B cells display increased abundance of discrete B cell subsets in meat allergic subjects. This observation, coupled with the capacity of individual B cell subsets to produce sIgE following activation, implicates these novel B cell phenotypes in promoting IgE in meat allergy. |
Clinical & Experimental Allergy. 2019 May;49(5):615-25. | |
| Coyne S, Condren M. | 2024 | Case Report: Alpha-Gal Diagnosis in an Adolescent With Cystic Fibrosis |
Pediatric pulmonology.:e27424. | cystic fibrosis |
| Cresce ND, Posthumus J, Platts-Mills TAE, Commins SP. | 2012 | Blood Type Does Not Predict the Development of an IgE Response to Galactose-alpha-1,3-Galactose. RATIONALE: Sera from healthy donors of A and O blood types have high levels of IgG antibodies to galactose-alpha-1,3-galactose (alpha-gal), whereas donors of type B or AB blood contain significantly less circulating anti-gal. This is presumably due to the structural similarity of B blood type antigen and alpha-gal. Thus, we hypothesized that blood type B or AB could be protective against the development of IgE to alpha-gal. METHODS: Sera were collected as part of several ongoing studies, each with IRB approval. Individual serum samples (n51047) were ‘‘back’’ typed in the laboratory using standard reagent red blood cells of either A or B type. Agglutination reaction was observed for 5 minutes at 30 C. A logistic regression model was used to assess correlation between blood type and IgE to alpha-gal. A Bonferroni adjustment was used for multiple comparisons in blood types. RESULTS: There was no significant association between blood type and sIgE to alpha-gal (p 5 0.19). Subjects with B/AB blood types constituted 140 of the 1047 samples analyzed (13.4%) and of these, 55 had IgE to alpha-gal (10.1% of positive samples). Within the US, prevalence of blood type B / AB ;15%. No correlation was found for blood type and gender, sIgE to beef, tick exposure or subset of symptoms. CONCLUSIONS: Despite preliminary reports, there does not appear to be an association between blood type and the development of IgE to alpha-gal. Further studies are aimed at assessing the avidity of the IgE response to alpha-gal between subjects of different blood types. |
Journal of Allergy and Clinical Immunology. 2012 Feb 1;129(2):AB80. | |
| Crispell G, Commins SP, Archer-Hartman SA, Choudhary S, Dharmarajan G, Azadi P, Karim S. | 2019 | **Discovery of Alpha-Gal-Containing Antigens in North American Tick Species Believed to Induce Red Meat Allergy. Development of specific IgE antibodies to the oligosaccharide galactose-alpha-1, 3-galactose (alpha-gal) following tick bites has been shown to be the source of red meat allergy. In this study, we investigated the presence of alpha-gal in four tick species: the lone-star tick (Amblyomma americanum), the Gulf-Coast tick (Amblyomma maculatum), the American dog tick (Dermacentor variabilis), and the black-legged tick (Ixodes scapularis) by using a combination of immunoproteomic approach and, carbohydrate analysis. Anti-alpha-gal antibodies identified alpha-gal in the salivary glands of both Am. americanum and Ix. scapularis, while Am. maculatum and De. variabilis appeared to lack the carbohydrate. PNGase F treatment confirmed the deglycosylation of N-linked alpha-gal-containing proteins in tick salivary glands. Immunolocalization of alpha-gal moieties to the salivary secretory vesicles of the salivary acini also confirmed the secretory nature of alpha-gal-containing antigens in ticks. Am. americanum ticks were fed on human blood (lacks alpha-gal) using a silicone membrane system to determine the source of the alpha-gal. N-linked glycan analysis revealed that Am. americanum and Ix. scapularis have alpha-gal in their saliva and salivary glands, but Am. maculatum contains no detectable quantity. Consistent with the glycan analysis, salivary samples from Am. americanum and Ix. scapularis stimulated activation of basophils primed with plasma from alpha-gal allergic subjects. Together, these data support the idea that bites from certain tick species may specifically create a risk for the development of alpha-gal-specific IgE and hypersensitivity reactions in humans. Alpha-Gal syndrome challenges the current food allergy paradigm and broadens opportunities for future research. |
Frontiers in immunology. 2019 May 17;10:1056. | |
| Crispell G. | 2022 | INVESTIGATING THE INVOLVEMENT OF THE TICK VECTOR IN THE INDUCTION OF ALPHA-GALACTOSE HYPERSENSITIVITY (ALPHA-GAL SYNDROME, RED MEAT ALLERGY) IN THE UNITED STATES. Alpha-gal syndrome (AGS or sometimes called red meat allergy) is a result of the development of specific IgE antibodies to the oligosaccharide galactose-α-1,3-galactose (α-gal) after a person has had exposure to tick bites. This dissertation investigates four common tick species found in North America: the lone-star tick (Amblyomma americanum), the Gulf-Coast tick (Amblyomma maculatum), the American dog tick (Dermacentor variabilis), and the black-legged tick (Ixodes scapularis) for the presence of α-gal by utilizing a combination of immunoproteomic approaches and carbohydrate analysis techniques. Anti-α-gal IgM antibodies (M86) were used in immunoblotting to detect α-gal in the saliva and salivary glands of both Am. americanum and Ix. scapularis, while Am. maculatum and De. variabilis were found to lack α-gal. Incubation of Am. americanum partially-fed salivary gland protein extracts with PNGase F confirmed the deglycosylation of N-linked α-gal containing glycans from tick salivary glycoproteins. Immunolocalization of α-gal moieties to the tick salivary secretory vesicles of the salivary acini by confocal microscopy also confirmed the likelihood of a secretory nature of α-gal-containing antigens by ticks. Am. americanum ticks were fed mechanically-defibrinated human blood (lacks α-gal) using a silicone membrane system in an attempt to determine the source of the α-gal. N-linked glycan analysis revealed that Am. americanum and Ix. scapularis contain α-gal in their saliva and salivary glands, but Am. maculatum contains no detectable quantity of α-gal. Consistent with the N-glycan profiling and analysis, salivary samples from Am. americanum and Ix. scapularis stimulated activation of basophils that were primed with plasma from α-gal allergic subjects. Proteomic data generated from these experiments offered multiple potential targets for further investigation and RNAi gene silencing. Together, these data support the theory that bites from only some tick species may specifically create an enhanced risk for the development of α-gal-specific IgE and hypersensitivity reactions in humans. The findings within this research have paved the way for future α-gal research in the tick, however, the exact mechanism by which ticks sensitize a host to α-gal continues to remain unknown. |
Dissertation | Ticks; lone-star tick; Amblyomma americanum; the Gulf-Coast tick ;Amblyomma maculatum; the American dog tick; Dermacentor variabilis; black-legged tick; Ixodes scapularis |
| Croglio MP, Commins SP, McGill SK. | 2021 | Isolated Gastrointestinal Alpha-Gal Meat Allergy Is a Cause for Gastrointestinal Distress without Anaphylaxis. Alpha-gal allergy is characterized by a reaction to beef, pork and othermammalian meat and derived products, typically hours after ingestion, and isdiagnosed by the presence of elevated serum alpha-gal IgE antibodies.1-3 Theallergy appears to develop following the bite of a hard tick and has beendescribed in the United States (particularly the southeastern US), Europe, Africa,Australia, Central and South America and Asia.4-6 Symptoms can includepruritus, rash, diarrhea, abdominal cramping, shock and anaphylaxis, the latter ofwhich is defined by the involvement of two or more systems (skin, GI, cardiac,pulmonary). GI symptoms are caused by IgE-mediated degranulation of mastcells and histamine receptors in the GI tract.Management of the allergy includes counseling on the avoidance ofmammalian meat, and sometimes dairy and other mammalian-derived products. In the case of exposure, short- and long-acting oral anti-histamines such asdiphenhydramine and fexofenadine may be used to ameliorate both GI andallergic symptoms.Allergy and oncology journals have primarily published research on alphagal allergy, and it has not been described previously in the GI literature. Wedescribe patients with the allergy who presented with isolated gastrointestinal(GI) symptoms. |
Gastroenterology. 2021 Jan 29. | Symptoms; GI variant; gastroenterology |
| Crow HM, Samples T, Purser JT. | 2019 | Red Meat Allergy Associated with NSTEMI. Alpha-gal syndrome, also known as mammalian meat allergy, is characterized by a hypersensitivity reaction to galactose-alpha-1,3-galactose. Reactions typically manifest hours after consumption of red meat products such as beef, pork, and lamb. We describe the case of a 64-year-old male resident of rural Oklahoma who presented with anaphylaxis and myocardial infarction. The patient suffered complications that were attributed to porcine-derived heparin in the setting of undiagnosed alpha-gal syndrome. We describe the clinical course of this patient that lead to the diagnosis of alpha-gal syndrome to raise awareness of this disease. |
American Journal of Medical Case Reports. 2019 Jan 23;7(1):13-5. | cardiac; cardiovascular; cardiology; pharmaceutical; heparin |
| Cui Y. | 2014 | When mites attack: domestic mites are not just allergens. Domestic mite species found in indoor environments and in warm or tropical regions are well known for causing allergic disorders. However, little is known about human acariasis, in which mites invade and parasitize the human body in various tissues from the gastrointestinal tract to the lung. Here, we summarize the reported cases of human acariasis of pulmonary, intestinal, oral (anaphylaxis), urinary, otic, and vaginal systems. Because the clinical symptoms of acariasis often overlap with other disease symptoms leading to frequent misdiagnosis, we highlight the need for more attention on these infections. |
Parasites & vectors. 2014 Dec 1;7(1):411. | Arthropod; Acari; mite |
| D’Ercole FJ, Dhandha VH, Levi ML | 2019 | Perioperative Challenges in Patients with Alpha-Gal Allergy. Alpha-gal allergy, also known as, mammalian meat allergy (MMA) is well described in the Allergy literature, however, the Anesthesiology literature remains soft in supporting recommendations for perioperative management. The goal of the Centers for Disease Control and Prevention (CDC) is to better understand the pathogenesis, signs and symptoms, and prevention of this delayed anaphylactic reaction compared to the rapid onset of most food allergies, especially immunoglobulin E (IgE) mediated allergy. MMA is not limited to dietary beef, bison, goat, pork, lamb, and venison intake alone but includes some perioperative medication formularies containing inactive ingredients such as gelatin, glycerin or stearate; surgical products such as surgical powder, xenografts, and porcine derived heart valve per the manufacturer's specifications. This report will include the brief of 6 patients with alpha-gal allergy who presented during 2018 for elective surgery at a North Carolina community hospital when no patients prior were identified with MMA. The patients described have demonstrated one or more of the several perioperative challenges unique to alpha-gal allergy outlined in this manuscript. Authors have identified eight challenges representing knowledge gaps impacting safe anesthesia care. |
J Clin Anesth Pain Manag. 2019;3(1):70-8. | hospital; surgery; perioperative; pharmaceutical; pharmacy; anesthesia |
| D'Souza M, Lania M. | 2020 | S3011 Recurring Gastrointestinal Symptoms as a Novel Presentation of Alpha-Gal Allergy. INTRODUCTION: Galactose-alpha-1,3-galactose (alpha-gal) allergy is a delayed allergy after ingestion of mammalian meat such as beef, pork, or lamb. In the literature, symptoms range from urticaria to anaphylaxis with concomitant gastrointestinal manifestations. There are no case reports of adults with abdominal pain as the sole symptom of this allergy. This case delineates a novel presentation of the alpha-gal allergy with a patient with only gastrointestinal symptoms. |
Official journal of the American College of Gastroenterology| ACG. 2020 Oct 1;115:S1587. | gastroenterology; GI symptoms; gastroesophageal reflux disease; abdominal pain; |
| Dahlgren FS, Paddock CD, Springer YP, Eisen RJ, Behravesh CB. | 2016 | Expanding Range of Amblyomma americanum and Simultaneous Changes in the Epidemiology of Spotted Fever Group Rickettsiosis in the United States. Spotted fever group (SFG) Rickettsia species are etiologic agents of a wide range of human infections from asymptomatic or mild infections to severe, life-threatening disease. In the United States, recent passive surveillance for SFG rickettsiosis shows an increased incidence and decreased severity of reported cases. The reasons for this are not well understood; however, we hypothesize that less pathogenic rickettsiae are causing more human infections, while the incidence of disease caused by more pathogenic rickettsiae, particularly Rickettsia, is relatively stable. During the same period, the range of Amblyomma americanumhas expanded. Amblyomma americanumis frequently infected with CandidatusRickettsia amblyommii”, a SFG Rickettsia of unknown pathogenicity. We tested our hypothesis by modeling incidence rates from 1993 to 2013, hospitalization rates from 1981 to 2013, and case fatality rates from 1981 to 2013 regressed against the presence of A. americanum, the decade of onset of symptoms, and the county of residence. Our results support the hypothesis, and we show that the expanding range of A. americanumis associated with changes in epidemiology reported through passive surveillance. We believe epidemiological and acarological data collected on individual cases from enhanced surveillance may further elucidate the reasons for the changing epidemiology of SFG rickettsiosis. |
The American journal of tropical medicine and hygiene. 2016 Jan 6;94(1):35-42. | |
| Dai J, Obokhare I. | 2024 | Recurrent Ogilvie Syndrome as a Possible Manifestation of Alpha-Gal Syndrome (AGS) Requiring Surgical Management: A Case Report. We present a case of a male in his 60s with a history of alpha-gal syndrome (AGS) who presented with recurrent acute colonic pseudo-obstruction, also known as Ogilvie syndrome, and underwent surgical treatment for life-limiting symptoms of colonic distention, constipation, and abdominal pain. Prior to surgery, he was hospitalized multiple times after beef consumption and was diagnosed with Ogilviesyndrome, requiring a colonoscopy with rectal tube placement for symptom resolution. He later underwent a robotic subtotal colectomy with ileocolic anastomosis. Follow-up visits showed improvement in symptoms of constipation and abdominal distention. This case highlights that AGS may lead to severe manifestations, such as recurrent Ogilvie syndrome. Due to the increasing prevalence of AGS and limited data on disease course, further research is needed to determine symptom manifestations and the potential utility of surgery in management. |
Cureus. 2024 Apr 30;16(4). | GI phenotype; gastroenterology; Ogilvie syndrome; GI variant; surgery |
| Dang Van S, Fouquet O, Jeanneteau A, Leclere JM, Baufreton C. | 2021 | Aortic homograft for aortic valve replacement in patient with Alpha-Gal allergy. Allergy to Galactose-Alpha-1,3-Galactose is an allergy to mammalian proteins, that are present on the surface of standard bioprosthestic valves, and could result in a catastrophic allergic reaction or may cause early deterioration of the bioprostheses. Aortic homograft is an acceptable alternative to standard prosthetic valves (biological and mechanical) to avoid a potential allergic manifestation and the need for definitive oral anticoagulation. We report the implantation of an aortic homograft in a patient with an aortic stenosis who presents a documented AlphaGal allergy. |
General thoracic and cardiovascular surgery. 2021 Jul 19. | cardiac; cardiovascular; xenotransplantation; surgery; perioperative |
| Daripa B, Lucchese S. | 2022 | Novel Case Presentation of Abulia After Lone Star Tick Bite As Evidenced by Raised Titers of Alpha-Gal Specific IgM Immunoglobulin and a Possibility of Alpha-Gal Driven Hypothalamic Dysfunction As the Pathomechanism. Galactose-α-1,3-galactose, an oligosaccharide epitope better acknowledged as α-Gal, is present in non-primate mammal meat, tick bites, microorganisms, and vaccines as a glycoprotein or glycolipid moiety. This can manifest hyperimmune reactions as it enters the human body, known as α-Gal syndrome (AGS). AGS and Guillain-Barré syndrome share cognate immunogenic pathomechanism via conquering immune tolerance further speculating galactose navigated neurological sequel. Unusual symptomatic presentation of abulia in our case, with incidental finding of high titers of α-Gal specific IgE immunoglobulin further supported by temporal resolution of symptoms on abstinence of meat products, raises a high degree of suspicion of neuro-psychiatric manifestation in sensitized α-Gal patients. The pathomechanism is blurry, and an absence of an objective diagnostic tool makes the neurological diagnosis challenging. α-Gal driven immune-related hypothalamic dysfunction could be a possibility that needs further exploration and is a topic of research. |
Cureus. 2022 Apr 28;14(4). | neurology; abulia |
| Darsow U, Gelincik A, Jappe U, Platts‐Mills TA, Ünal D, Biedermann T. | 2024 | Algorithms in allergy: An algorithm for alpha‐Gal syndrome diagnosis and treatment, 2024 update. |
Allergy. 2024;79(11):3169-3172. | diagnosis |
| de la Fuente J, Cabezas-Cruz A, Pacheco I. | 2020 | ‡ Alpha-Gal Syndrome: challenges to understanding sensitization and clinical reactions to alpha-gal. Introduction: The α-Gal syndrome (AGS) is a type of allergy characterized by an IgE antibody response against the carbohydrate Galα1-3Galβ1-4GlcNAc-R (α-Gal). Tick bites are recognized as the most important cause of anti-α-Gal IgE antibody increase in humans. Several risk factors have been associated with the development of AGS, but their integration into a standardized disease diagnosis has proven challenging. Areas covered: Herein we discuss the current AGS diagnosis based on anti-α-Gal IgE titers and propose an algorithm that considers all co-factors in the clinical history of α-Gal-sensitized patients to be incorporated into the AGS diagnosis. The need for identification of host-derived gene markers and tick-derived proteins for the diagnosis of the AGS is also discussed. . Expert opinion: The current AGS diagnosis based on anti-α-Gal IgE titers has limitations because not all patients sensitized to α-Gal and with anti-α-Gal IgE antibodies higher than the cut-off (0.35 IU/ml) develop anaphylaxis to mammalian meat and AGS. The basophil activation test proposed to differentiate between patients with AGS and asymptomatic α-Gal sensitization cannot be easily implemented as a generalized clinical test. In coming years, the algorithm proposed here could be used in a mobile application for easier AGS diagnosis in the clinical practice. |
Expert Review of Molecular Diagnostics. 2020 Sep 1. Forthcoming. | diagnosis |
| de la Fuente J, Contreras, M, Estrada-Peña A, Cabezas-Cruz A. | 2017 | Targeting a global health problem: Vaccine design and challenges for the control of tick-borne diseases. It has been over twenty years since the first vaccines for the control of tick infestations became commercially available. These vaccines proved their efficacy and the potential of this approach for the control of tick-borne diseases (TBDs), which represent a growing burden for human and animal health worldwide. In all these years, research in this area has produced new tick-derived and pathogen-derived candidate protective antigens. However, the potential of vaccines for the control of TBDs has been underestimated due to major challenges to reduce tick infestations, pathogen infection, multiplication and transmission, tick attachment and feeding time and/or host pathogen infection. Nevertheless, vaccines constitute the most safe and effective intervention for the control of TBDs in humans, domestic and wild animals. |
Vaccine 2017; 35(38): 5089-5094. | |
| de la Fuente J, Gortázar C, Cabezas‐Cruz A, Contreras M, Villar M, Pacheco I, Arias A, Mas A. | 2021 | Boosting anti‐alpha‐Gal immune response to control COVID‐19. |
Royal Society Open Science Stage1 Registered Report. 2020;20(10.17605). | coronavirus; Covid-19; SARS-Cov-2; virus; pathogen; vaccine |
| de la Fuente J, Pacheco I, Contreras M, Mateos-Hernández L, Villar M, Cabezas-Cruz A. | 2019 | Guillain-Barré and Alpha-gal Syndromes: Saccharides-induced Immune Responses. The molecular interactions between hosts, vectors and pathogens drive the etiology of infectious diseases. At first sight, the Guillain-Barré and Alpha-Gal syndromes have quite different etiologies but, as proposed here, a closer look into the immune response to galactose-containing oligosaccharide structures that characterizes these two diseases reveals striking commonalities. In this Opinion paper, we address the main molecular drivers of two apparently unrelated diseases, and how the characterization of the immune response and immunological tolerance would advance the control and prevention of these diseases. |
Exploratory Research and Hypothesis in Medicine. 2019 Dec 19;4(4):87-9. | |
| de la Fuente J, Pacheco I, Villar M, Cabezas-Cruz A. | 2019 | The alpha-Gal syndrome: new insights into the tick-host conflict and cooperation. This primer focuses on a recently diagnosed tick-borne allergic disease known as the alpha-gal syndrome (AGS). Tick bites induce in humans high levels of IgE antibodies against the carbohydrate Galalpha1-3Galbeta1-(3)4GlcNAc-R (alpha-Gal) present on tick salivary glycoproteins and tissues of non-catarrhine mammals, leading to the AGS in some individuals. This immune response evolved as a conflict and cooperation between ticks and human hosts including their gut microbiota. The conflict is characterized by the AGS that mediate delayed anaphylaxis to red meat consumption and certain drugs such as cetuximab, and immediate anaphylaxis to tick bites. The cooperation is supported by the capacity of anti-alpha-Gal IgM and IgG antibody response to protect against pathogens with alpha-Gal on their surface. Despite the growing diagnosis of AGS in all world continents, many questions remain to be elucidated on the tick proteins and immune mechanisms triggering this syndrome, and the protective response against pathogen infection elicited by anti-alpha-Gal antibodies. The answer to these questions will provide information for the evaluation of risks, diagnosis and prevention of the AGS, and the possibility of using the carbohydrate alpha-Gal to develop vaccines for the control of major infectious diseases. |
Parasites & vectors. 2019 Dec;12(1):1-5. | |
| de la Fuente J, Urra JM, Contreras M, Pacheco I, Ferreras-Colino E, Doncel-Pérez E, de Mera IG, Villar M, Cabrera CM, Hernando CG, Baquero EV | 2020 | A dataset for the analysis of antibody response to glycan alpha-Gal in individuals with immune-mediated disorders Humans evolved by losing the capacity to synthesize the glycan Galα1-3Galβ1-(3)4GlcNAc-R (α-Gal), which resulted in the development of a protective response mediated by anti-α-Gal IgM/IgG/IgA antibodies against pathogens containing this modification on membrane proteins. As an evolutionary trade-off, humans can develop the alpha-Gal syndrome (AGS), a recently diagnosed disease mediated by anti-α-Gal IgE antibodies and associated with allergic reactions to mammalian meat consumption and tick bites. However, the anti-α-Gal antibody response may be associated with other immune-mediated disorders such as those occurring in patients with COVID-19 and Guillain-Barré syndrome (GBS). Here, we provide a dataset (209 entries) on the IgE/IgM/IgG/IgA anti-α-Gal antibody response in healthy individuals and patients diagnosed with AGS, tick-borne allergies, GBS and COVID-19. The data allows correlative analyses of the anti-α-Gal antibody response with factors such as patient and clinical characteristics, record of tick bites, blood group, age and sex. These analyses could provide insights into the role of anti-α-Gal antibody response in disease symptomatology and possible protective mechanisms. |
F1000Research. 2020 Nov 24;9(1366):1366. | anti-gal; immunoglobulin; IgG; IgM; IgE; Guillain-Barre syndrome; Covid-19; coronavirus |
| de la Fuente J. | 2018 | Controlling ticks and tick-borne diseases...looking forward. Tick-borne diseases (TBDs) represent a growing burden for human and animal health worldwide. Several approaches including the use of chemicals with repellency and parasiticidal activity, habitat management, genetic selection of hosts with higher resistance to ticks, and vaccines have been implemented for reducing the risk of TBDs. However, the application of latest gene editing technologies in combination with vaccines likely combining tick and pathogen derived antigens and other control measures should result in the development of effective, safe, and environmentally sound integrated control programs for the prevention and control of TBDs. This paper is not a review of current approaches for the control of ticks and TBDs, but an opinion about future directions in this area. |
Ticks and tick-borne diseases. 2018 Jul 1;9(5):1354-7. | |
| de la Fuente JD, Gortázar C, Cabezas-Cruz A. | 2020 | Immunity to glycan α-Gal and possibilities for the control of COVID-19. |
Immunotherapy.2020 Dec 14. | coronavirus; Covid-19; SARS-Cov-2; virus; pathogen; vaccine |
| de Silva NR, Dasanayake WM, Karunatilake C, Wickramasingha GD, De Silva BD, Malavige GN. | 2018 | Aetiology of anaphylaxis in patients referred to an immunology clinic in Colombo, Sri Lanka. Background: The aetiology of anaphylaxis differs according to types of foods consumed, fauna and foliage and cultural practices. Although the aetiology of anaphylaxis in Western countries are well known, the causes in South Asian countries have not been reported. We sought to determine the causes of anaphylaxis in patients referred to an immunology clinic in Colombo, Sri Lanka. Methods: 238 episodes of anaphylaxis were reviewed in 188 patients who were referred and skin prick tests and in vitro tests (ImmunoCap) were carried out to assess the presence of allergen specific IgE. Clinical features and severity of anaphylaxis was also recorded along with treatment received. Results: Anaphylaxis to food either following direct exposure 90/238 (37.5%) or after exercise in the form of food dependent exercise induced anaphylaxis 29/238 (12.2%) was the predominant cause of anaphylaxis. Allergy to cow’s milk and red meat, after immediate exposure, accounted for 66/238 (27.7%) of instances of all episodes of anaphylaxis and 66/90 (73.33%) of anaphylaxis due to food. Vaccines accounted for 28/238 (11.8%) of instances of anaphylaxis, especially among children. Of those who developed anaphylaxis to the MMR (n = 14), 71.4% of them had specific IgE to cow’s milk and 35.7% of them had specific IgE to beef. Of those who developed anaphylaxis to insect stings, 27/42 of these episodes occurred following stings of ants (family Formicidae). The predominant cause of anaphylaxis changed with the age, with food allergy being the most frequent trigger of anaphylaxis in childhood, while drug allergy and idiopathic anaphylaxis being more frequent after 30 years of age. Conclusions: In this cohort, anaphylaxis to red meat appears to be the predominant cause of food induced anaphylaxis and presence of beef specific IgE and cow’s milk, appears to be a predisposing factor for vaccine induced anaphylaxis. |
Allergy, Asthma & Clinical Immunology. 2018 Dec;14(1):1-9. | Asia; Sri Lanka; prevalence; vaccine |
| de Silva R, Dasanayake WM, Wickramasinhe GD, Karunatilake C, Weerasinghe N, Gunasekera P, Malavige GN. | 2017 | Sensitization to bovine serum albumin as a possible cause of allergic reactions to vaccines. Background: Immediate type hypersensitivity to vaccines containing bovine/porcine excipients, such as the measles, mumps and rubella (MMR) vaccine is probably due to sensitization to bovine/porcine gelatin. Most patients with such reactions in Sri Lanka have cow's milk (CM) or beef allergy. Objectives: We investigated whether those who had beef and CM allergy had a higher incidence of hypersensitivity reactions to vaccines and the possible trigger of such reactions. Material and methods: Twenty patients with immediate type hypersensitivity reactions to vaccines containing bovine/porcine excipients, controls with allergy to beef/pork (n = 11) or CM (n = 11), and 8 non atopic controls were recruited. Total serum IgE, specific IgE to beef, CM, casein, beta lactoglobulin, gelatin and bovine serum albumin (BSA) by Phadia ImmunoCap and IgE to porcine gelatin by Western blot were evaluated. Results: 11/20, 5/20, 2/20, 2/20, 1/20 and 1/20 patients reported allergic reactions to measles containing, JE, rabies primary chick embryo, pentavalent, diphtheria and tetanus, and adult diphtheria and tetanus vaccines, respectively. Only one patient with allergy to vaccines had gelatin specific IgE, whereas IgE to BSA was seen in 73.3%, 90%, 66.6% and 0 of vaccine, beef or CM allergic and non-atopic controls, respectively. The mean IgE to BSA was higher in patients with allergy to vaccines, although not significant. Specific IgE to BSA was present in 54.7% of children with allergy to CM, of whom 11.8% had high levels (>17.5 kUA/L). In contrast, 66.6% of these children did not have specific IgE to β-lactoglobulin, which is one of the major components of whey protein. Conclusion and clinical relevance: Gelatin does not appear to play a major role in Sri Lankan children with allergy to vaccines. In contrast, due to the higher levels of BSA specific IgE, sensitization to BSA is possibly playing a role. |
Vaccine. 2017 Mar 13;35(11):1494-500. | Asia; Sri Lanka; pharmaceutical; medical product; vaccine; bovine serum albumin; BSA; |
| de Silva R, Karunatilake C, Iddagoda J, Dasanayake D. | 2022 | Food allergy in Sri Lanka–A comparative study. Background: The incidence of IgE mediated food allergy (FA) is increasing in the west. Cow's milk (CM), hen's egg, wheat, soy, peanut, tree nut, fish, and shellfish are responsible for 90% of food allergy in the west; however, local dietary habits may result in specific allergies. Data on food allergies in South Asia is scarce. The present study aims to evaluate the foods that cause immediate type hypersensitivity in Sri Lanka, and to compare with Asia and the developed west. Methods: Records of patients referred to an Immunology clinic from 2010–January 2022 were reviewed. The diagnosis of food allergy was based on standard guidelines. Confirmation of the specific food implicated was based on the history and the presence of specific IgE or component resolved diagnostics by in vitro methods (Phadia ImmunoCap) or by skin prick testing with commercial extracts (Alk Abello). Prick to prick testing was performed for fruits and vegetables when commercial extracts were unavailable. Results: Three hundred and forty-six patients were confirmed with food allergy. CM allergy (CMA) was the commonest (31.2%) followed by red meat allergy (27.7%) and food dependent exercise induced anaphylaxis (FDEIA) (17.9%). Allergy to alpha-gal crustaceans, eggs, gelatin, wheat, coconut milk, and mollusks were seen in 2–10% of patients. The onset of CMA was mainly in childhood. However, in 23/108 patients, onset was after 5 years, including 8 patients in adulthood, and in 14 of the 23, it was preceded by red meat allergy. Onset of primary red meat allergy was predominantly in children, but in 33/96 (34.3%) of patients, it was in adults. Most patients with alpha-gal allergy (21/29, 72.4%) had initial symptoms in childhood and adolescence. Anaphylaxis was diagnosed in 213 patients. FDEIA is the commonest cause (24.7%) followed by red meat allergy (23%), CMA (21.5%) and alpha-gal allergy (10.3%). Allergy to peanuts and fruits were rare. Patients with red meat allergy and/or CMA developed allergy, including anaphylaxis, to vaccines containing bovine/porcine products. Conclusion: CM was the most common food allergy in children, but egg allergy was uncommon. Primary red meat allergy was the second most common, and was associated with allergy to vaccines containing bovine products, such as the measles, mumps and rubella (MMR) vaccine. Allergy to peanuts and fruits were rare. Primary red meat allergy may be responsible for late onset CMA. |
World Allergy Organization Journal. 2022 Dec 1;15(12):100723. | Asia; Sri Lanka; red meat allergy; prevalence |
| Della Marta N, Yuile A, Mok C, Wei J, Oatley M, Skinner T, Miller S, van Nunen S, Clarke SJ, Diakos CI, De Silva M. | 2025 | A protocol for pretreatment testing for antibodies to galactose-alpha-1, 3-galactose to mitigate the risk of cetuximab hypersensitivity reactions. |
JCO 43, 115-115(2025). DOI:10.1200/JCO.2025.43.4_suppl.115 | drugs and medical products; biologic; monoclonal antibody; cetuximab; oncology; cancer |
| Desai N, Thakrar S, Maas M, Navarrete S, Rajabaliev E, Schwartz L, Zuelzer WA. | 2024 | Alpha-Gal Syndrome. |
Unusual Conditions That Every Orthopaedic Surgeon Should Know: A Case-Based Guide. 2024 Jul 30:309-28. | orthopedics; orthopaedics; hemostatic agents; topical thrombin |
| Dewachter P, Jacquenet S, Beloucif S, Goarin JP, Koskas F, Mouton-Faivre C. | 2019 | Pork-cat syndrome revealed after surgery: Anaphylaxis to bovine serum albumin tissue adhesive. Sensitization to cat serum albumin (SA) cross-reacted to other mammalian SAs and led to anaphylaxis to bovine serum albumin (BSA) tissue adhesive use. In cat-allergic patients, preoperative measurement of the cat SA IgE level could be useful to potentially avoid BSA tissue adhesive if positive. |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 Sep 1;7(7):2450-2. | medical products; adhesive; pork-cat syndrome |
| Dewachter P, Kopac P, Laguna JJ, Mertes PM, Sabato V, Volcheck GW, Cooke PJ. | 2019 | Anesthetic management of patients with pre-existing allergic conditions: a narrative review. This narrative review seeks to distinguish the clinical patterns of pre-existing allergic conditions from other confounding non-allergic clinical entities, and to identify the potential related risks and facilitate their perioperative management. Follow-up investigation should be performed after a perioperative immediate hypersensitivity to establish a diagnosis and provide advice for subsequent anaesthetics, the main risk factor for perioperative immunoglobulin E (IgE)-mediated anaphylaxis being a previous uninvestigated perioperative immediate hypersensitivity reaction. The concept of cross-reactivity between drugs used in the perioperative setting and food is often quoted, but usually not supported by evidence. There is no reason to avoid propofol in egg, soy, or peanut allergy. The allergenic determinants have been characterized for fish, shellfish, and povidone iodine, but remain unknown for iodinated contrast agents. Iodinated drugs may be used in seafood allergy. Evidence supporting the risk for protamine allergy in fish allergy and in neutral protamine Hagedorn insulin use is lacking. Conversely, cross-reactivity to gelatin-based colloid may occur in alpha-gal syndrome. Atopy and allergic asthma along with other non-allergic conditions, such as NSAID-exacerbated respiratory disease, chronic urticaria, mastocytosis, and hereditary or acquired angioedema, are not risk factors for IgE-mediated drug allergy, but there is a perioperative risk associated with the potential for exacerbation of the various conditions. |
British journal of anaesthesia. 2019 Jul 1;123(1):e65-81. | |
| Diaz JH | 2020 | Red Meat Allergies after Lone Star Tick (Amblyomma americanum) Bites. Red meat allergies have followed tick bites on every continent except Antarctica. The sensitizing antigen is galactose-α-1,3-galactose (α-gal), an oligosaccharide constituent of nonprimate blood and meat, acquired by ticks during animal bloodfeeding. Because red meat allergy after tick bites is a worldwide phenomenon, the objectives of this review were to describe the global epidemiology of red meat allergy after tick bites and its immunological mechanisms; to identify the human risk factors for red meat allergy after tick bites; to identify the most common tick vectors of red meat allergy worldwide; to describe the clinical manifestations, diagnostic confirmation, and management of patients with red meat allergy after tick bites; and to recommend strategies for the prevention of tick bites. To meet these objectives, Internet search engines were queried with keywords to select scientific articles for review. The keywords included ticks, tick bites, allergy, anaphylaxis, and meat allergy. The study period was defined as 1980–2019. The major risk factors for red meat allergy after tick bites included male sex, non-B blood type, systemic mastocytosis, a bioprosthetic (bovine or porcine) heart valve, and preexisting allergies to gelatin or animal dander. Following confirmation by challenge testing, patients with red meat allergies should avoid red meats, foods containing gelatin, and intravenous immunotherapy with monoclonal antibodies such as cetuximab and infliximab produced in SP2/0 mouse cell lines. Red meat allergy after tick bites represents an emerging threat from tick bites in addition to infectious diseases. |
Southern Medical Journal. 2020 Jun 1;113(6):267-74. | Review artview artlice |
| Díaz-Sánchez S, Vaz-Rodrigues R, Contreras M, Rafael M, Villar M, González-García A, Artigas-Jerónimo S, Gortázar C, de la Fuente J. | 2024 | Zebrafish gut microbiota composition in response to tick saliva biomolecules correlates with allergic reactions to mammalian meat consumption. |
Microbiological Research. 2024 May 29:127786. | |
| Dickel H | 2021 | Exceptional occupational allergies due to food of animal origin. | Der Hautarzt; Zeitschrift fur Dermatologie, Venerologie, und Verwandte Gebiete. 2021 Apr 20. | Occupational medicine |
| Djagny KB, Wang Z, Xu S. | 2001 | Gelatin: A Valuable Protein for Food and Pharmaceutical Industries: Review |
Critical reviews in food science and nutrition. 2001 Nov 1;41(6):481-92. | |
| Dobrochaeva K, Khasbiullina N, Shilova N, Knirel Y, Obukhova P, Nokel A, Kunetskiy R, Tsygankova S, Bello-Gil D, Costa C, Mañez R. | 2021 | Specificity profile of αGal antibodies in αGalT KO mice as probed with comprehensive printed glycan array: Comparison with human anti-Galili antibodies. Background: The α1,3-galactosyltransferase gene-knockout (GalT KO) mice are able to produce natural anti-αGal antibodies apparently without any specific immunization. GalT KO mice are commonly used as a model immunological system for studying anti-αGal responses to Gal-positive xenografts in human. In this study, we compared the specificity of mouse and human αGal antibodies to realize the adequacy of the murine model. Methods: Using hapten-specific affinity chromatography antibodies against Galα1-3Galβ1-4GlcNAcβ epitope were isolated from both human and GalT KO mice blood sera. Specificity of isolated antibodies was determined using a printed glycan array (PGA) containing 400 mammalian glycans and 200 bacterial polysaccharides. Results: The quantity of isolated specific anti-Galα antibodies corresponds to a content of <0.2% of total Ig, which is an order of magnitude lower than that generally assumed for both human and murine peripheral blood immunoglobulin, with a high predominance of IgM over IgG (95% vs 5%). Analysis using a printed glycan array has demonstrated that (a) antibodies from both species bind not only the Galα1-3Galβ1-4GlcNAcβ epitope, but also unrelated glycans; (b) particularly, for human (but not mouse) antibodies the best binders appear to be bacterial polysaccharides; (c) the profile of mouse antibodies is broader, it is noteworthy that they recognize a variety of human blood group B epitopes and even glycans without the α-galactosyl residue. Conclusions: We believe that the mouse model should be used cautiously in xenotransplantation experiments when the fine epitope specificity of antibodies is critical. |
Xenotransplantation.Jan 12 2020.e12672. doi: 10.1111/xen.12672. Epub ahead of print. PMID: 33432698. | blood group B antigen; glycan; microbiota; natural antibodies; polysaccharides; printed glycan array; αGal antibodies; αGal epitope; αGalT KO |
| Dölle-Bierke S, Höfer V, Francuzik W, Näher AF, Bilo MB, Cichocka-Jarosz E, de Oliveira LC, Fernandez-Rivas M, García BE, Hartmann K, Jappe U. | 2023 | Food-Induced Anaphylaxis: Data From the European Anaphylaxis Registry. Relevant points: • In the subgroup of meat and poultry, red meat such as beef and pork accounted for 59% • |
The Journal of Allergy and Clinical Immunology: In Practice. 2023 Mar 27. | Europe; anaphylaxis |
| Donaldson B, Le MTN. | 2019 | The clinical presentation of alpha-gal allergy among pediatric patients with food allergy in southwest Missouri. Alpha-gal allergy is associated with immunoglobulin E (IgE) antibodies to galactose-α-1,3-galactose (alpha-gal), a carbohydrate found in beef, pork, and lamb. First described in the adult population in 2009 by Commins et al, this syndrome is associated with delayed anaphylaxis, angioedema, and urticaria with symptom onset 3 to 6 hours after eating red meat.1-3 Bites from ticks, namely the Lone Star Tick (Amblyomma americanum) in the United States, are associated with production of IgE antibodies to alpha-gal, resulting in an immune system primed to react to foods containing the antigen in patients who previously tolerated meat without symptoms. |
Annals of Allergy, Asthma & Immunology. 2019 Nov 1;123(5):524-5. | |
| Doncel-Pérez E, Contreras M, Gómez Hernando C. | 2020 | What is the impact of the antibody response to glycan alpha-Gal in Guillain-Barré syndrome associated with SARS-CoV-2 infection. There are several reports of the onset of Guillain-Barré syndrome (GBS) symptomsin COVID-19 patients. Previously, we reported that reduction in anti-α-Gal IgE, IgMand IgG antibody titers and alteration of anti-α-Gal antibody isotype compositioncorrelated with COVID-19 severity. In this case study, we aimed to compare the antiα-Gal antibody response in COVID-19 and GBS patients. The levels of anti-α-GalIgE, IgM, IgG and IgA were measured by ELISA in the sera of GBS and COVID-19patients. Patients diagnosed with GBS showed an increase in anti-α-Gal IgM whencompared to healthy individuals and COVID-19 patients. The levels of anti-α-GalIgA were significantly higher in COVID-19 patients. No significant differences wereobserved in the levels of IgE and IgG between GBS and COVID-19 patients. Profileof anti-α-Gal antibody isotypes revealed a higher representation of anti-α-Gal IgMand IgG among GBS and COVID-19 patients, respectively. Remarkably, anti-α-GalIgM was also highly represented in SARS-CoV-2 positive patients suffering GBS.Despite the limited number of cases included in the study, we suggest that anti-α-GalIgM and IgA responses are differentially regulated in GBS and COVID-19 patients,which could reflect the disparate etiologies of these diseases. A possible associationbetween high anti-α-Gal IgA in GBS and COVID-19 severity is proposed. |
Merit Research Journal of Medicine and Medical Sciences (MRJMMS). 2020. | coronavirus; Covid-19; SARS-CoV-2; Guillain-Barré syndrome; glycan; IgG; IgM; IgA |
| Donini R, Haslam SM, Kontoravdi C. | 2021 | Glycoengineering Chinese hamster ovary cells: a short history. Biotherapeutic glycoproteins have revolutionised the field of pharmaceuticals, with new discoveries and continuous improvements underpinning the rapid growth of this industry. N-glycosylation is a critical quality attribute of biotherapeutic glycoproteins that influences the efficacy, half-life and immunogenicity of these drugs. This review will focus on the advances and future directions of remodelling N-glycosylation in Chinese hamster ovary (CHO) cells, which are the workhorse of recombinant biotherapeutic production, with particular emphasis on antibody products, using strategies such as cell line and protein backbone engineering. |
Biochemical Society Transactions. 2021 Apr 30;49(2):915-31. | Chinese Hamster Ovaries; glycosylation; biologics; biotherapeutics; monclonal antibody; mAb; pharmacy; pharmaceutical; drug |
| Drouet M, Boutet S, Lauret MG, Chène J, Bonneau JC, Le Sellin J, Hassoun S, Gay G, Sabbah A. | 1994 | The pork-cat syndrome or crossed allergy between pork meat and cat epithelia (1). This work is a study of the frequency of the association between sensitivity to pork meat and cat epithelia. Comparison with a reference population that was not sensitized to pork meat, shows that this association is highly significant. This suggests therefore the possibility of a crossed allergenicity. If there is a real crossed allergenicity between pork meat and cat epithelia, we suggest that this crossed allergenicity is without doubt much greater and concerns more the meats and epithelia of mammals. |
Allergie et immunologie. 1994 May;26(5):166. | Pork-cat syndrome |
| Drouet M, Sabbah A, Le JS, Bonneau JC, Gay G, Dubois-Gosnet C. | 2001 | Fatal anaphylaxis after eating wild boar meat in a patient with pork-cat syndrome. Crossed allergy between pork and cat epithelia was described by us in 1994. It is due to serum albumin. Nowadays, other bio-chemical observations allow "completion" of the syndrome by extension of the crossed reactivity between other mammal meats and other epithelia of dog and horse. The authors report an observation of the pork-cat syndrome (developing in the form of anaphylaxis, and then ending in the death of the patient), following consumption of wild boar meat. Co-factors, such as effort, taking alcohol or hormonal condition may complicate the picture to make diagnosis more difficult. |
Allergie et immunologie. 2001 Apr;33(4):163-5. | diet; food; boar meat; pork-cat syndrome |
| Drouet M, Sarre ME, Hoppe A, Bonneau JC, Leclere JM, le Sellin J, Beauvillain C, Renier G. | 2016 | Characteristics of a group of 21 patients allergic to meat by sensitization to alpha-Gal allergens. / Caractéristiques d'un groupe de 21 patients allergiques aux viandes par sensibilisation aux allergènes alpha-Gal. Patients allergic to red meat with sensitization to alpha-Gal allergen typically have delayed allergic reactions after eating meats. We present a group of 21 patients allergic to meat with alpha-Gal sensitization and study various characteristics: the existence of tick bites or hymenoptera stings occurring before allergy, the existence of allergic reactions after ingestion of dairy products in particular cheese. Some patients present an associated allergy with dairy products that could lead to suspect an allergy to mammalian milk especially as the IgE sensitization to mammalian milk is common in this syndrome. However, we discuss another possibility: rennet, which is extracted from the stomach of the calf is used to manufacture cheese. This substance derived from offal contains alpha-Gal allergens and could most likely be involved in allergy induced by cheeses. |
Revue Française d'Allergologie 2016; 56(7/8): 533-538. | vector; cross-reactivity; hymenoptera; food; diet; dairy; rennet; cheese |
| Duffy MS, Morris HR, Dell A, Appleton JA, Haslam SM. | 2006 | Protein glycosylation in Parelaphostrongylus tenuis—first description of the Galα1-3Gal sequence in a nematode. The white-tailed deer is the definitive host of the parasitic nematode Parelaphostrongylus tenuis. This parasite also infects a wide variety of domesticated livestock, causing a debilitating neurologic disease. Glycoconjugates are becoming increasingly implicated in nematode strategies to maintain persistent infections in immunologically competent hosts. In this study, we have carried out detailed mass spectrometric analysis together with classical biochemical techniques, including western blotting and immunohistochemical staining with anticarbohydrate monoclonal antibodies and have shown that P. tenuis contains complex-type N-glycans with the antennae capped with Galα1-3Galβ1-4GlcNAc sequence. By mimicking a vertebrate glycan, Galα1-3Gal may aid the parasite in evading immunological detection by the host. This is the first report of the Galα1-3Gal sequence in a nematode. |
Glycobiology. 2006 Sep 1;16(9):854-62. | Nematode; invertebrate |
| Dunkman WJ, Rycek W, Manning MW. | 2019 | † ** What Does a Red Meat Allergy Have to Do With Anesthesia? Perioperative Management of Alpha-Gal Syndrome. Over the past decade, there has been a growing awareness of a new allergic syndrome known as alpha-gal allergy or alpha-gal syndrome, commonly recognized as a red meat allergy. We performed a review of the literature to identify articles that provide both background on this syndrome in general and any reports of reactions to medications or medical devices related to alpha-gal syndrome. Alpha-gal syndrome results from IgE to the oligosaccharide galactose-α-1,3-galactose, expressed in the meat and tissues of noncatarrhine mammals. It is triggered by the bite of the lone star tick and has been implicated in immediate-onset hypersensitivity to the monoclonal antibody cetuximab and delayed-onset hypersensitivity reactions after the consumption of red meat. There is growing recognition of allergic reactions in these patients to other drugs and medical devices that contain alpha-gal. Many of these reactions result from inactive substances that are part of the manufacturing or preparation process such as gelatin or stearic acid. This allergy may be documented in a variety of ways or informally reported by the patient, requiring vigilance on the part of the anesthesiologist to detect this syndrome, given its serious implications. This allergy presents a number of unique challenges to the anesthesiologist, including proper identification of a patient with alpha-gal syndrome and selection of anesthetic and adjunctive medications that will not trigger this allergy. |
Anesthesia & Analgesia. 2019 Nov 1;129(5):1242-8. | review article; perioperative care; pharmacy; pharmaceutical; medication; surgery; hospitalization; medical products; drugs; anesthesia |
| Dupont B, Mariotte D, Clarisse B, Galais MP, Bouhier-Leporrier K, Grellard JM, Le Mauff B, Reimund JM, Gervais R. | 2014 | Risk factors associated with hypersensitivity reactions to cetuximab: anti-cetuximab IgE detection as screening test. AIM: To describe the factors associated with a high risk of a hypersensitivity reaction to cetuximab. PATIENTS & METHODS: We retrospectively studied a cohort of patients living in Normandy (France) treated with cetuximab. RESULTS: Among the 229 treated patients, 24 (10.5%) had a hypersensitivity reaction to cetuximab, including 11 grade 3-5 reactions. Detection of anti-cetuximab IgE could be performed in 108 patients. Anti-cetuximab IgE was found in 13 of 17 patients (76.5%) who had a hypersensitivity reaction to cetuximab compared with 17 of 91 control patients (18.7%; adjusted odds ratio: 14.99; 95% CI: 3.59-62.63). No clinical criteria predicted the risk of allergy to cetuximab. CONCLUSION: Anti-cetuximab IgE may help physicians identify patients at risk of a hypersensitivity reaction to cetuximab. |
Future Oncology. 2014 Nov;10(14):2133-40. | |
| Dupont B, Mariotte D, Dugué AE, Clarisse B, Grellard JM, Babin E, Chauffert B, Dakpé S, Moldovan C, Bouhier‐Leporrier K, Reimund, JM. | 2017 | Utility of serum anti-cetuximab immunoglobulin E levels to identify patients at a high risk of severe hypersensitivity reaction to cetuximab. AIM: Cetuximab is an anti-epidermal growth factor receptor antibody used for the treatment of metastatic colorectal cancer and head and neck cancer. Hypersensitivity reactions (HSRs) are associated with cetuximab use. The aim of the study was to evaluate the utility of anti-cetuximab immunoglobulin E (IgE) detection in order to identify patients at risk of HSR to cetuximab. METHODS: We included patients ready to receive a first cetuximab infusion in a prospective cohort carried out at nine French centres. Pretreatment anti-cetuximab IgE levels were measured. We compared the proportion of severe HSRs in the low anti-cetuximab IgE levels (</=29 IgE arbitrary units) subgroup with that in a historical cohort of 213 patients extracted from a previous study. RESULTS: Of the 301 assessable patients (mean age: 60.9 +/- 9.3 years, head-and-neck cancer: 77%), 66 patients (22%) had high anti-cetuximab IgE levels, and 247 patients received cetuximab (including 38 with high anti-cetuximab levels). Severe HSRs occurred in eight patients (five grade 3 and three grade 4). The proportion of severe HSRs was lower in the low anti-cetuximab IgE levels subgroup vs. the historical cohort (3/209 [1.4%] vs. 11/213 [5.2%], odds ratio, 0.27, 95% confidence interval, 0.07-0.97), and higher in high vs. low anti-cetuximab IgE levels subgroup (5/38 [13.2%] vs. 3/209 [1.4%]; odds ratio, 10.4, 95% confidence interval, 2.4-45.6). Patients with severe HSRs had higher anti-cetuximab IgE levels than patients without reaction (median, 45 vs. 2 IgE arbitrary units, P = 0.006). CONCLUSIONS: Detection of pretreatment anti-cetuximab IgE is feasible and helpful to identify patients at risk of severe cetuximab-induced HSRs. |
British Journal of Clinical Pharmacology. 2017 Mar;83(3):623-31. | |
| Dupont B, Mariotte D, Moldovan C, Grellard JM, Vergnaud, MC, Laroche D, Gervais R. | 2014 | Case Report About Fatal or Near-Fatal Hypersensitivity Reactions to Cetuximab: Anticetuximab IgE as a Valuable Screening Test. Hypersensitivity reactions are a classic side effect of cetuximab. We report the cases of three patients who developed life-threatening hypersensitivity to cetuximab, which could have been predicted by assessing the concentration of serum anticetuximab immunoglobulin (Ig)E. The anticetuximab IgE concentration could be an interesting test to predict which patients are at risk of experiencing severe hypersensitivity reactions to cetuximab. |
Clinical Medicine Insights: Oncology. 2014 Jan;8:CMO-S13897. | |
| Dupont M, Carlier C, Gower-Rousseau C, Barbier-Lider P, Botsen D, Brasseur M, Burgevin A, Chourbagi C, D’Almeida R, Hautefeuille V, Hentzien M | 2022 | Incidence and associated factors of cetuximab-induced hypersensitivity infusion reactions in 1392 cancer patients treated in four French areas: A possible association with Lyme disease?. |
Published online 2022. https://www.researchsquare.com/article/rs-1210416/latest.pdf | France; pharmaceutical; biologic; monoclonal antibody; cetuximab |
| Dvorníková BZ. | 2024 | Master's thesis: Identification of Glycosylated Tick Proteins Containing Immunogenic Epitopes. |
N/A | vectors; ticks; Ixodes scapularis; Ixodes ricinus; Ornithodoros moubata |
| Eberlein B, Mehlich J, Reidenbach K, Pilz C, Hilger C, Darsow U, Brockow K, Biedermann T. | 2020 | Negative oral provocation test with porcine pancreatic enzyme plus cofactors despite confirmed α-Gal syndrome. This case shows that Kreon, an α-Gal-containing porcine pancreas extract can be tolerated in higher than usual doses and despite cofactors in patients with α-Gal syndrome. This is particularly relevant in cases where the drug is necessary to treat exocrine pancreatic insufficiency. Two similar cases have been described [3], but this is the first case in which cofactors, well-known amplifiers of reactions to α-Gal [4], were also tested with the α-Galcontaining drug. After allergy work-up a hymenoptera allergy could be excluded as cause or co-factor of the anaphylaxis. |
J Investig Allergol Clin Immunol. 2020 Jun 3;30(6):6. | |
| Ebo, D. G., Faber, M., Sabato, V., Leysen, J., Gadisseur, A., Bridts, C. H., & De Clerck, L. S. | 2013 | Sensitization to the mammalian oligosaccharide galactose-alpha-1,3-galactose (alpha-gal): experience in a Flemish case series. BACKGROUND: Recent observations have disclosed that the galactose-alpha (1,3)-galactose (alpha-gal) moiety of non-primate glycoproteins can constitute a target for meat allergy. OBJECTIVE: To describe adults with allergic reactions to mammalian meat, dairy products and gelatin. To investigate whether patients could demonstrate sensitization to activated recombinant human coagulation factor VII ectapog alpha that is produced in baby hamster kidney cells. METHODS: Ten adults with mammalian meat, dairy products and gelatin allergies were examined using quantification of specific IgE and/or skin prick test for red meat, milk, milk components, gelatin, cetuximab and eptacog alpha. RESULTS: Most patients demonstrate quite typical clinical histories and serological profiles, with anti-alpha-gal titers varying from less than 1% to over 25% of total serum IgE. All patients demonstrate negative sIgE for gelatin, except the patient with a genuine gelatin allergy. All patients also demonstrated a negative sIgE to recombinant milk components casein, lactalbumin and lactoglobulin. Specific IgE to eptacog was positive in 5 out of the 9 patients sensitized to alpha-gal and none of the 10 control individuals. CONCLUSION: This series confirms the importance of the alpha-gal carbohydrate moiety as a potential target for allergy to mammalian meat, dairy products and gelatin (oral, topical or parenteral) in a Flemish population of meat allergic adults. It also confirms in vitro tests to mammalian meat generally to be more reliable than mammalian meat skin tests, but that diagnosis can benefit from skin testing with cetuximab. Specific IgE to gelatin is far too insensitive to diagnose alphaa-gal related gelatin allergy. IgE binding studies indicate a potential risk of alpha-gal-containing human recombinant proteins produced in mammalians. |
Acta clinica Belgica. 2013 Jun 1;68(3):206-9. | |
| Edlow JA. | 2023 | Alpha-Gal Syndrome: A Novel and Increasingly Common Cause of Anaphylaxis. |
Annals of Emergency Medicine. 2023 Oct 11. | emergency medicine; anaphylaxis |
| Eisen L. | 2022 | Personal protection measures to prevent tick bites in the United States: Knowledge gaps, challenges, and opportunities. Personal protection measures to prevent human tick encounters from resulting in bites are widely recommended as the first line of defense against health impacts associated with ticks. This includes using repellents, wearing untreated or permethrin-treated protective clothing, and conducting tick checks after coming inside, aided by removing outdoor clothing articles and running them in a dryer on high heat (to kill undetected ticks) and taking a shower/bath (to aid in detecting ticks on the skin). These measures have the benefit of incurring no or low cost, but they need to be used consistently to be most effective. In this paper, I review the level of use (acceptability combined with behavior) of the above-mentioned personal protection measures and their effectiveness to prevent tick bites and tick-borne disease. Studies on the level of use of personal protection measures to prevent tick bites have used different recruitment strategies, focused on different types of respondent populations, employed variable phrasings of survey questions relating to a given personal protection measure, and presented results based on variable frequencies of taking action. This complicates the synthesis of the findings, but the studies collectively indicate that members of the public commonly take action to prevent tick bites, most frequently by wearing untreated protective clothing or conducting tick checks (done routinely by 30 to 70% of respondents in most studies of the public), followed by showering/bathing after being outdoors or using repellents on skin/clothing (15 to 40% range), and with permethrin-treated clothing being the least frequently used tick bite prevention method (<5 to 20% range). A suite of experimental studies have shown that applying repellents or permethrin to coveralls or uniform-style clothing can result in decreased numbers of tick bites, but similar studies are lacking for members of the public wearing summer-weight clothing during normal daily activities. Moreover, a set of case-control and cross-sectional studies have explored associations between use of different personal protection measures to prevent tick bites and Lyme disease or other tick-borne infections. The results are mixed for each personal protection measure, with some studies indicating that regular use of the measure is associated with a reduction in tick-borne disease while other studies found no similar protective effect. One possible interpretation is that these personal protection measures can protect against tick-borne infection but the information gathered to date has not been sufficiently detailed to clarify the circumstances under which protection is achieved, especially with regards to frequency of use, parts of the body being protected, and use of combinations of two or more potentially protective measures. In conclusion, personal protection measures to prevent tick bites are used by the public and merit further study to better understand how they need to be used to have the greatest public health impact. |
Ticks and Tick-borne Diseases. 2022 Mar 26:101944. | ticks; tick bite avoidance |
| El Hanache H, Perennec T, Beaumont P, Puillandre E, Schwender D, Donguy L, Froidefond C, Jarlot S, Petit N, Nootens C, Pirson F. | 2023 | Food anaphylaxis in the elderly: Analysis of allergy vigilance network data from 2002 to 2021. Background: Few studies have focused on food allergies in the elderly, even though it may persist or appear de novo. Methods: We reviewed data for all cases of food-induced anaphylaxis in people age ≥ 60 reported to the French "Allergy Vigilance Network" (RAV) between 2002 and 2021. RAV collates data reported by French-speaking allergists regarding cases of anaphylaxis graded II to IV according to the Ring and Messmer classification. Results: In total, 1: 1 cases were reported, with an even sex distribution and mean age was 67.4 years (range 60 to 93). The most frequent allergens were mammalian meat and offal (31 cases, 16.2%), often associated with IgE to α-Gal. Legumes were reported in 26 cases (13.6%), fruits and vegetables in 25 cases (13.1%), shellfish 25 cases (13.1%), nuts 20 cases (10.5%), cereals 18 cases (9.4%), seeds 10 cases (5.2%), fish 8 cases (4.2%) and anisakis 8 cases (4.2%). Severity was grade II in 86 cases (45%), grade III in 98 cases (52%) and grade IV in 6 cases (3%) with one death. Most episodes occurred at home or in a restaurant and in most cases adrenaline was not used to treat the acute episode. Potentially relevant cofactors such as beta-blocker, alcohol or non-steroidal anti-inflammatory drug intake were present in 61% of cases. Chronic cardiomyopathy, present in 11.5% of the population, was associated with greater, grade III or IV reaction severity (OR 3.4; 1.24-10.95). Conclusion: Anaphylaxis in the elderly has different causes to younger people and requires detailed diagnostic testing and individualized care plans. |
Clinical and Experimental Allergy: Journal of the British Society for Allergy and Clinical Immunology. 2023 Feb 22. | Europe; France; prevalence; elderly; senior citizen; age; epidemiology |
| Eller E, Skov PS, Baumann K, Hilger C, Ollert M, Bindslev-Jensen C. | 2021 | Delayed reaction in alpha-gal allergy is reflected in serum levels after ingestion of pork kidney, and absorption is dependent on food processing. Letter to the editor |
Clinical and experimental allergy: journal of the British Society for Allergy and Clinical Immunology. | Kidney; digestion; mechanism of delay |
| Elston DM. Climate change and expansion of tick geography. | 2020 | Climate change and expansion of tick geography. The expanding range of tick-borne diseases is a growing problem worldwide. Climate change plays a preeminent role in the expansion of tick species, especially for southern ticks in the United States such as Amblyomma species, which have introduced new pathogens to northern states.1-5 In addition to well-known tickborne diseases, Amblyomma ticks have been implicated in the spread of emerging severe and potentially fatal viral illnesses, including Bourbon virus and Heartland virus.6 The increasing range of Amblyomma ticks also exposes new populations to tick-induced meat allergy (alpha-gal) syndrome, whereby development of specific IgE antibodies to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) following tick bites results in severe allergic responses to consumption of beef, pork, and lamb. |
Cutis. 2020 Apr 1;105(4):161-2. | |
| Enders FB, Elkuch M, Wörner A, Hofmeier KS, Hartmann K. | 2023 | Alpha-gal syndrome initially misdiagnosed as chronic spontaneous urticaria in a pediatric patient: a case report and review of the literature |
Journal of Medical Case Reports. 2023 Dec;17(1):1-3. | Europe; Switzerland; pediatric; gelatin |
| Enoch S, Shaaban H, Dunn KW. | 2005 | Informed consent should be obtained from patients to use products (skin substitutes) and dressings containing biological material. |
Journal of Medical Ethics. 2005 Jan 1;31(1):2-6. | perioperaiive care; dermatology; medical products; skin substitutes; dressings; informed consent |
| Epelboin L, Roche F, Dueymes M, Guillot G, Duron O, Nacher M, Djossou F, Soria A. | 2021 | Allergy to Mammalian Meat Linked to Alpha-Gal Syndrome Potentially After Tick Bite in the Amazon: A Case Series. The past decade has seen the emergence of a new type of food allergy occurring after ingestion of mammalian meat. This allergy is related to immunoglobulin (Ig)E specific for galactose-alpha-1,3 galactose (α-Gal). Originally described in the United States in 2009, other cases have subsequently been described in Australia and in Europe, but still very few in Latin America. The purpose of this study was to show the existence of this pathology in French Guiana and to describe the historical, clinical, and biological characteristics of these patients. Patients reporting an allergy to mammalian meat were included between September 2017 and August 2019. Eleven patients were included, nine of whom exhibited digestive symptoms; four, urticaria reactions; three, respiratory reactions; and angioedema. The time between ingestion of red meat and reaction varied between 1.5 and 6 hours. The implicated meats were most often beef and pork. All patients had been regularly exposed to tick bites before the appearance of symptoms. All the samples (n = 7) were positive for anti-α-Gal anti-mammalian meats IgE. All the patients were Caucasian French expatriates. This study confirms the presence of this new entity in French Guiana and is the largest reported in Latin America. Our results do not clearly allow us to state that tick bites are the cause of this allergy, but all patients reported being exposed regularly to these arthropods. |
The American journal of tropical medicine and hygiene.:tpmd201630. | South America; French Guiana; Amblyomma cajennense |
| Erickson LD, Wilson JM, Cramton K, Rival CM. | 2025 | Pre-clinical strategies and emerging technologies driving advances in the alpha-gal syndrome. |
Allergology International. 2025 Apr 2. | |
| Erickson LD, Chandrasekhar JL, Cox KM. | 2020 | B Cell Responses in the Development of Mammalian Meat Allergy. Studies of meat allergic patients have shown that eating meat poses a serious acute health risk that can induce severe cutaneous, gastrointestinal, and respiratory reactions. Allergic reactions in affected individuals following meat consumption are mediated predominantly by IgE antibodies specific for galactose-α-1,3-galactose (α-gal), a blood group antigen of non-primate mammals and therefore present in dietary meat. α-gal is also found within certain tick species and tick bites are strongly linked to meat allergy. Thus, it is thought that exposure to tick bites promotes cutaneous sensitization to tick antigens such as α-gal, leading to the development of IgE-mediated meat allergy. The underlying immune mechanisms by which skin exposure to ticks leads to the production of α-gal-specific IgE are poorly understood and are key to identifying novel treatments for this disease. In this review, we summarize the evidence of cutaneous exposure to tick bites and the development of mammalian meat allergy. We then provide recent insights into the role of B cells in IgE production in human patients with mammalian meat allergy and in a novel mouse model of meat allergy. Finally, we discuss existing data more generally focused on tick-mediated immunomodulation, and highlight possible mechanisms for how cutaneous exposure to tick bites might affect B cell responses in the skin and gut that contribute to loss of oral tolerance. |
Molecular medical microbiology 2002 Jan 1 (pp. 1089-1116). Academic Press. | review article; vector; tick; tick saliva; sensitization; B cell; tick-mediated immunomodulation |
| Erwin EA, Custis NJ, Satinover SM, Perzanowski MS, Woodfolk JA, Crane J, Wicken, K, Platts-Mills TA. | 2005 | Quantitative measurement of IgE antibodies to purified allergens using streptavidin linked to a high-capacity solid phase. BACKGROUND: Commercially available assays for IgE antibody provide results in international units per milliliter for many allergen extracts, but this is not easily achieved with purified or novel allergens. OBJECTIVE: To develop assays for IgE antibody suitable for purified or novel allergens by using a commercially available immunosorbent. METHODS: Streptavidin coupled to a high-capacity immunosorbent (CAP) was used to bind biotinylated purified allergens from mite (Der p 1 and Der p 2), cat (Fel d 1), and dog (Can f 1). Assays for IgE antibody to these allergens were performed on sera from children (asthma and control) as well as adults with atopic dermatitis. RESULTS: The results were validated by serial dilution of sera with high and low levels of IgE antibody and were quantitated in international units per milliliter by using a standard curve. Values for IgE antibody to Der p 1, Der p 2, and Fel d 1 correlated with values obtained with the allergen extracts (r2 = 0.80, 0.84, and 0.95, respectively; P < .001 in each case). Furthermore, the values for IgE antibody in sera from children with high exposure to mite and cat allergens demonstrated 10-fold higher levels of IgE antibody to Der p 1 and Der p 2 than to Fel d 1 (P < .001). CONCLUSION: The streptavidin immunosorbent technique provides a new method for quantifying IgE antibody to purified proteins. The results provide evidence about the high quantities of IgE antibody to purified inhalant allergens in patients with atopic dermatitis. In addition, the results demonstrate major differences in IgE antibodies specific for mite and cat allergens among children with high exposure to both allergens. |
Journal of allergy and clinical immunology. 2005 May 1;115(5):1029-35. | |
| Ezhuthachan I, Kaplan B. | 2018 | A CASE OF CHRONIC URTICARIA AND ANGIOEDEMA WITH FALSE-POSITIVE ALPHA-GAL IGE. Introduction: Sensitization to galactose-alpha-1,3-galactose (alpha-gal) has been linked with delayed urticaria, angioedema and anaphylaxis to mammalian meat. We report chronic urticaria and angioedema (CUA) in a patient with false-positive alpha-gal and mammalian meat IgE. Case Description: Patient is an 18-year-old male with urticaria and angioedema referred to our clinic for evaluation of positive IgE to alpha-gal and mammalian meat. He first developed urticaria/angioedema at 14 years of age. It was treated with H 1, H 2 blockers and completely resolved in 2 months. After being asymptomatic for 3 years, his symptoms recurred. No triggers were noted, including no dietary changes and worsening in symptoms upon meat or dairy ingestion. Laboratory evaluation was remarkable for positive IgE for alpha-gal (3.76 kU/L), beef (2.01 kU/L), lamb/mutton (0.77 kU/L) and pork (1 kU/L). Treatment with fexofenadine, cetirizine and famotidine was initiated and patient was referred to our clinic for further evaluation. We recommended a 2-week trial of red meat elimination diet, which didn't result in symptom improvement. Hives/angioedema didn't worsen after reintroduction of red meat. Montelukast was added to his medications, resulting in 70% improvement in symptoms. . Discussion: High rate of false-positive IgE to food allergens is well established. To our knowledge this is the first report of false positive alpha-gal IgE in CUA, misdiagnosed as allergy to mammalian meat. This case demonstrates the importance of a comprehensive history in CUA along with careful selection and evaluation of relevant laboratory tests. Note: it's impossible to include this paper in this database without noting that some of us in the alpha-gal community have wondered how the authors came to the conclusion that this was a case of a false positive without eliminating non-meat sources of alpha-gal from the patient's diet that may have been the source of ongoing reactions: dairy, gelatin, etc. |
Annals of Allergy, Asthma & Immunology. 2018 Nov 1;121(5):S115. | |
| Fagerstone KA, Clay WH. | 1997 | Overview of USDA animal damage control efforts to manage overabundant deer. |
Wildlife Society Bulletin (1973-2006). 1997 Jul 1;25(2):413-7. | Lone star tick; host; white-tailed deer |
| Fang ZY, Zhang HT, Lu C, Lu QM, Yu CH, Wang HY. | 2018 | Association between allergic diseases and irritable bowel syndrome: a retrospective study. Background: The relationship between allergic disease and irritable bowel syndrome (IBS) is poorly understood. We aimed to investigate the potential association as well as the underlying immunological mechanisms. Methods: A retrospective case-control study of 108 atopic patients from among outpatients in an allergy clinic (allergic rhinitis [AR], n = 49; chronic urticaria [CU], n = 59) and 74 controls from among ward companions was conducted from November 2016 to March 2017. The detection rates and related gastrointestinal (GI) symptoms of IBS, as well as immunological indices, were calculated. Results: CU patients had a trend of increase in the detection of IBS compared to controls (OR = 4.846; 95% CI 0.967–24.279, p = 0.077). Loose stools (OR = 2.406; 95% CI 1.075–5.386, p < 0.05) and viscous stools (OR = 2.665; 95% CI 1.250–5.682, p < 0.05) were more common in CU patients. Atopic patients positive for serum total immunoglobulin E (IgE) (OR = 3.379; 95% CI 1.088–10.498, p < 0.05) or house dust mite (HDM)-specific IgE (OR = 3.640; 95% CI 1.228–10.790, p < 0.05) were more likely to have abdominal bloating. Besides, a positive association between levels of total IgE and severity of abdominal bloating was observed (p < 0.05). An HDM-specific IgE-positive reaction was independently associated with abdominal bloating in atopic patients (p < 0.05). Conclusions: Allergic disease has a clear clinical association with IBS with more frequent and severe symptoms of IBS. CU patients have a tendency to suffer from IBS, usually with diarrhea. Serum total IgE and HDM-specific IgE are positively correlated with GI symptoms in atopic patients. |
International archives of allergy and immunology. 2018;177(2):153-9. | gastrointestinal disease; GI; irritable bowel syndrome; IBS; gastroenterology |
| Farooque S, Kenny M, Marshall SD. | 2019 | Anaphylaxis to intravenous gelatin-based solutions: a case series examining clinical features and severity. Summary: The proportion of patients receiving intravenous gelatin-based colloids has increased in the last decade due to safety concerns about starch-based products. Recent research suggests hypersensitivity reactions to intravenous gelatin-based solutions occur at similar rates per administration as non-depolarising neuromuscular blocking agents such as rocuronium (6.2/100,000 administrations). There are scant published data on clinical features, diagnosis and time course of these reactions. We undertook a review of cases reported and tested at one of the UK's largest drug allergy clinics. All patients seen in the drug allergy clinic at Imperial College Healthcare NHS Trust (London, UK) with a confirmed diagnosis of anaphylaxis to gelatin-based solutions between May 2013 and May 2018 were included. We retrospectively reviewed clinical histories, skin test results and severity of reactions in this cohort of patients. Twelve patients with anaphylaxis to gelatin-based solutions were identified (eight women, mean (SD) age 58 (17) years). Eleven reactions were severe or life-threatening with three progressing to cardiac arrest. Presentation was commonly delayed; only three patients suffered reactions within 5 min of the solution being administered with a further six presenting 10–70 min later. Where measured, tryptase was elevated in all patients (median (IQR [range]) 14.7 (8.2–23.8 [6.5–83.4]) ng.ml−1). Reactions to gelatin-based solutions are usually severe and can present with latency uncommon with other intravenous anaesthetic triggers. The use of gelatin-based solutions in the peri-operative setting should be re-assessed given the risk of severe allergy. |
Anaesthesia. 2019 Feb;74(2):174-9. | medical products; gelatin; plasma volume expander; colloid; hospital; perioperative |
| Faruque MO, Mohiuddin AK, Mahmud S. | 2020 | Prevalence, severity and risk factors of food allergy and food addiction among the people of Tangail district, Bangladesh. Food allergy is an abnormal response of some particular foods triggered by the body’s immune system. Food addiction which generally shares a similar neurobiological and behavioral framework with substance addiction like foods. The aim of this study was to evaluate common food items responsible for food allergy along with food addiction among Bangladeshi people. Methods: A cross-sectional study among 699 participants in the Tangail district of Bangladesh was done to record the presence of food allergy and food addiction patterns. Chi-square tests and logistic regression analysis were performed to assess the association between different factors with food allergy and food addiction. Results: It was found that brinjal was the most frequent food item responsible for 28.3% of people’s food allergy. The main symptoms due to the food allergy were about 28.5% itching and 22.7% rash on the skin. According to this study, 50.4% of allergic patients took medicine and most of the allergic patients didn’t seek medical advice. A maximum of 72.8% of allergic patients also had an addiction to food. Street foods like jhalmuri, fried foods were the general food addicted items covering 34.9%. Food-addicted participants with food allergies reported significantly more problems with foods, where obesity and heart disease are recognized as clinical effects due to having higher amounts of fat and sugar to these foods. Conclusions: The study revealed some important determinants of food allergic and food addiction that will help to increase our knowledge for the greater interest of our health and further research. |
International Journal of Community Medicine and Public Health. 2020 Oct;7(10):3810. | Asia; Bangaldesh; prevalence; beef allergy |
| Fernando DD, Fischer K. | 2020 | Proteases and Pseudoproteases in Parasitic Arthropods of Clinical Importance. rasitic arthropods feed on blood or skin tissue and share comparable repertoires of proteases involved in haematophagy, digestion, egg development and immunity. While proteolytically active proteases of multiple classes dominate, an increasing number of pseudoproteases have been discovered that have no proteolytic function but are pharmacologically active biomolecules,evolved to carry out alternative functions as regulatory, anti-haemostatic, anti-inflammatory or immunomodulatory compounds. In this review, we provide an overview of proteases and pseudoproteases from clinically important arthropod parasites. Many of these act in central biological pathways of parasite survival and host–parasite interaction and may be potential targets for therapeutic interventions. |
The FEBS Journal. | |
| Fiocchi A, Restani P, Riva E, Mirri GP, Santini I, Bernardo L, Galli CL. | 1998 | Heat treatment modifies the allergenicity of beef and bovine serum albumin. The effect of heat on the allergenicity of beef and bovine serum albumin was investigated among 10 toddlers skin prick test (SPT)‐positive to raw and cooked beef. The meat‐allergy diagnosis was confirmed during double‐blind, placebo‐controlled food challenge (DBPCFC) with 180 g of beef cooked for 5 min at 100°C. SPT with homogenized and freeze‐dried beef, and heated and unheated bovine serum albumin were performed. Both heated and unheated bovine serum albumin, homogenized beef, and freeze‐dried beef were used in trial DBPCFC. All children were SPT‐positive to unheated bovine serum albumin. Seven were positive to heated bovine serum albumin, one to freeze‐dried beef, and none to homogenized beef. DBPCFCs were negative for homogenized beef and freeze‐dried beef, positive for unheated bovine serum albumin in five patients, and positive for heated albumin in four children. We conclude that heating reduces sensitization to beef and bovine serum albumin but does not abolish reactivity to albumin under home conditions. However, industrially heat‐treated and sterilized homogenized beef and freeze‐dried beef may be suitable substitutes in beef‐allergic children's diets. |
Allergy. 1998 Aug;53(8):798-802. | skin prick test SPT dairy cow's milk allergy |
| Fiocchi A, Restani P, Riva E. | 2000 | Beef allergy in children. Beef allergy was poorly known before the ’90s. Since then, a number of papers appeared elucidating the nature, epidemiology, and symptoms of beef allergy in children allergic to cow’s milk and children suffering from atopic dermatitis. It is now clear that beef allergy is not an infrequent occurrence, with an incidence between 3.28% and 6.52% among children with atopic dermatitis, its incidence may be as much as 0.3% in the general population. A diagnosis of beef allergy must be supported by skin prick tests, RASTs, and challenges. The specificity and sensitivity according to type of test and the type of extract, however, remains to be evaluated. Despite the fact that other allergens can be sensitizing, the major beef allergen is bovine serum albumin (BSA). Beef-sensitive children are also sensitized to ovine serum albumin, as well as to other serum albumins; therefore, the use of alternative meats in beef-allergic children must be carefully evaluated on an individual basis. Because industrial heat processing is more efficient than domestic cooking in reducing reactivity in beef-sensitive children, freeze-drying and homogenization may support the introduction of processed beef into the diet of beef-allergic children. |
Nutrition. 2000 Jun 1;16(6):454-7. | Europe; Italy; beef allergy; prevalence; BSA |
| Fischer J, Biedermann T. | 2016 | Delayed immediate-type hypersensitivity to red meat and innards: current insights into a novel disease entity./Verzögerte Soforttyp-Allergie gegen rotes Fleisch und Innereien: aktueller Wissensstand zu einem neuen Krankheitsbild. The development of component-resolved diagnostics instead of whole extracts has brought about major advances in recent years. Particularly remarkable has been the identification of new disease entities based on the detection of IgE antibodies against specific individual components. In this context, delayed immediate-type hypersensitivity to red meat and innards plays a key role. This disorder is more common in German-speaking countries and likely still underdiagnosed. Affected individuals exhibit delayed type I reactions following the consumption of red meat or innards (responses to the latter are more rapid). All patients have IgE antibodies against the oligosaccharide galactose-alpha-1,3-galactose - alpha-gal. Those affected also have to avoid-alpha-gal-containing drugs such as cetuximab or gelatin-containing colloidal solutions. Also referred to as alpha-gal syndrome, this condition is unique in that it is characterized by type I hypersensitivity to a sugar instead of a protein. Given that many patients have a history of recurrent episodes of acute urticaria or angioedema, dermatologists should be familiar with the alpha-gal syndrome. |
Journal der Deutschen Dermatologischen Gesellschaft. 2016 Jan;14(1):38-43. | |
| Fischer J, Eberlein B, Hilger C, Eyer F, Eyerich S, Ollert M, Biedermann T. | 2017 | Alpha-gal is a possible target of IgE-mediated reactivity to antivenom. BACKGROUND: Antivenoms are mammalian immunoglobulins with the ability to neutralize snake venom components and to mitigate the progression of toxic effects. Immediate hypersensitivity to antivenoms often occurs during the first administration of these heterologous antibodies. A comparable clinical situation occurred after introduction of cetuximab, a chimeric mouse-human antibody, for cancer treatment. The carbohydrate epitope galactose-alpha-1,3-galactose, located on the Fab region of cetuximab, was identified as the target responsible for IgE reactivity. OBJECTIVE: To investigate whether serum IgE antibodies directed to the -gal epitope are associated with hypersensitivity to equine antivenoms. METHODS: Antivenoms were screened for -gal epitopes via immunoblot and in comparison with cetuximab and pork kidney by IgE reactivity assays. Basophil activation tests were used to investigate reactivity to antivenoms in samples from 20 patients with specific IgE antibodies to -gal and 10 controls. Additional IgE detection, IgE inhibition, ImmunoCAP inhibition, and skin prick tests were performed using samples from selected patients. RESULTS: Both antivenoms and cetuximab induced positive skin prick test results in patients with sIgE to -gal. Alpha-gal epitopes were detected by immunoblotting on antivenoms. Measurements of IgE reactivity and ImmunoCAP inhibition indicated that the antivenoms contained lower -gal contents than cetuximab. Deglycosylation assays and IgE inhibition tests confirmed that IgE-mediated reactivity to antivenom is associated with -gal. Antivenoms, pork kidney, and cetuximab activated basophils from patients with IgE to -gal. CONCLUSION: Alpha-gal is a potential target of IgE-mediated reactivity to equine antivenom and a possible cause of the high incidence of hypersensitivity reactions during the first application of equine antivenom. |
Allergy. 2017 May;72(5):764-71. | Antivenom |
| Fischer J, Hebsaker J, Caponetto P, Platts-Mills TA, Biedermann T. | 2014 | * Galactose-alpha-1,3-galactose sensitization is a prerequisite for pork-kidney allergy and cofactor-related mammalian meat anaphylaxis. Delayed type I reactions to red meat are typical for patients sensitized to galactose-alpha-1,3-galactose (α-Gal), and increasing numbers of patients are being recognized worldwide. Interestingly, allergic reactions to pork kidney are mainly observed in Europe and are a good example of how regional differences in meat consumption can influence the clinical presentation of this specific variant of type I allergy. The aim of this study was to outline how an understanding of allergy to pork kidney can be helpful for the understanding of red meat allergy in general. |
Journal of allergy and clinical immunology. 2014 Sep 1;134(3):755-9. | co-factor; cofactor, ACE inhibitor/β-agonist; exercise; alcohol; non-steroidal anti-inflammatory drug; NSAID |
| Fischer J, Hilger C. | 2017 | Alpha-Gal Syndrome: Clinical Presentation, New Concepts, and Unmet Needs. For decades, carbohydrate determinants were seen as cross-reactive structures without clinical impact. The discovery of specific IgE to the carbohydrate galactose-α-1,3-galactose, called α-gal, changed our perspective on the allergenic potential of carbohydrate determinants. α-Gal is present in tissues of non-primate mammals and, upon ingestion, can provoke a delayed form of allergic reaction in sensitized patients. We are faced with a new and unique entity of allergy with high clinical relevance in food allergy and anaphylaxis to drugs derived from mammalian products. Tick bites are assumed to constitute the primary sensitization source to α-gal. To address the complexity of this disease, the term α-gal syndrome has been suggested. |
Current Treatment Options in Allergy. 2017 Sep 1;4(3):303-11. | |
| Fischer J, Huynh HN, Hebsaker J, Forchhammer S, Yazdi AS. | 2020 | **Prevalence and Impact of Type I Sensitization to Alpha-Gal in Patients Consulting an Allergy Unit. Background: Alpha-gal syndrome is a complex allergy with high clinical relevance regarding mammalian-derived food and drugs and is characterized by the presence of IgE antibodies directed at the carbohydrate galactose-α-1,3-galactose. As not all alpha-gal sIgE-positive individuals present clinical symptoms upon consumption of mammalian meat, the diagnostic value of alpha-gal sIgE has yet to be clarified. Objective: To investigate the prevalence of alpha-gal-sIgE positivity among allergy patients, examine the impact of tick bites as associated risk factors and determine the diagnostic value of alpha-gal-sIgE positivity. Methods: A retrospective cross-sectional study evaluating patients in the Allergy Unit was performed. Alpha-gal-sIgE levels were assessed by ImmunoCAP assay. Exposure to tick bites was assessed by a questionnaire. A receiver operating characteristics (ROC) curve analysis was performed to determine the diagnostic value of alpha-gal sIgE for the diagnosis of alpha-gal syndrome. Results: In the study population (n = 1369), the overall prevalence of alpha-gal-sIgE-positive (≥0.10 kUA/L) individuals was 19.9%, and the highest prevalence (30.2%) was found in patients with insect venom allergies. A reported tick bite within the 12 months prior to blood sampling significantly increased the risk of alpha-gal-sIgE positivity (OR 2.084). The ROC curve analysis indicated alpha-gal sIgE ≥0.54 kUA/L as the optimal cutoff point for assessing the diagnostic value of alpha-gal syndrome in allergy patients. Conclusions: In allergy care settings, alpha-gal-sIgE positivity is a common finding. Alpha-gal sIgE is a sensitive marker in the diagnosis of alpha-gal syndrome but has limited predictive value for the characteristics or severity of this allergy. |
International Archives of Allergy and Immunology. 2020;181(2):119-27. | prevalence |
| Fischer J, Lupberger E, Hebsaker J, Blumenstock G, Aichinger E, Yazdi AS, Reick D, Oehme R, Biedermann T. | 2017 | ** Prevalence of type I sensitization to alpha-gal in forest service employees and hunters. BACKGROUND: The production of IgE molecules specific to the carbohydrate galactose-alpha-1,3-galactose (alpha-gal) is known to induce delayed anaphylaxis against mammalian meat. Tick bites constitute the primary sensitization source, as ticks transfer alpha-gal in their saliva to a host during a bite. The reported prevalence of alpha-gal-specific IgE (alpha-gal-sIgE) positivity varies between different populations from diverse geographic regions. OBJECTIVE: To investigate the prevalence of alpha-gal-sIgE positivity in a population of forest service employees who are highly exposed to ticks in comparison with a residential population and a historic sample. METHODS: A cross-sectional study evaluating 300 forest service employees and hunters from southwest Germany was performed. Alpha-gal-sIgE levels were assessed by ImmunoCAP assay. The prevalence of alpha-gal-sIgE-positive individuals was compared with a matched cohort composed of a residential population and blood samples from forest service employees collected 15 years ago. RESULTS: In the study population, the prevalence of alpha-gal-sIgE-positive (>/=0.10 kUA /L) individuals was 35.0%, whereas the prevalence of individuals with alpha-gal-sIgE levels >/=0.35 kUA /L was 19.3%. Alpha-gal-sIgE positivity was associated with total IgE levels and recent tick bites. Mammalian meat-induced delayed anaphylaxis was found in 8.6% of the participants with alpha-gal-sIgE levels >/=0.35 kUA /L. For forest service employees and hunters, the odds ratio for alpha-gal-sIgE positivity was 2.48 compared to the residential population. The prevalence of alpha-gal-sIgE positivity in the current and historic cohort was comparable. CONCLUSION: Forest service employees and hunters compose a population with a high prevalence of alpha-gal-sIgE positivity and carry a considerable risk of red meat allergy. |
Allergy. 2017 Oct;72(10):1540-7. | prevalence |
| Fischer J, Reepschläger T, Schricker T, Raap U. | 2022 | Alpha-Gal-Syndrom. Zusammenfassung Das Alpha-Gal-Syndrom gehört zu den spannendsten Entdeckungen in der Allergologie der letzten 15 Jahre und wird ausgelöst durch spezifisches Immunglobulin E (sIgE) gegen den für Menschen immunogenen Zucker Galaktose-α‑1,3‑Galaktose (Alpha-Gal). Säugetierfleisch, Milch und daraus hergestellte Nahrungsmittel enthalten Alpha-Gal und können zu Anaphylaxien führen. Auch Arzneimittel und Medizinprodukte aus Säugetiergewebe können allergen sein. Zeckenstiche gelten als Hauptquelle einer Induktion von Alpha-Gal-sIgE. Ziel dieses Beitrags ist es, einen Überblick über den Stand des Wissens zum klinischen Bild und zu pathophysiologischen Konzepten zu geben. Abstract In the world of allergology, alpha-gal syndrome remains one of the most fascinating discoveries over the last 15 years as it is triggered by specific IgE directed against the immunogenic sugar galactose-α‑1,3‑galactose (alpha-gal), found foremost in mammalian meat, milk and products derived thereof, potentially resulting in anaphylaxis. Also, mammalian-derived drugs and medical products have been identified as possible culprits. Nonetheless, tick bites remain the major cause of specific alpha-gal-sIgE. Herein, we summarize the current clinical knowledge and pathophysiology of alpha-gal syndrome in order to better understand this disease. |
Der Hautarzt. 2022 Mar;73(3):195-200. | Europe; Germany; review article |
| Fischer J, Riel S, Fehrenbacher B, Frank A, Schaller M, Biedermann T, Hilger C, Mackenstedt U. | 2020 | Spatial distribution of alpha-gal in Ixodes ricinus-a histological study. Alpha-gal syndrome is a complex allergic disease in humans that is caused by specific IgE (sIgE) against the carbohydrate galactose-α-1,3-galactose (alpha-gal). Tick saliva contains alpha-gal, and tick bites are considered a major cause of the induction of alpha-gal-sIgE. The origin of alpha-gal in tick saliva remains unclarified. The presence of alpha-gal in tick tissue was visualized in this study to provide an overview of the spatial distribution of alpha-gal and to further elucidate the origin of alpha-gal in tick saliva. Fed and unfed Ixodes ricinus females were examined by histology, immunohistochemistry, immunofluorescence, transmission electron microscopy and immunoelectron microscopy using the alpha-gal-specific monoclonal antibody M86 and Marasmius oreades agglutinin (MOA) lectin. Alpha-gal epitopes were detected in the midgut, hemolymph and salivary glands, and the immunofluorescence analysis revealed signs of the endocytosis of alpha-gal-containing constituents during the process of hematophagy. Alpha-gal epitopes in endosomes of the digestive gut cells of the ticks were observed via immunoelectron microscopy. Alpha-gal epitopes were detected in dried droplets of hemolymph from unfed ticks. Intense staining of alpha-gal epitopes was found in type II granular acini of the salivary glands of fed and unfed ticks. Our data suggest that alpha-gal is not ubiquitously expressed in tick tissue but is present in both fed and unfed ticks. The findings also indicate that both the metabolic incorporation of constituents from a mammalian blood meal and endogenous production contribute to the presence of alpha-gal epitopes in ticks. |
Ticks and Tick-borne Diseases. 2020 Jul 2:101506. | ticks; vector of sensitization |
| Fischer J, Yazdi AS, Biedermann T. | 2016 | Clinical spectrum of alpha-Gal syndrome: from immediate-type to delayed immediate-type reactions to mammalian innards and meat. The term alpha-Gal syndrome describes a novel IgE-mediated immediate-type allergy to the disaccharide galactose-alpha-1,3-galactose (alpha-Gal). Its classification as a syndrome is proposed on the basis of its clinical relevance in three different fields of allergy: food, drugs, and tick bites. The main focus of the present article is on alpha-Gal as an eliciting allergen in food allergy. It was recently shown that immediate-type allergies to pork kidney and other mammalian innards belong to the spectrum of alpha-Gal syndrome. These allergic reactions manifest as classic immediate-type allergies with a typical latency of under 1 h. The phenomenon of a delayed-onset immediate-type allergy with a latency of 3-6 h following ingestion of mammalian meat is considered pathognomonic for alpha-Gal syndrome. This clinically distinct type of presentation can be explained using the concept of food-dependent exercise-induced anaphylaxis (FDEIA). However, clinical observations and challenge testing in this constellation reveal that individual sensitivity in alpha-Gal patients is highly variable and which broadens our basic understanding of alpha-Gal syndrome. |
Allergo journal international. 2016 Mar 1;25(2):55-62. | |
| Fischer J. | 2015 | Food Allergy through Tick Bites a new Health Risk? No abstract available |
Allergologie. 2015;38:194-195. | |
| Fisher EJ, Mo J, Lucky AW. | 2006 | Multiple pruritic papules from lone star tick larvae bites. Background: Ticks are the second most common vectors of human infectious diseases in the world. In addition to their role as vectors, ticks and their larvae can also produce primary skin manifestations. Infestation by the larvae of ticks is not commonly recognized, with only 3 cases reported in the literature. The presence of multiple lesions and partially burrowed 6-legged tick larvae can present a diagnostic challenge for clinicians. Observation: We describe a 51-year-old healthy woman who presented to our clinic with multiple erythematous papules and partially burrowed organisms 5 days after exposure to a wooded area in southern Kentucky. She was treated with permethrin cream and the lesions resolved over the following 3 weeks without sequelae. The organism was later identified as the larva of Amblyomma species, the lone star tick. Conclusions: Multiple pruritic papules can pose a diagnostic challenge. The patient described herein had an unusually large number of pruritic papules as well as tick larvae present on her skin. Recognition of lone star tick larvae as a cause of multiple bites may be helpful in similar cases. |
Archives of dermatology. 2006 Apr 1;142(4):491-4. | vector; tick vs chigger |
| Fitzgerald K. | 2024 | An in vitro model of galactose-α-1, 3-galactose (alpha-gal)-induced mast cell activation. |
Senior honors thesis, Dept of Biology, University of North Carolina | |
| Flaherty MG, Kaplan SJ, Jerath MR. | 2017 | *Diagnosis of Life-Threatening Alpha-Gal Food Allergy Appears to Be Patient Driven. Objective: Patients exhibiting life-threatening symptoms associated with the alpha-gal food allergy (delayed urticaria or anaphylaxis due to mammalian meat) are frequently undiagnosed, causing unnecessary emergency department (ED) and health care visits, and extensive pain and suffering. This study aimed to determine the path to diagnosis experienced by alpha-gal patients. Methods: Semistructured interviews were conducted from March to June 2016 with a chronological systematic sample of approximately 10% of patients diagnosed with alpha-gal and treated by the University of North Carolina Allergy and Immunology Clinic (n = 28). Main outcome measures included average length of time between first symptoms’ appearance and diagnosis, number and type of health care encounters en route to diagnosis, and typical symptom severity. Results: Six interviewees (21%) were diagnosed within a year of experiencing symptoms, of the remaining 22, mean time to diagnosis was 7.1 years. In over 100 medical encounters (including 28 ED visits and 2 urgent care) the correct diagnosis or effective diagnosing referral occurred less than 10% of the time. Seventy-one percent (20/28) described their first symptoms as severe. More patients found the allergist specializing in this condition on their own (n = 12; 43%) than those who were formally diagnosed or received referrals (n = 10; 36%) through the health care system. Conclusions: The medical community is challenged to stay abreast of emerging and newly uncovered illnesses through traditional medical literature communication channels. Presently, patients more often discover a diagnosis of alpha-gal allergy by using information resources on their own than by presenting to the ED with anaphylaxis. |
Journal of primary care & community health. 2017 Oct;8(4):345-8. | HCP; provider awareness; physician awareness; education; underdiagnosis; |
| Flaherty MG, Threats M, Kaplan SJ. | 2018 | Patients’ Health Information Practices and Perceptions of Provider Knowledge in the Case of the Newly Discovered Alpha-gal Food Allergy. Background:Alpha-gal food allergy is a life-threatening, newly discovered condition with limited presence in authoritative information sources. Sufferers seeking diagnosis are likely to encounter clinicians unfamiliar with the condition. Objective: To understand information practices of individuals diagnosed with alpha-gal allergy, how they obtained diagnosis, and their perceptions of health-care providers’ awareness of the condition. Methods: Semistructured interviews with open- and closed-ended questions were completed with a chronological systematic sample of 28 adults (11% of alpha-gal clinic patients at the time) diagnosed with alpha-gal allergy and treated at University of North Carolina Allergy and Immunology Clinic. Results: The majority of patients determined they had alpha-gal allergy through nontraditional health information channels. Three-quarters of patients rated their primary care provider as having little to no knowledge. In 25 specialists’ encounters, 23 were rated as having little to no knowledge. Conclusion: With new conditions, information is often available through informal networks before appearing in the vetted medical literature. In this study, social connections were the primary pathway to successful diagnosis. Health practitioners need to develop mechanisms to understand that process. |
Journal of Patient Experience. 2020 Feb;7(1):132-9. | patient perceptions; clinician–patient relationship; health literacy |
| Flaherty MG, Threats M, Kaplan SJ. | 2020 | * Patients’ Health Information Practices and Perceptions of Provider Knowledge in the Case of the Newly Discovered Alpha-gal Food Allergy. Background: Alpha-gal food allergy is a life-threatening, newly discovered condition with limited presence in authoritative information sources. Sufferers seeking diagnosis are likely to encounter clinicians unfamiliar with the condition. . Objective: To understand information practices of individuals diagnosed with alpha-gal allergy, how they obtained diagnosis, and their perceptions of health-care providers’ awareness of the condition. Methods: Semistructured interviews with openand closed-ended questions were completed with a chronological systematic sample of 28 adults (11% of alpha-gal clinic patients at the time) diagnosed with alpha-gal allergy and treated at University of North Carolina Allergy and Immunology Clinic. . Results: The majority of patients determined they had alpha-gal allergy through nontraditional health information channels. Three-quarters of patients rated their primary care provider as having little to no knowledge. In 25 specialists’ encounters, 23 were rated as having little to no knowledge. . Conclusion: With new conditions, information is often available through informal networks before appearing in the vetted medical literature. In this study, social connections were the primary pathway to successful diagnosis. Health practitioners need to develop mechanisms to understand that process |
Journal of Patient Experience. 2020 Feb;7(1):132-9. | patient perceptions; clinician–patient relationship; health literacy |
| Flebbe-Rehwaldt L, Altrich ML. | 2014 | Cross Reactivity Of Alpha Gal Allergy With An Extended Red Meat Panel. RATIONALE: Galactose-alpha-1,3-galactose (alpha-gal), is a carbohydrate moiety found in red meats such as beef, pork and lamb and associated with a delayed IgE response, leading to urticaria and/oranaphylaxis. Alpha Gal specific IgE is believed to be responsible for cross reactive allergies to beef, pork and lamb, but little data exists showing the cross reactivity of Alpha Gal and other non-primate mammalian meats such as rabbit and veal. METHODS: De-identified serum samples from Alpha Gal positive(n515) and negative (n515) patients were tested for IgE reactivity withbeef, pork, lamb, rabbit, veal, and chicken (as a negative control). Data was compiled into groups based on a cutoff of 0.1 kU/L as a positive test. RESULTS: Thirteen percent of Alpha Gal negative samples contained IgE antibodies against at least one red meat. In the alpha gal positive subset, 13 percent of samples were negative to veal, and 20 percent were negative to rabbit. However none were negative for beef, pork, or lamb. Twelve percent of beef IgE positive samples were negative for IgE to veal. CONCLUSIONS: Analysis of results testing for red meat and Alpha Galreactive IgE revealed that a large portion of samples contained antibodies to both red meats and Alpha Gal, supporting the inter-related nature of these allergies and the need for complete testing to identify source(s). Interestingly, there was not complete agreement between veal and beef positivity indicating there may be different allergens present in the various meat preparations. |
Journal of Allergy and Clinical Immunology. 2014 Feb 1;133(2):AB112. | diagnosis; testing |
| Flebbe-Rehwaldt L, Wells H, Hester J, Altrich M. | 2013 | ALPHA GAL ALLERGY AND CROSS-REACTIVE RED MEAT ALLERGY: ANALYSIS OF CLINICAL DATA. Introduction: Galactose-alpha-1,3-galactose (alpha-gal), is a cross-reactive carbohydrate moiety found in red meats such as beef, pork and lamb and is associated with a delayed IgE response, leading to urticaria and/or anaphylaxis. Methods: A retrospective review of national laboratory data was performed over eighteen months of the testing for IgE to Beef, Pork, Lamb, and Alpha Gal utilizing data with de-identified patient health information. Data was compiled into groups based on a cutoff of 0.1 kU/L as a positive test. Results: Thirty two percent of samples contained IgE antibodies against all 4 allergens, while 53 percent contained no detectable antibodies to any of the 4 allergens. Seven percent of samples were positive for at least one red meat (beef, pork, and/or lamb) but were negative for Alpha Gal. An additional 2 percent of samples were positive for IgE recognizing all three red meats but were negative for IgE to Alpha Gal. Interestingly, 4 percent of samples were positive for low levels (<1kU/L) of Alpha Gal IgE, but negative for IgE recognizing any of the three meats. Conclusions: Analysis of results testing for red meat and Alpha Gal reactive IgE revealed that a large portion of samples contained antibodies to both red meats and alpha gal, supporting the inter-related nature of these allergies. Surprisingly, 4 percent of samples were positive for Alpha Gal (albeit low levels) and negative to all three red meats. This suggests that the level of alpha gal contained in commercial products testing for red meat IgE are not sufficient to detect Alpha Gal IgE when present in low levels. Additionally a small portion of samples were negative for Alpha Gal reactive IgE, but positive for IgE recognizing some or all of the red meats. This indicates there are IgE antibodies that bind meat proteins and not the Alpha Gal carbohydrate, thus testing to red meat and Alpha Gal is important to gain a complete clinical picture. Further analysis may reveal if certain demographics (age or sex) contribute to this population of samples. |
Annals of Allergy, Asthma & Immunology. 2013; 111(5): A99-A99. | |
| Flebbe-Rehwaldt L, Wells H, Roberts S, Walters P, Ling M, Brockus C, Halsey JF, James H, Commins S, Platts-Mills T, Altrich M. | 2011 | An Immunoassay to Measure IgE to Galactose alpha 1,3 Galactose Associated with Red Meat Allergies. RATIONALE: IgE antibodies specific for the galactose-a-1,3 galactose (Alpha-Gal) carbohydrate found on non-primate mammalian proteins have recently been linked to delayed hypersensitivity reactions following the consumption of these proteins. IgE-mediated hypersensitivity to Alpha-Gal typically develops in adults who have had no previous sensitivity to meat. METHODS: This assay is a solid phase immunoassay that measures the concentration of IgE specific for Alpha-Gal in human serum. Specimens analyzed were de-identified discard sera from an immunology laboratory. RESULTS: The assay for Alpha-Gal specific IgE proved to be highly reproducible and specific. The useful analytical range is 0.1kU/L to 100kU/L and the reference range is <0.35kU/L. The coefficients of variation for intra- and inter-assay precision were < 2.5% and 8.5%, respectively. Among adult serum samples randomly selected from specimens positive for IgE specific for beef, pork and/or lamb, 50% tested positive for Alpha-Gal specific IgE. In contrast, no sera from patients under the age of 10 years with IgE specific for beef, pork and/or lamb tested positive for Alpha-Gal specific IgE. CONCLUSIONS: IgE antibodies specific for Alpha-Gal can be detected and accurately quantified by this immunoassay. Since the assay has been released approximately two thirds of the samples submitted for clinical testing have been positive for Alpha-Gal specific IgE. This test will more specifically identify the etiology of allergic responses to meat allergens in patients, information that may be critical for effective clinical management of a patient. |
Journal of Allergy and Clinical Immunology. 2011 Feb 1;127(2):AB185. | |
| Fong A, Schuyler AJ, Platts-Mills TA, Becker A. | 2015 | Rapid Onset Anaphylaxis to Red Meat in Three Siblings from Uganda. RATIONALE: IgE to galactose-a1,3-galactose(‘‘alpha-gal’’) is associated with delayed onset anaphylaxis and has been measured in sub-Saharan Africa, but without reports of anaphylaxis. We present three siblings with rapid onset anaphylaxis to red meat while in a Uganda refugee camp. METHODS: Commercial extracts, raw and cooked meats were used for SPT. Allergen specific IgE (sIgE) was measured to foods, alpha-gal, cat, Fel d 1, Fel d 2 and parasites. Alpha-gal was then absorbed with beef thyroglobulin conjugated to sepharose beads. RESULTS: The siblings developed anaphylaxis within an hour of consuming goat, beef or pork. SPT for all siblings was positive to commercial beef, pork; raw beef, goat; cooked beef, and cat. Sibling 3 SPT was also positive to cooked goat. sIgE for all siblings was positive to alpha-gal (5.62; 8.38; 6.70 KU/L), beef (4.82; 6.72; 7.00 KU/L), pork (4.60; 5.86; 6.46 KU/L), cow’s milk (3.02; 4.38; 5.26 KU/L), cat (1.62; 2.58; 3.92 KU/L) and echinococcus (2.02; 3.26; 5.04 KU/L). Pork albumin, Fel d 1, Fel d 2, ascaris, and anisakis sIgE were negative. Goat sIgE was not available. After depletion of alpha-gal from the sera, beef, pork, cow’s milk, cat and echinococcus sIgE were negative. The siblings consume chicken, fish and cow’s milk. There is no clear history of tick bites. CONCLUSIONS: To the best of our knowledge, these are the first reported cases of red meat anaphylaxis from Africa. The early onset of their symptoms may indicate another sp |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB206. | Africa; Uganda; prevalence |
| Fournier PE, Thuny F, Grisoli D, Lepidi H, Vitte J, Casalta JP, Weiller PJ, Habib G, Raoult D | 2011 | A deadly aversion to pork. On August 3, 2006, a 53-year-old man with penicillin allergy presented with afebrile blood-culture-negative endocarditis (BCNE). He lived in an urban area near Marseille and had never travelled abroad. He did not report any specific food allergies. 4 months earlier, he had had a mitral valve replacement with a bioprosthetic valve (porcine Hancok II, Medtronic, Minneapolis, USA). Transoesophageal echocardiography identified vegetation on the bioprosthesis. Although blood cultures and serological test results were negative, empirical anti-staphylococcal therapy was started. The vegetation increased in size and caused valvular obstruction, necessitating a replacement with the same type of Hancok II valve. Our patient experienced two further relapses of afebrile BCNE necessitating mitral valve replacements, with Hancok II bioprostheses, in October and December, 2006. In June, 2007, he had a third relapse and died. Each removed valve showed inflammatory infiltrates and a vegetation, which led to diagnoses of endocarditis. At each episode, we tested blood samples and the removed valves using a comprehensive diagnostic procedure previously reported to identify the aetiology of BCNE. 1 In each episode, all test results were negative. |
The Lancet. 2011 Apr 30;377(9776):1542. | cardiology; cardiac surgery; bioprosthetic heart valve |
| Fowler PD, Nguyentran S, Quatroche L, Porter ML, Kobbekaduwa V, Tippin S, Miller G, Dinh E, Foster E, Tsao JI. | 2022 | Northward Expansion of Amblyomma americanum (Acari: Ixodidae) into Southern Michigan. Amblyomma americanum (Linnaeus) (Acari: Ixodidae) (lone star tick) is an aggressive, generalist parasite that vectors numerous important human and animal pathogens. In recent decades its geographic range has been expanding northwards from endemic regions in the southeastern and southcentral US. In 2019 five questing A. americanum comprising two life stages were detected at one site in Berrien County, in southwestern Michigan, satisfying one CDC criterium for an established population for the first time in the state. To better characterize the northern extent of emerging A. americanum, we conducted active surveillance (i.e., drag sampling) in summer 2020 throughout Michigan’s southern counties and detected one adult A. americanum from each of six widespread sites, including where they had been detected in 2019. A larger established population was identified at another site in Berrien County, which yielded 691 A. americanum comprising three life stages. Questing tick phenologies at this site were similar to that reported for other regions. Statewide surveillance in 2021 revealed no A. americanum outside of Berrien County, but establishment criteria were met again at the two sites where established populations were first detected respectively in 2019 and 2020. These observations may represent the initial successful invasion of A. americanum into Michigan. Data from passive (1999-2020) and active surveillance (2004-2021) efforts, including a domestic animal sentinel program (2015-2018), are reported to provide context for this nascent invasion. Continued active surveillance is needed to help inform the public, medical professionals, and public health officials of the health risks associated with this vector. |
bioRxiv. 2022 Jan 1:2021-12. | vector; tick; Amblyomma americanum; lone star tick; tick distribution; geography; range |
| Foy AB, Giannini C, Raffel C. | 2008 | Allergic reaction to a bovine dural substitute following spinal cord untethering: Case report. Bovine tissues are now routinely used for dural closure in cranial and spinal surgery. The authors report the case of an 18-year-old woman with a history of myelomeningocele who had symptoms of tethered cord syndrome and presented to a regional hospital. At that hospital she underwent a cord untethering procedure. The spinal dura was closed with Durepair, a dural substitute derived from fetal bovine skin. Her postoperative course was complicated by a cerebrospinal fluid leak that was surgically repaired. Following this, she developed erythroderma, intermittent fevers, eosinophilia, and marked elevation in serum immunoglobulin E. She was then transferred to the authors' institution. A skin antigen test to beef was administered, which revealed a positive reaction. A radioallergosorbent test to beef also yielded positive results. She was taken to the operating room for removal of the bovine graft due to concern for an allergic reaction to the graft. The graft material showed evidence of eosinophilic infiltration. Her clinical symptoms and laboratory values all improved after surgery. To the authors' knowledge this is the first reported case of an allergic reaction to bovine-based dural substitutes. |
Journal of Neurosurgery: Pediatrics. 2008 Feb 1;1(2):167-9. | Pharmacy; perioperative; surgery; neurosurgery; bovine tissue; Durepair |
| Franks MD AM, Murphy BS M, Griffis MD M, Franks BA, CWR R, Franks CM, Petty MD G | 2021 | Alpha-Gal Allergy: a new threat to Appalachia. Alpha-gal allergy, or mammalian meat allergy, is described as the development of IgE antibodies to the oligosaccharide galactose-a-1,3-galactose following a bite from the tick species Amblyomma americanum (Lone Star tick) or Dermacentor variabilis (Wood tick). Dermatologic or gastrointestinal symptoms are usually delayed by four to six hours after exposure, making the diagnosis difficult. Due to the use of mammalian proteins in many common medications, surgical equipment, and prosthesis, unexpected reactions can occur. In the United States, this pathology is predominately seen in the southeast but has been associated with other tick species on every continent except Antarctica. As the habitat for Amblyomma and Dermacentor continues to move further north due to changing patterns in deer population and weather, the incidence of alpha-gal syndrome has increased in the states outside its normal southeastern locale, especially in people with occupations and hobbies that require time outdoors in wooded areas. |
Marshall Journal of Medicine. 2021;7(4):2. | Appalachia; West Virginia |
| Fuertes LV, Bustamante MP, Fernandez AB, Pino AG, De La Losa FP. | 2013 | A case of eosinophilic esophagitis, with sensitization to BSA (meat allergy) and rhinoconjunctivitis due to dog epithelium. Background: Patients with eosinophilic esophagitis (EEo) have a prior history of atopy. Skin prick test(SPT) is able to identify the allergens involved, allowing a correct dietary approach, in order to achieve the remission of sympthoms and discontinue swallowed costicostheroids. Allergy to bovine meat and especially to Bovine serum albumin (BSA) is exceptional in adult life, but can be a cause of EEo. Methods: We present one 26-year-old patient with EEo diagnosed six months before, who presented characteristic sympthoms after eating mamal´s meat (well cooked beef and pork), and legumes (chickpea), as food impactation. She had history of rhinitis, related to sensitization to dog epithelium. The patient underwent SPT, specific IgE detection and SDS-PAGE immunoblotting studies. Results: The SPT with food allergens showed negative responses to pork, cow, rabbit, lamb, chicken meat, milk, egg, legumes (including chickpea), nuts, fruits and vegetables, fish, seafood, cereals. It showed positive result to BSA. The SPT with aeroallergens showed negative responses to all we studied, but dog epithelium that was positive. The determination of specific IgE were negative to beef and pig meat,milk,egg, legumes, nuts, cereals. The result was positive to dog epithelium (17.1 ku/l CAP), dog BSA (8.03 ku/l), cow BSA (0.51 ku/l). Total IgE 214UI/l.IgE-Immunoblotting indicates recognition bands of 60-70 kDa components (molecular weight compatible with BSA) in dog epithelium extract, and less intensity response in meat extracts. Two allergens with a molecular weight close to 15-20 kDa were recognized. We found reactivity to 40-45 KDa allergens in meat extract also. Conclusion: We report a case of EEo, who had sensitization to BSA and dog epithelium. The patient suffered previous rhinoconjunctivitis related to her dog, but we could not demonstrate cross-reactivity. It is suggested a potential inciting role for aeroallergens in patient with EEo, and the subsequent food allergy. BSA is an approximately 67 KDa protein involved both in milk (especially in children) and beef allergy. It explains cross-reactivity among different meats and epitheliums and different mammal´s meat. In our case, the patient´s serum recognized a protein with a molecular weight of 17 kDa, that could correspond to myoglobin, a heat-resistant protein that explains why some patients do not tolerate undercooked or even cooked meat. Thank our study, the patient could discontinue swallowed corticosteroids and avoidance diet, but meats. |
Clinical and Translational Allergy. 2013 Jul 1;3(S3):P166. | eosinophilic easaphagitis; BSA |
| Fujiwara M, Arak T. | 2019 | Immediate anaphylaxis due to beef intestine following tick bites. Letter to the Editor: Red meat allergy induces delayed anaphylaxis 3e6 h after ingestion of mammalian meat. Such delayed anaphylaxis is associated with immunoglobulin E (IgE) antibodies to galactose-alpha-1,3-galactose (a-Gal), a carbohydrate epitope contained in both mammalian meat and tick saliva. In addition, it has been reported that Japanese patients with red meat allergy often experience an allergic reaction after ingesting flounder roe. By contrast, an immediate reaction to mammalian organ meat in patients with red meat allergy is not well-reported in the literature. Here we report a case of red meat allergy in which the individual received tick bites followed by episodes of immediate anaphylaxis that developed after ingesting beef intestine and flounder roe. |
Allergology International. 2019;68(1):127-9. | Asia; Japan; diet; foods; organ meats; intestine; fish eggs; flounder eggs |
| Fukunaga T, Tanaka N, Furumoto T, Nakakita S, Ohashi T, Higuchi Y, Maekawa H, Takegawa K. | 2021 | Substrate specificities of α1, 2-and α1, 3-galactosyltransferases and characterization of Gmh1p and Otg1p in Schizosaccharomyces pombe. In the fission yeast Schizosaccharomyces pombe, α1,2- and α1,3-linked D-galactose (Gal) residues are transferred to N- and O-linked oligosaccharides of glycoproteins by galactosyltransferases. Although the galactomannans are important for cell–cell communication in S. pombe (e.g., in nonsexual aggregation), the mechanisms underlying galactosylation in cells remain unclear. Schizosaccharomyces pombe has 10 galactosyltransferase-related genes: seven belonging to glycosyltransferase (GT) family 34 and three belonging GT family 8. Disruption of all 10 α-galactosyltransferases (strain Δ10GalT) has been shown to result in a complete lack of α-Gal residues. Here, we have investigated the function and substrate specificities of galactosyltransferases in S pombe by using strains expressing single α-galactosyltransferases in the Δ10GalT background. High-performance liquid chromatography (HPLC) analysis of pyridylaminated O-linked oligosaccharides showed that two GT family 34 α1,2-galactosyltransferases (Gma12p and Gmh6p) and two GT family 8 α1,3-galactosyltransferases (Otg2p and Otg3p) are involved in galactosylation of O-linked oligosaccharide. Moreover, 1H-NMR of N-glycans revealed that three GT family 34 α1,2-galactosyltransferases (Gmh1p, Gmh2p and Gmh3p) are required for the galactosylation of N-linked oligosaccharides. Furthermore, HPLC and lectin-blot analysis revealed that Otg1p showed α1,3-galactosyltransferase activity under conditions of co-expression with Gmh6p, indicating that α-1,2-linked galactose is required for the galactosylation activity of Otg1p in S. pombe. In conclusion, eight galactosyltransferases have been shown to have activity in S. pombe with different substrate specificities. These findings will be useful for genetically tailoring the galactosylation of both N- and O-glycans in fission yeast. |
Glycobiology. 2021 Apr 28. | Fungus; yeast; Schizosaccharomyces; brewing; traditional beer; alcohol |
| Gabrielli A, Candela M, Pisani E, et al. | 1992 | Antibodies against terminal galactosyl (alpha 1-3) galactose epitopes in systemic sclerosis (scleroderma). |
Clin Exp Rheumatol. 1992;10(1):31. | systemic sclerosis; scleroderma; autoimmune; rheumatology |
| Gaines DN, Operario DJ, Stroup S, Stromdahl E, Wright C, Gaff H, Broyhill J, Smith J, Norris DE, Henning T, Lucas A. | 2014 | Ehrlichia and spotted fever group Rickettsiae surveillance in Amblyomma americanum in Virginia through use of a novel six-plex real-time PCR assay. The population of the lone star tick Amblyomma americanum has expanded in North America over the last several decades. It is known to be an aggressive and nondiscriminatory biter and is by far the most common human-biting tick encountered in Virginia. Few studies of human pathogen prevalence in ticks have been conducted in our state since the mid-twentieth century. We developed a six-plex real-time PCR assay to detect three Ehrlichia species (E. chaffeensis, E. ewingii, and Panola Mountain Ehrlichia) and three spotted fever group Rickettsiae (SFGR; R. amblyommii, R. parkeri, and R. rickettsii) and used it to test A. americanum from around the state. Our studies revealed a presence of all three Ehrlichia species (0–24.5%) and a high prevalence (50–80%) of R. amblyommii, a presumptively nonpathogenic SFGR, in all regions surveyed. R. parkeri, previously only detected in Virginia's Amblyomma maculatum ticks, was found in A. americanum in several surveyed areas within two regions having established A. maculatum populations. R. rickettsii was not found in any sample tested. Our study provides the first state-wide screening of A. americanum ticks in recent history and indicates that human exposure to R. amblyommii and to Ehrlichiae may be common. The high prevalence of R. amblyommii, serological cross-reactivity of all SFGR members, and the apparent rarity of R. rickettsii in human biting ticks across the eastern United States suggest that clinical cases of tick-borne disease, including ehrlichiosis, may be commonly misdiagnosed as Rocky Mountain spotted fever, and that suspicion of other SFGR as well as Ehrlichia should be increased. These data may be of relevance to other regions where A. americanum is prevalent. |
Vector-Borne and Zoonotic Diseases. 2014 May 1;14(5):307-16. | Tick-borne disease; ehrichia; rickettsiae; lone star tick; amblyomma |
| Galili U | 2021 | Biosynthesis of α-Gal Epitopes (Galα1-3Galβ1-4GlcNAc-R) and Their Unique Potential in Future α-Gal Therapies The α-gal epitope is a carbohydrate antigen which appeared early in mammalian evolution and is synthesized in large amounts by the glycosylation enzyme α1,3galactosyltransferase (α1,3GT) in non-primate mammals, lemurs, and New-World monkeys. Ancestral Old-World monkeys and apes synthesizing α-gal epitopes underwent complete extinction 20–30 million years ago, and their mutated progeny lacking α-gal epitopes survived. Humans, apes, and Old-World monkeys which evolved from the surviving progeny lack α-gal epitopes and produce the natural anti-Gal antibody which binds specifically to α-gal epitopes. Because of this reciprocal distribution of the α-gal epitope and anti-Gal in mammals, transplantation of organs from non-primate mammals (e.g., pig xenografts) into Old-World monkeys or humans results in hyperacute rejection following anti-Gal binding to α-gal epitopes on xenograft cells. The in vivo immunocomplexing between anti-Gal and α-gal epitopes on molecules, pathogens, cells, or nanoparticles may be harnessed for development of novel immunotherapies (referred to as “α-gal therapies”) in various clinical settings because such immune complexes induce several beneficial immune processes. These immune processes include localized activation of the complement system which can destroy pathogens and generate chemotactic peptides that recruit antigen-presenting cells (APCs) such as macrophages and dendritic cells, targeting of antigens presenting α-gal epitopes for extensive uptake by APCs, and activation of recruited macrophages into pro-reparative macrophages. Some of the suggested α-gal therapies associated with these immune processes are as follows: 1. Increasing efficacy of enveloped-virus vaccines by synthesizing α-gal epitopes on vaccinating inactivated viruses, thereby targeting them for extensive uptake by APCs. 2. Conversion of autologous tumors into antitumor vaccines by expression of α-gal epitopes on tumor cell membranes. 3. Accelerating healing of external and internal injuries by α-gal nanoparticles which decrease the healing time and diminish scar formation. 4. Increasing anti-Gal–mediated protection against zoonotic viruses presenting α-gal epitopes and against protozoa, such as Trypanosoma, Leishmania, and Plasmodium, by vaccination for elevating production of the anti-Gal antibody. The efficacy and safety of these therapies were demonstrated in transgenic mice and pigs lacking α-gal epitopes and producing anti-Gal, raising the possibility that these α-gal therapies may be considered for further evaluation in clinical trials. |
Front. Mol. Biosci. 2021 Nov 4; 8:746-83. | Anti-gal |
| Galili U, Anaraki F, Thall A, Hill-Black C, Radic M. | 2011 | One percent of human B lymphocytes are capable of producing the natural anti-Gal antibody. The natural anti-Gal antibody constitutes 1% of circulating IgG in humans and interacts specifically with the carbohydrate epitope Gal alpha 1-3Gal beta 1-4GlcNAc-R (the alpha-galactosyl epitope). In view of the unusually large amounts of this antibody in the serum, it was of interest to determine the proportion of circulating B lymphocytes capable of synthesizing anti-Gal. For this purpose, blood B lymphocytes were incubated with Epstein-Barr virus (EBV) and plated in microtiter wells. Proliferation of the EBV transformed B lymphocytes was readily visible after 3 weeks of incubation. The supernatants from wells containing proliferating B-lymphoid clones were assayed for anti-Gal by an agglutination assay with rabbit red blood cells and the specificity of the agglutinating antibodies was further confirmed by their interaction with synthetic oligosaccharides and by enzyme-linked immunosorbent assay with glycoproteins. Approximately 5% of the wells contained anti-Gal antibodies. Limiting dilution studies and IgH gene rearrangement patterns suggested that each well contained an average of five proliferating B-lymphoid clones. Thus, it is concluded that approximately 1% of circulating B lymphocytes are capable of producing anti-Gal. The proportion of anti-Gal--producing lymphoid clones exceeds by fourfold that of clones producing anti-blood group A or anti-blood group B antibodies. Individual anti-Gal clones display fine variations in their combining site, as indicated by their differential interaction with alpha-galactosyl epitopes on glycolipids and on N-linked carbohydrate chains of glycoproteins. The high frequency of precursor B lymphocytes capable of producing anti-Gal, found in every individual and the restricted specificity of this antibody to alpha-galactosyl epitopes, potentially makes anti-Gal--producing lymphocytes an effective system for studying human Ig genes involved in the natural immune response to structurally defined haptens. |
Blood. 2011 Jul 14. | |
| Galili U, Avila JL, editors. | 2012 | α–Gal and Anti–Gal: α1, 3–Galactosyltransferase, α–Gal Epitopes, and the Natural Anti–Gal Antibody Subcellular Biochemistry (Subcellular Chemistry Vol. 32) [BOOK] From Amazon.com: This is an interdisciplinary book which for the first time assembles the wide spectrum of information on the basic and clinical aspects of the natural anti-Gal antibody, the alpha-gal epitope and the enzyme producing it, alpha-1,3-galactosyltransferase. Anti-Gal is the most abundant antibody in humans, apes and Old World monkeys (monkeys of Asia and Africa). It binds specifically to the alpha-gal epitope (Galalpha1-3Galbeta1-4GlcNAc-R) on glycoproteins and glycolipids. Humans, apes and Old World monkeys lack alpha-gal epitopes. In contrast, the alpha-gal epitope is produced in large amounts on cells of nonprimate mammals prosimians and New World monkeys (monkeys of South America), by the glycosylation enzyme alpha-1,3-galactosyltransferase. This differential distribution of the alpha-gal epitope and anti-Gal in mammals is the result of an evolutionary selective process which led to the inactivation of alpha-1,3-galactosyltransferase in ancestral Old World primates. A direct outcome of this event is the present rejection of xenografts such as pig organs in humans and monkeys because of the binding of human anti-Gal to alpha-gal epitopes on pig cells. The various chapters in this book were contributed by researchers studying basic and clinically related aspects of this area. The book aims to provide comprehensive and updated information on this antigen/antibody system, which at present is the major obstacle in xenotransplantation, and on some of the genetic engineering approaches developed for overcoming this obstacle. In addition, this book describes the significance of anti-Gal and alpha-gal epitopes in some parasitic, bacterial and viral infections, as well as in the pathogenesis of autoimmune diseases such as Graves' disease. Finally, this book describes novel approaches for exploiting the natural anti-Gal antibody for increasing immunogenicity of cancer and viral vaccines in humans. This book is edited and partly written by Dr. Uri Galili who originally discovered anti-Gal and the unique evolution of &agr;-1,3-galactosyltransferase, and by Dr. Jose-Luis Avila who has been studying anti-Gal significance in Chagas' disease and in Leishmania infections. This book covers the main areas of research on &agr;-1,3galactosyltransferase, its product the &agr;-gal epitope (Gal&agr;1-3Gal&bgr;1-4GlcNAc-R) and the natural anti-Gal antibody that interacts with this epitope. The book includes chapters on: The evolution of &agr;-1,3 galactosyltransferase in mammals; the structure of the &agr;-1,3galactosyltransferase gene; the structure function relationship of the &agr; 1,3galactosyltransferase enzyme; the molecular characteristics of &agr;-gal epitopes on glycolipids and glycoproteins and methods for its detection; the natural anti-Gal antibody and its significance in xenotransplantation; attempts to prevent xenograft rejection by elimination of &agr;-1,3galactosyltransferase gene, and by modulating &agr;-gal epitope expression and anti-Gal activity; significance of anti-Gal and &agr;-gal epitopes in viral, bacterial and protozoal infections; and the possible clinical exploitation of anti-Gal for the enhancement of cancer and viral vaccine immunogenicity. |
Springer Science & Business Media; 2012 Dec 6. | |
| Galili U, Clark MR, Shohet SB, Buehler J, Macher BA. | 1987 | Evolutionary relationship between the natural anti-Gal antibody and the Gal alpha 1----3Gal epitope in primates. Anti-Gal is a natural antibody, which constitutes as much as 1% of circulating IgG in humans and displays a distinct specificity for the structure Gal alpha 1----3Gal. This glycosidic structure has been found on various tissues of many nonprimate mammals. A comparative study of the occurrence of anti-Gal versus the expression of the Gal alpha 1----3Gal epitope was performed in primates, and a distinct evolutionary pattern was observed. Whereas anti-Gal was found to be present in Old World monkeys and apes in titers comparable to those in humans, its corresponding antigenic epitope is abundantly expressed on erythrocytes of New World monkeys. Immunostaining with anti-Gal of glycolipids from New World monkey erythrocytes indicated that the molecules to which anti-Gal binds are similar to those found in rabbit and bovine erythrocytes. These findings indicate that there is an evolutionary reciprocity between New World and Old World primates in the production of the Gal alpha 1----3Gal structure and the antibody that recognizes it. The expression of the Gal alpha 1----3Gal epitope was evolutionarily conserved in New World monkeys, but it was suppressed in ancestral lineages of Old World primates. The suppression of this epitope was accompanied by the production of anti-Gal. The observed in vivo binding of anti-Gal to human normal senescent and some pathologic erythrocytes implies that the Gal alpha 1----3Gal epitope is present in man in a cryptic form. |
Proceedings of the National Academy of Sciences. 1987 Mar 1;84(5):1369-73. | |
| Galili U, Ishida H, Tanabe K, Toma H. | 2002 | Anti-gal A/B, a novel anti-blood group antibody identified in recipients of abo-incompatible kidney allografts1. Background: The most prevalent anticarbohydrate antibodies in human serum are anti-Gal interacting specifically with the α-gal epitope (Galα1-3Galβ1-4GlcNAc-R) and anti-blood group antibodies interacting with blood group A and B antigens. The α-gal epitope, although absent in humans, comprises part of the core of carbohydrate chain in A and B antigens. Therefore, it was of interest to determine whether immunoglobulin (Ig) G antibodies, elicited in patients rejecting ABO-incompatible kidney allografts, can interact with the α-gal epitope. Methods: Anti-A and anti-B antibodies were determined by enzyme-linked immunosorbent assay (ELISA) with blood group A or B human red cell membranes, as solid phase antigens. Anti-Gal was determined by ELISA with α-gal–bovine serum albumin as solid-phase antigen. Specific removal of anti-Gal was performed by adsorption on fixed rabbit red cells. Results: Blood group O patients who underwent transplantation with either A or B kidney produced an antibody that bound to all three carbohydrate antigens. This multispecific antibody, designated anti-Gal A/B, is specific to the core α-gal epitope within A and B antigens. Recipients of allograft expressing incompatible blood group B also produce anti-Gal B antibody, which binds to the core α-gal epitope only in the B antigen. Anti-Gal A/B and anti-Gal B constitute most of the elicited anti-blood group antibody response. Allograft recipients also produced pure anti-A, or pure anti-B, which require the complete blood group structure for binding. Conclusions: The findings in this study imply that much of the immune response elicited by incompatible A or B antigens on kidney allografts results in activation of anti-Gal B-cell clones producing antibodies to the core α-gal epitope in these blood group antigens. Only less than 25% of the elicited antibodies interact with the complete A or B antigens (i.e., pure anti-A or pure anti-B). These findings suggest that prevention of the anti-Gal response may decrease the immune rejection of ABO-incompatible allografts. |
Transplantation. 2002 Dec 15;74(11):1574-80. | |
| Galili U, Shohet SB, Kobrin E, Stults CL, Macher BA. | 1988 | Man, apes, and Old World monkeys differ from other mammals in the expression of alpha-galactosyl epitopes on nucleated cells. The study of the expression of alpha-galactosyl epitopes on various mammalian cells is of particular interest, since as much as 1% of circulating IgG antibodies in humans interact with this carbohydrate residue. This natural antibody, designated "anti-Gal," was previously found to bind to terminal Gal alpha 1----3Gal beta 1----4GlcNAc-R on biochemically defined glycolipids (Galili, U., Macher, B. A., Buehler, J., and Shohet, S. B. (1985) J. Exp. Med. 162, 573-582; Galili, U., Buehler, J., Shohet, S. B., and Macher, B. A. (1987) J. Exp. Med. 165, 693-704). The expression of anti-Gal binding epitopes on nucleated cells from various mammalian species was studied by immunostaining with this antibody. The binding of anti-Gal to various cells was correlated with the binding of the lectin Bandeiraea (Griffonia) simplicifolia IB4 (BS lectin). The BS lectin also interacts with alpha-galactosyl residues and particularly with high affinity with Gal alpha 1----3Gal beta 1----4GlcNAc residues. We observed a striking evolutionary pattern in the expression of these epitopes on mammalian nucleated cells. Fibroblasts, epithelial cells, endothelial cells, smooth muscle cells, and lymphoid cells of nonprimate mammals, prosimians, and New World monkeys readily bound both anti-Gal and BS lectin. However, no such binding was detectable on cells of Old World monkeys, apes, and humans. Measurment of the binding of radiolabeled BS lectin to the various nucleated cells suggests that cells binding anti-Gal express 10(6) to 3.5 x 10(7) alpha-galactosyl epitopes, most of which, based on the anti-Gal specificity, seem to have the structure of Gal alpha 1----3Gal beta 1----4GlcNAc-R. The absence of these epitopes from human cells results from diminished activity of the enzyme alpha 1----3 galactosyltransferase, which catalyzes the following reaction. Gal beta 1----4GlcNAc-R + UDP-Gal(alpha 1----3-galactosyltransferase)----Gal alpha 1----3Gal beta 1----4GlcNAc-R + UDP This enzyme, which participates in the glycosylation of cell membrane glycoconjugates in nonprimate mammals, prosimians, and New World monkeys, appears to have been suppressed in Old World primates as a result of evolutionary events which occurred 20-30 million years ago. It is argued that an anomalous activity of this enzyme in man may result in initiation of autoimmune diseases because of the de novo expression of Gal alpha 1----3Gal beta 1----4GlcNAc-R epitopes recognized by anti-Gal. |
Journal of Biological Chemistry. 1988 Nov 25;263(33):17755-62. | |
| Galili U, Shohet SB, Kobrin E, Stults CL, Macher BA. | 1988 | Man, apes, and Old World monkeys differ from other mammals in the expression of alpha-galactosyl epitopes on nucleated cells. The study of the expression of alpha-galactosyl epitopes on various mammalian cells is of particular interest, since as much as 1% of circulating IgG antibodies in humans interact with this carbohydrate residue. This natural antibody, designated "anti-Gal," was previously found to bind to terminal Gal alpha 1----3Gal beta 1----4GlcNAc-R on biochemically defined glycolipids (Galili, U., Macher, B. A., Buehler, J., and Shohet, S. B. (1985) J. Exp. Med. 162, 573-582; Galili, U., Buehler, J., Shohet, S. B., and Macher, B. A. (1987) J. Exp. Med. 165, 693-704). The expression of anti-Gal binding epitopes on nucleated cells from various mammalian species was studied by immunostaining with this antibody. The binding of anti-Gal to various cells was correlated with the binding of the lectin Bandeiraea (Griffonia) simplicifolia IB4 (BS lectin). The BS lectin also interacts with alpha-galactosyl residues and particularly with high affinity with Gal alpha 1----3Gal beta 1----4GlcNAc residues. We observed a striking evolutionary pattern in the expression of these epitopes on mammalian nucleated cells. Fibroblasts, epithelial cells, endothelial cells, smooth muscle cells, and lymphoid cells of nonprimate mammals, prosimians, and New World monkeys readily bound both anti-Gal and BS lectin. However, no such binding was detectable on cells of Old World monkeys, apes, and humans. Measurment of the binding of radiolabeled BS lectin to the various nucleated cells suggests that cells binding anti-Gal express 10(6) to 3.5 x 10(7) alpha-galactosyl epitopes, most of which, based on the anti-Gal specificity, seem to have the structure of Gal alpha 1----3Gal beta 1----4GlcNAc-R. The absence of these epitopes from human cells results from diminished activity of the enzyme alpha 1----3 galactosyltransferase, which catalyzes the following reaction. Gal beta 1----4GlcNAc-R + UDP-Gal(alpha 1----3-galactosyltransferase)----Gal alpha 1----3Gal beta 1----4GlcNAc-R + UDP This enzyme, which participates in the glycosylation of cell membrane glycoconjugates in nonprimate mammals, prosimians, and New World monkeys, appears to have been suppressed in Old World primates as a result of evolutionary events which occurred 20-30 million years ago. It is argued that an anomalous activity of this enzyme in man may result in initiation of autoimmune diseases because of the de novo expression of Gal alpha 1----3Gal beta 1----4GlcNAc-R epitopes recognized by anti-Gal. |
Journal of Biological Chemistry. 1988 Nov 25;263(33):17755-62. | |
| Galili U. | 2018 | Why Do We Produce Anti-Gal: Evolutionary Appearance of Anti-Gal in Old World Primates. The natural anti-Gal antibody is one of the multiple natural anti-carbohydrate antibodies produced in humans against a wide range of carbohydrate antigens on GI bacteria. The antibody is unique to humans, apes, and Old World monkeys, and it binds specifically to a mammalian carbohydrate antigen called the α-gal epitope that is synthesized in nonprimate mammals, lemurs (prosimians) and New World monkeys by the glycosylation enzyme α1,3GT. The α1,3GT gene (GGTA1) appeared in mammals >100 million years ago, prior to the split between marsupial and placental mammals. This gene has been conserved in its active form, in all mammals, except for Old World monkeys, apes, and humans. Inactivation of the α1,3GT gene in ancestral Old World primates occurred 20–30 million years ago and could have been associated with epidemics of enveloped viruses in the Eurasia-Africa continent. It is suggested that prior to such epidemics, few ancestral Old World primates acquired deletion point mutations that inactivated the α1,3GT gene and eliminated α-gal epitopes. This resulted in loss of immune tolerance to the α-gal epitope and thus, in production of the anti-Gal antibody against antigens on bacteria colonizing the GI tract. This accidental inactivation of the α1,3GT gene in very small populations is analogous to the highly rare blood type “Bombay” individuals who do not synthesize blood group H (O antigen) because of inactivation of the α1,2-fucosyltransferase gene. The loss of immune tolerance to blood group H antigen has resulted in production of natural anti-blood group H antibodies in the blood group Bombay individuals. It is suggested that anti-Gal protected against infections by enveloped viruses presenting α-gal epitopes, which were lethal to the parental primate populations that conserved active α1,3GT and thus, synthesized α-gal epitopes. Alternative causes for the elimination of Old World primates synthesizing α-gal epitopes could be bacteria or protozoa parasites presenting α-gal or α-gal-like epitopes, and bacterial toxins, or detrimental viruses that used α-gal epitopes in these primates as “docking receptors.” Ultimately, any of these proposed selective processes could result in extinction of Old World primates synthesizing α-gal epitopes on their cells. These ancestral primates were replaced by offspring populations lacking α-gal epitopes and producing the anti-Gal antibody, which continues to be produced by Old World monkeys, apes, and humans. New World monkeys and lemurs were protected from pathogens of the Old World by oceanic barriers, thus they continue to synthesize α-gal epitopes and lack the ability to produce the anti-Gal antibody. This scenario of few individuals in a large population having a mutation(s) that inactivates a glycosyltransferase gene thus, resulting in production of evolutionary advantageous natural antibodies against the eliminated carbohydrate antigen, may reflect one of the mechanisms inducing changes in the carbohydrate profile of various mammalian populations. |
The Natural Anti-Gal Antibody As Foe Turned Friend In Medicine. 2018:23. | anti-gal; evolution |
| Galili U. | 2018 | Evolution in primates by “Catastrophic‐selection” interplay between enveloped virus epidemics, mutated genes of enzymes synthesizing carbohydrate antigens, and natural anti‐carbohydrate antibodies. “Catastrophic‐selection” is an evolutionary mechanism, by which entire parental‐populations are eliminated but very few mutated offspring survive and replace extinct parental‐populations. The human natural anti‐carbohydrate antibodies, anti‐Gal and anti‐Neu5Gc suggest the occurrence of catastrophic‐selection events in primate evolution. Parental‐populations synthesizing corresponding carbohydrate‐antigens underwent extinction in viral epidemics, and few offspring survived. These offspring carried accidental mutations that inactivated carbohydrate‐antigen synthesis and produced natural‐antibody against the lost antigen. Such natural anti‐carbohydrate antibody was produced against environmental carbohydrate‐antigens (e.g., gastrointestinal bacteria). The carbohydrate‐antigen in infected parental‐populations was also synthesized on viruses by the host glycosylation‐machinery. The natural‐antibody in the offspring bound to the carbohydrate‐antigen on infecting viruses produced in parental‐populations, destroyed the viruses and protected these offspring from extinction. This process occurred in ancestral Old‐World monkeys and apes synthesizing α‐gal epitopes, which were replaced 20–30 million‐years‐ago by offspring lacking α‐gal epitopes and producing natural anti‐Gal antibody against this antigen, and later in hominins synthesizing the sialic‐acid antigen Neu5Gc, which were replaced by offspring lacking Neu5Gc and producing anti‐Neu5Gc antibody. A present‐day example for accidental mutations in very few humans that lost a common carbohydrate‐antigen and produce a natural antibody against it is the rare blood‐group “Bombay” individuals. These individuals lack the H‐antigen (blood‐group O) which is synthesized in all other humans, and produce the natural anti‐H antibody against blood‐group O. Overall, it is suggested that natural anti‐carbohydrate antibodies played a critical role in preventing complete extinction of mammalian species in epidemics of highly virulent viruses and may have similar role in future events. |
American Journal of Physical Anthropology. 2019 Feb;168(2):352-63. | evolution; |
| Galili U. | 1989 | Abnormal expression of α-galactosyl epitopes in man: a trigger for autoimmune processes?. 1% of circulating IgG in man is anti-Gal antibody, which interacts specifically with the carbohydrate structure Gal alpha 1----3Gal beta 1----4GlcNAc-R on mammalian glycoconjugates (described throughout as the alpha-galactosyl epitope). This epitope is abundant on cell surface glycoconjugates of non-primate mammals, prosimians, and New World monkeys. It is not found on cells of Old World monkeys, apes, and man because of diminished alpha 1----3 galactosyltransferase enzyme activity. However, the alpha 1----3 galactosyltransferase gene seems to be present within the human genome. A mechanism that increases alpha 1----3 galactosyltransferase activity in human cells could trigger an autoimmune process mediated by anti-Gal binding to the newly synthesised alpha-galactosyl epitopes. |
The Lancet. 1989 Aug 12;334(8659):358-61. | autoimmune disease |
| Galili U. | 1993 | Evolution and pathophysiology of the human natural anti-α-galactosyl IgG (anti-Gal) antibody Anti-Gal is a human natural antibody which interacts specifically with the mammalian carbohydrate structure Galα1-3Galβ1-4GlcNAc-R, termed, the α-galactosyl epitope. This antibody constitutes approximately 1% of circulating IgG in human serum and is produced, upon stimulation, by 1% of circulating B lymphocytes. Anti-Gal is also present as IgA antibodies in body secretions such as saliva, milk and colostrum. The antigenic source for the constant production of anti-Gal seems to be the α-galactosyl-like epitopes found on many bacteria of the gastrointestinal flora. Whereas anti-Gal is abundant in humans, apes and Old World monkeys, it is absent from New World monkeys, prosimians and nonprimate mammals. The latter group of species produces, however, large amounts of α-galactosyl epitopes (> 106 epitopes per cell). It is estimated that anti-Gal appeared in ancestral Old World primates less than 28 million years ago, possibly as a result of an evolutionary event which exerted a selective pressure for the suppression of α-galactosyl epitopes expression by inactivation of the gene for the enzyme α1,3 galactosyltransferase. This also resulted in the loss of immune tolerance to the α-galactosyl epitope and the production of anti-Gal. The physiologic role of this antibody is not clear as yet. It may participate in the protection against gastrointestinal bacteria. In addition it seems to contribute to the removal of normal and pathologically senescent red cells by interacting with the few hundred cryptic α-galactosyl epitopes which are exposed de novo in the course of red cell aging, thereby opsonizing these cells for phagocytosis by reticuloendothelial macrophages. The α-galactosyl epitope has been found to be aberrantly expressed on human cells and the interaction of anti-Gal with such epitopes may result in autoimmune disease. Preliminary data suggest such a mechanism in Graves' disease. Anti-Gal has been found to interact with therapeutic recombinant proteins expressing α-galactosyl epitopes, but so far there is no indication that it affects the half-life in the circulation and the biologic activity. Detection of anti-Gal in the seminal fluid and in the cerebrospinal fluid may serve as a simple means for assessment of damage to the blood-genital tract barrier or the blood-brain barrier. Studies on the interaction of anti-Gal with aberrantly expressed α-galactosyl epitopes on human cells may elucidate the possible role of anti-Gal in human autoimmune diseases. |
Springer seminars in immunopathology. 1993 Sep 1; 15(2-3): 155-171. | evolution; autoimmune disease; Graves; thyroid; semen |
| Galili U. | 2020 | Human Natural Antibodies to Mammalian Carbohydrate Antigens as Unsung Heroes Protecting against Past, Present, and Future Viral Infections. Human natural antibodies to mammalian carbohydrate antigens (MCA) bind to carbohydrate-antigens synthesized in other mammalian species and protect against zoonotic virus infections. Three such anti-MCA antibodies are: (1) anti-Gal, also produced in Old-World monkeys and apes, binds to α-gal epitopes synthesized in non-primate mammals, lemurs, and New-World monkeys; (2) anti-Neu5Gc binds to Neu5Gc (N-glycolyl-neuraminic acid) synthesized in apes, Old-World monkeys, and many non-primate mammals; and (3) anti-Forssman binds to Forssman-antigen synthesized in various mammals. Anti-viral protection by anti-MCA antibodies is feasible because carbohydrate chains of virus envelopes are synthesized by host glycosylation machinery and thus are similar to those of their mammalian hosts. Analysis of MCA glycosyltransferase genes suggests that anti-Gal appeared in ancestral Old-World primates following catastrophic selection processes in which parental populations synthesizing α-gal epitopes were eliminated in enveloped virus epidemics. However, few mutated offspring in which the α1,3galactosyltransferase gene was accidentally inactivated produced natural anti-Gal that destroyed viruses presenting α-gal epitopes, thereby preventing extinction of mutated offspring. Similarly, few mutated hominin offspring that ceased to synthesize Neu5Gc produced anti-Neu5Gc, which destroyed viruses presenting Neu5Gc synthesized in parental hominin populations. A present-day example for few humans having mutations that prevent synthesis of a common carbohydrate antigen (produced in >99.99% of humans) is blood-group Bombay individuals with mutations inactivating H-transferase; thus, they cannot synthesize blood-group O (H-antigen) but produce anti-H antibody. Anti-MCA antibodies prevented past extinctions mediated by enveloped virus epidemics, presently protect against zoonotic-viruses, and may protect in future epidemics. Travelers to regions with endemic zoonotic viruses may benefit from vaccinations elevating protective anti-MCA antibody titers. |
Antibodies. 2020 Jun;9(2):25. | evolution; virus; mammalian carbohydrate antigens |
| Galili U. | 2013 | Anti-Gal: an abundant human natural antibody of multiple pathogeneses and clinical benefits. Anti-Gal is the most abundant natural antibody in humans, constituting ~ 1% of immunoglobulins. Anti-Gal is naturally produced also in apes and Old World monkeys. The ligand of anti-Gal is a carbohydrate antigen called the 'alpha-gal epitope' with the structure Galalpha1-3Galbeta1-4GlcNAc-R. The alpha-gal epitope is present as a major carbohydrate antigen in non-primate mammals, prosimians and New World monkeys. Anti-Gal can contributes to several immunological pathogeneses. Anti-Gal IgE produced in some individuals causes allergies to meat and to the therapeutic monoclonal antibody cetuximab, all presenting alpha-gal epitopes. Aberrant expression of the alpha-gal epitope or of antigens mimicking it in humans may result in autoimmune processes, as in Graves' disease. alpha-Gal epitopes produced by Trypanosoma cruzi interact with anti-Gal and induce 'autoimmune like' inflammatory reactions in Chagas' disease. Anti-Gal IgM and IgG further mediate rejection of xenografts expressing alpha-gal epitopes. Because of its abundance, anti-Gal may be exploited for various clinical uses. It increases immunogenicity of microbial vaccines (e.g. influenza vaccine) presenting alpha-gal epitopes by targeting them for effective uptake by antigen-presenting cells. Tumour lesions are converted into vaccines against autologous tumour-associated antigens by intra-tumoral injection of alpha-gal glycolipids, which insert into tumour cell membranes. Anti-Gal binding to alpha-gal epitopes on tumour cells targets them for uptake by antigen-presenting cells. Accelerated wound healing is achieved by application of alpha-gal nanoparticles, which bind anti-Gal, activate complement, and recruit and activate macrophages that induce tissue regeneration. This therapy may be of further significance in regeneration of internally injured tissues such as ischaemic myocardium and injured nerves. |
Immunology. 2013 Sep;140(1):1-1. | |
| Galili U. | 2018 | The natural anti-gal antibody as foe turned friend in medicine. Chapter 7: Anti-Gal IgE Mediates Allergies to Red Meat. [BOOK] Immunoglobulin class (isotype) switch to anti-Gal IgE was first observed in cancer patients receiving an immunotherapy treatment by infusion of the monoclonal antibody cetuximab (anti-epidermal growth factor receptor antibody). When produced in a hybridoma, this antibody carries the α-gal epitope, which binds anti-Gal IgE antibody in these patients, inducing allergic and anaphylactic reactions. Studies on the production of anti-Gal IgE indicated that it is rare in Northern regions of the United States (20%). The production of anti-Gal IgE was further found to correlate with allergies to red meat (beef, pork, and lamb). One of the reasons for class switch from anti-Gal IgM or IgG1 to IgE was found to be “lone star” (Amblyomma americanum) tick bites. Bites of the ticks Ixodes ricinus in Europe, Haemaphysalis longicornis in Asia and Ixodes holocyclus in Australia were found to cause similar seroconversion to anti-Gal IgE and appearance of allergic reactions to red meat. Such allergies also are found with pork kidneys because they contain very large amounts of α-gal epitopes. The substances in tick saliva which stimulate the class switch in anti-Gal B cells into IgE producing cells have not been identified yet. Prevention of allergic reactions to α-gal epitopes may be achieved by identifying patients producing anti-Gal IgE, either by the use of a lab test or by a skin test with natural or synthetic α-gal epitopes linked to lipids or to other molecules. Use of therapeutic natural or recombinant glycoproteins and monoclonal antibodies lacking α-gal epitopes will also prevent anti-Gal IgE-mediated allergic reactions. This may be achieved by enzymatic destruction of α-gal epitopes with recombinant α-galactosidase or by using eukaryotic expression systems confirmed not to include the biosynthetic pathway for synthesis of α-gal epitopes. Because such biosynthetic pathways are also present in mammary glands of nonprimate mammals, recombinant therapeutic glycoproteins produced in mammary glands and secreted in milk of transgenic farm animals should be evaluated for presence of α-gal epitopes. If present, the α-gal epitopes may be destroyed enzymatically with α-galactosidase. Alternatively, the milk may be produced in knockout mammals for the α1,3GT gene, i.e., mammals that lack the ability to synthesize the α-gal epitope. Lastly, it would be of interest to determine whether red meat from cows, pigs, or lambs engineered to lack α-gal epitopes by disruption of the α1,3GT (GGTA1) gene, can be consumed by individuals producing anti-Gal IgE without having allergic reactions to this food. |
The natural anti-Gal antibody as foe turned friend in medicine. Academic Press; 2017 Sep 5. | |
| Galili U. | 2019 | Evolution in primates by “Catastrophic‐selection” interplay between enveloped virus epidemics, mutated genes of enzymes synthesizing carbohydrate antigens, and natural anti‐carbohydrate antibodies “Catastrophic‐selection” is an evolutionary mechanism, by which entire parental‐populations are eliminated but very few mutated offspring survive and replace extinct parental‐populations. The human natural anti‐carbohydrate antibodies, anti‐Gal and anti‐Neu5Gc suggest the occurrence of catastrophic‐selection events in primate evolution. Parental‐populations synthesizing corresponding carbohydrate‐antigens underwent extinction in viral epidemics, and few offspring survived. These offspring carried accidental mutations that inactivated carbohydrate‐antigen synthesis and produced natural‐antibody against the lost antigen. Such natural anti‐carbohydrate antibody was produced against environmental carbohydrate‐antigens (e.g., gastrointestinal bacteria). The carbohydrate‐antigen in infected parental‐populations was also synthesized on viruses by the host glycosylation‐machinery. The natural‐antibody in the offspring bound to the carbohydrate‐antigen on infecting viruses produced in parental‐populations, destroyed the viruses and protected these offspring from extinction. This process occurred in ancestral Old‐World monkeys and apes synthesizing α‐gal epitopes, which were replaced 20–30 million‐years‐ago by offspring lacking α‐gal epitopes and producing natural anti‐Gal antibody against this antigen, and later in hominins synthesizing the sialic‐acid antigen Neu5Gc, which were replaced by offspring lacking Neu5Gc and producing anti‐Neu5Gc antibody. A present‐day example for accidental mutations in very few humans that lost a common carbohydrate‐antigen and produce a natural antibody against it is the rare blood‐group “Bombay” individuals. These individuals lack the H‐antigen (blood‐group O) which is synthesized in all other humans, and produce the natural anti‐H antibody against blood‐group O. Overall, it is suggested that natural anti‐carbohydrate antibodies played a critical role in preventing complete extinction of mammalian species in epidemics of highly virulent viruses and may have similar role in future events. |
American Journal of Physical Anthropology. 2019 Feb;168(2):352-63. | |
| Galili U. | 2016 | Natural anti-carbohydrate antibodies contributing to evolutionary survival of primates in viral epidemics?. Humans produce multiple natural antibodies against carbohydrate antigens on gastrointestinal bacteria. Two such antibodies appeared in primates in recent geological times. Anti-Gal, abundant in humans, apes and Old-World monkeys, appeared 20–30 million years ago (mya) following inactivation of the α1,3GT gene (GGTA1). This gene encodes in other mammals the enzyme α1,3galactosyltransferase (α1,3GT) that synthesizes α-gal epitopes (Galα1-3Galβ1-4GlcNAc-R) which bind anti-Gal. Anti-Neu5Gc, found only in humans, appeared in hominins <6 mya, following elimination of N-glycolylneuraminic-acid (Neu5Gc) because of inactivation of CMAH, the gene encoding hydroxylase that converts N-acetylneuraminic-acid (Neu5Ac) into Neu5Gc. These antibodies, were initially produced in few individuals that acquired random mutations inactivating the corresponding genes and eliminating α-gal epitopes or Neu5Gc, which became nonself antigens. It is suggested that these evolutionary selection events were induced by epidemics of enveloped viruses, lethal to ancestral Old World primates or hominins. Such viruses presented α-gal epitopes or Neu5Gc, synthesized in primates that conserved active GGTA1 or CMAH, respectively, and were lethal to their hosts. The natural anti-Gal or anti-Neu5Gc antibodies, produced in offspring lacking the corresponding carbohydrate antigens, neutralized and destroyed viruses presenting α-gal epitopes or Neu5Gc. These antibodies further induced rapid, effective immune responses against virus antigens, thus preventing infections from reaching lethal stages. These epidemics ultimately resulted in extinction of primate populations synthesizing these carbohydrate antigens and their replacement with offspring populations lacking the antigens and producing protective antibodies against them. Similar events could mediate the elimination of various carbohydrate antigens |
Glycobiology. 2016 Nov 14;26(11):1140-50. | |
| Galliker N, Vallelian F, Petrausch U, Ballmer-Weber B, Schmid-Grendelmeier P. | 2013 | Perioperative anaphylaxis due to Physiogel-and allergy to beef and gelatine. No abstract available |
ALLERGOLOGIE. 2013 Sep 1;36(9):410-2. | perioperative care; surgery; gelatine; gelatin; Physiogel; personal care prodcut |
| Galvao VR, Castells MC. | 2015 | Hypersensitivity to biological agents-updated diagnosis, management, and treatment. Biological agents are used in the treatment of neoplastic, autoimmune, and inflammatory diseases and their clinical applications are becoming broader. Following their increased utilization, hypersensitivity reactions linked to these drugs have become more frequent, sometimes preventing the use of first-line therapies. The clinical presentation of hypersensitivity reactions to biological agents ranges from mild cutaneous manifestations to life-threatening reactions. In this scenario, rapid desensitization is a groundbreaking procedure that enables selected patients to receive the full treatment dose in a safe way, in spite of their immediate hypersensitivity reaction to the drug, and protects them against anaphylaxis. The aim of this review is to update and discuss some of the main biological agents used in clinical practice (rituximab, trastuzumab, cetuximab, ofatumumab, tocilizumab, brentuximab, omalizumab, and tumor necrosis factor alpha inhibitor agents) and their associated hypersensitivity reactions, including clinical presentations, diagnosis, and treatment in the acute setting. In addition, novel management options with rapid desensitization are presented. |
The Journal of Allergy and Clinical Immunology: In Practice. 2015 Mar 1;3(2):175-85. | medical product; pharmacy; pharmaceutical; biologic |
| Ganiko L, Silva LS, Puccia R, Freymüller-Haapalainen E, Matsuo AL, Almeida IC, Miranda K, Medeiros LC, Sinigaglia-Coimbra R, Vallejo MC. | 2011 | The Pathogenic Fungus Paracoccidioides brasiliensis Exports Extracellular Vesicles Containing Highly Immunogenic α-Galactosyl Epitopes. Exosome-like vesicles containing virulence factors, enzymes, and antigens have recently been characterized in fungal pathogens, such as Cryptococcus neoformans and Histoplasma capsulatum. Here, we describe extracellular vesicles carrying highly immunogenic α-linked galactopyranosyl (α-Gal) epitopes in Paracoccidioides brasiliensis. P. brasiliensis is a dimorphic fungus that causes human paracoccidioidomycosis (PCM). For vesicle preparations, cell-free supernatant fluids from yeast cells cultivated in Ham's defined medium-glucose were concentrated in an Amicon ultrafiltration system and ultracentrifuged at 100,000 × g. P. brasiliensis antigens were present in preparations from phylogenetically distinct isolates Pb18 and Pb3, as observed in immunoblots revealed with sera from PCM patients. In an enzyme-linked immunosorbent assay (ELISA), vesicle components containing α-Gal epitopes reacted strongly with anti-α-Gal antibodies isolated from both Chagas' disease and PCM patients, with Marasmius oreades agglutinin (MOA) (a lectin that recognizes terminal α-Gal), but only faintly with natural anti-α-Gal. Reactivity was inhibited after treatment with α-galactosidase. Vesicle preparations analyzed by electron microscopy showed vesicular structures of 20 to 200 nm that were labeled both on the surface and in the lumen with MOA. In P. brasiliensis cells, components carrying α-Gal epitopes were found distributed on the cell wall, following a punctuated confocal pattern, and inside large intracellular vacuoles. Lipid-free vesicle fractions reacted with anti-α-Gal in ELISA only when not digested with α-galactosidase, while reactivity with glycoproteins was reduced after β-elimination, which is indicative of partial O-linked chain localization. Our findings open new areas to explore in terms of host-parasite relationships in PCM and the role played in vivo by vesicle components and α-galactosyl epitopes. |
Eukaryot. Cell. 2011;10:343-51. | fungus; ascomycetes; ascomycota; Paracoccidioides |
| Gao B, Long C, Lee W, Zhang Z, Gao X, Landsittel D, Ezzelarab M, Ayares D, Huang Y, Cooper DK, Wang Y. | 2017 | Anti-Neu5Gc and anti-non-Neu5Gc antibodies in healthy humans. Our group previously investigated the levels of anti-Gal and anti-nonGal IgM and IgG in a cohort of 75 healthy humans of various backgrounds, and found some significant differences related to factors such as age, gender, ABO blood group, diet, vaccination history, and geographic location during childhood. We have now expanded our cohort (n = 84) to investigate the levels of anti-Neu5Gc and anti-nonGal/nonNeu5Gc antibodies in healthy humans. Anti-nonGal and anti-nonGal/nonNeu5Gc human IgM and IgG binding to pRBCs and pAECs from GTKO/CD46 and GTKO/CD46/Neu5GcKO pigs were measured by flow cytometry. Anti-Gal and anti-Neu5Gc IgM and IgG levels were measured by ELISA. In summary, (i) the great majority (almost 100%) of humans had anti-Neu5Gc IgM and IgG antibodies that bound to pAECs and approximately 50% had anti-Neu5Gc antibodies that bound to pRBCs, (ii) there was significantly less human antibody binding to pig cells that did not express either Gal or Neu5Gc compared with those that did not express Gal alone, (iii) the levels of both IgM and IgG binding to GTKO/CD46/Neu5GcKO pRBCs and pAECs were low, (iv) the level of anti-Neu5Gc IgG was higher in men than women, (v) the level did not change with age or diet, and there was some variability associated with (vi) previous vaccination history and (vii) the geographic region in which the individual spent his or her childhood. Our study confirms that human antibody binding to RBCs and AECs from GTKO/CD46/Neu5GcKO pigs is greatly reduced compared to binding to GTKO/CD46 cells. However, all humans appear to have a low level of antibody that binds to pAECs that is not directed to either Gal or Neu5Gc. Our findings require consideration in planning clinical trials of xenotransplantation. |
PLoS One. 2017 Jul 17;12(7):e0180768. | xenoglycan; glycan antigen; glycan antibody; Neu5Gc; carbohydrate; sialic acid |
| Garcia MB, Gomez-Samper AF, Garcia E, Peñaranda A. | 2020 | Delayed urticaria or anaphylaxis after consumption of red meat with evidence of alpha-gal sensitisation |
BMJ Case Reports CP. 2020 Dec 1;13(12):e236923. | |
| García-Menaya JM, Cordobés-Durán C, Gómez-Ulla J, Zambonino MA, Mahech, AC, Chiarella GM, Giangrande N, Bobadilla-González P. | 2016 | Successful Desensitization to Cetuximab in a Patient With a Positive Skin Test to Cetuximab and Specific IgE to Alpha-gal. Cetuximab (Erbitux, Merck KGaA) is an IgG1 chimeric monoclonal antibody that binds specifically to the extracellular domain of the human epidermal growth factor receptor (EGFR). It is approved for the treatment of RAS wild-type metastatic colorectal cancer as well as head and neck cancer. Severe reactions tend to occur during the first administration [1]. In 2008, severe anaphylactic reactions after the first infusion of cetuximab were reported for the first time, and the authors demonstrated that pre-existing specific IgE (sIgE) antibodies to galactose-alpha-1,3-galactose (alpha-gal) were responsible for the reactions [2]. Alpha-gal is present on the Fab portion of the cetuximab heavy chain. Very few cases of desensitization to cetuximab have been described since these first reports of severe reactions [3-5]. Moreover, in recent years, severe hypersensitivity reactions to red meat with a delay of several hours have been reported in patients with IgE to alpha-gal [6]. Here, we present the case of a 50-year-old man without a previous history of atopy or drug allergy who was diagnosed with pyriform sinus squamous cell cancer in 2014. The cancer was treated by surgery followed by chemotherapy and radiation therapy. The disease progressed, however, and a year later the patient was diagnosed with lung metastases. |
Journal of investigational allergology & clinical immunology. 2016;26(2):132. | Garcia-Menaya Bobadilla-Gonzalez |
| Gaspar A, Santos N, Faria E, Câmara R, Rodrigues-Alves R, Carrapatoso I, Gomes E, Pereira AM, Carneiro-Leão L, Morais-Almeida M, Delgado L, Pedro E, Branco-Ferreira M. | 2020 | Anaphylaxis: a decade of a nationwide allergy society registry Background: Anaphylaxis is an acute, life-threatening, multi-organ hypersensitivity reaction. Objective: The aim of this study was to identify the causes of anaphylaxis in Portugal, contributing to a better knowledge of the anaphylaxis epidemiology and management. Methods: During a 10-year period a nationwide notification system for anaphylaxis. was implemented, with voluntary reporting by allergists. Data on 1783 patients with anaphylaxis were included. Detailed characterization of etiopathogenesis, manifestations and clinical management was obtainedfrom pediatric and adult ages. Results: The mean age was 32.720.3 years, 30% under 18 years of age; 58% were female. The mean age at the first anaphylaxis episode was 27.520.4 years (ranging from 1-month-old to 88years). The main culprits of anaphylaxis were foods (48%), drugs (37%) (main trigger in adults, 48%) and hymenoptera-venoms (7%). The main culprit foods were shellfish (27%), fresh fruits (17%), cow’s milk (16%), treenuts (15%), fish (8%), egg (7%) and peanut (7%). The main drugs were nonsteroidal antiinflammatory drugs(43%), antibiotics (39%) and anaesthetic agents (6%). Other causes were exercise (3%), latex (2%), cold-induced (2%) and idiopathic anaphylaxis (2%). Most patients (80%) were admitted to the emergency department; only 43% received adrenaline treatment. Recurrence of anaphylaxis occurred in 41% of patients (21% with ≥3 anaphylactic episodes); 7% used an adrenaline autoinjector device. Conclusions: Food has been the leading cause of anaphylaxis in Portugal, while drugs were the main elicitors in adults. We highlight the undertreatment with adrenaline and recurrent episodes, pointing for the need to improve diagnostic and therapeutic approaches of anaphylaxis. Note: alpha-gal syndrome was not found to be a major cause of anaphylaxis. |
Journal of investigational allergology & clinical immunology.:0. | Europe; Portugal; prevalence; anaphylaxis |
| Gelatin Manufacturers Institute of America | 2012 | Gelatin Handbook |
Gelatin Manufacturers Institute of America | |
| German-Sanchez A, Alonso-Llamazares A, Latorre-Ibanez MD, BartolomeZavala B, Antepara-Ercoreca I. S | 2024 | Sheep cheese allergy in Alpha-gal Syndrome. |
J Investig Allergol Clin Immunol (2023) 33(6):491–3. doi: 10.18176/jiaci.0897 | Sheep's milk; cheese |
| Ghahramani GK, Temprano J. | 2015 | Tick bite-related meat allergy as a cause of chronic urticaria, angioedema, and anaphylaxis in endemic areas. | International Journal of Dermatology. 2015 Jan 23;2(54):e64-5. | chronic spontaneous urticaria CSU chronic idiopathic urticaria CIU cross-contamination; venison; dermatology; west virginia; routine screening |
| Ghelichi-Ghojogh M, Ghezeljeh E, Delavari S, Aghapour SA. | 2024 | Alpha-Gal syndrome as a novel food allergy: a case report study |
Annals of Medicine and Surgery. 2024 Jun 1;86(6):3624-6. | Asia; Iran; case report |
| Ghishan S, Obeidat Y, Altarawneh S, Wang X, Sherif A. | 2023 | S2588 Alpha Gal Allergy Associated With Eosinophilic Gastroenteritis, Coincidence or Coexistence?. |
Official journal of the American College of Gastroenterology| ACG. 2023 Oct 1;118(10S):S1793-4. | GI; gastroenterology; eosinophilic gastroenteritis; GI variant; GI phenotype |
| Gilstad C, Conry-Cantilena K, Zarpak R, Eder A. | 2023 | An outbreak of anaphylactic transfusion reactions to group B plasma and platelets and its possible relationship to Alpha-Gal syndrome BACKGROUND: Alpha-gal syndrome (AGS) is a potentially life-threatening acquired meat allergy associated with tick bites. The allergen Galactose-α-1,3-Galactose is antigenically similar to the B blood group antigen. B blood group status offers some protection against development of the allergy. Although not preferred practice, transfusion of plasma and platelets from group B donors is believed to be safe for group O recipients. STUDY DESIGN AND METHODS: Anaphylactic transfusion reactions were reported for three patients in two Washington DC hospitals from Nov 2022 to February 2023. A chart review was performed for all three patients. Patients or family members were interviewed, and IgE levels to alpha-gal were measured in two of the three patients. RESULTS: One reaction was acutely fatal. All reactions were to blood group B Plasma or Platelets in blood group O recipients. One patient had two prior anaphylactic reactions to group O RBCs and group B Plasma in a previous admission. All patients came from southern Maryland where AGS is an emerging problem. Two patients had histories of tick bites, previously unexplained gastrointestinal complaints, and abnormal elevated levels of IgE to alpha gal. Two patients had cat allergies. DISCUSSION: AGS is an emerging problem which may have implications for blood transfusion practice. Avoidance of blood group B antigen containing components may be prudent in non-blood group B patients with established AGS. Investigation for AGS should be considered in the evaluation of anaphylactic transfusion reactions. |
Transfusion. 2023;63(10):1997-2000.Available at SSRN 4453856. 2023 May 19. | immunohematology; transfusion complications; blood type; plasma; platetelet; death; mortality |
| Giuffrida MG, Cavallarin L, Lamberti C, Cirrincione S. | 2024 | Study of alpha-Gal glycosylation of cow's milk proteins and allergological implications. |
Published 2023. Accessed March 12, 2024 | Milk; dairy |
| Glaze K, Ancayan S, Dodge S. | 2025 | Perioperative management of alpha-gal syndrome in bariatric surgery: A case study of venous thromboembolism prophylaxis. |
J Am Pharm Assoc (2003). 2025;(102381):102381. | gastroenterology; bariatric surgery; heparin; fondaparinux; argatroban; bivalirudin; venous thromboembolism prophylaxis |
| Gleim ER, Conner LM, Berghaus RD, Levin ML, Zemtsova GE, Yabsley MJ. | 2014 | The phenology of ticks and the effects of long-term prescribed burning on tick population dynamics in southwestern Georgia and northwestern Florida Some tick populations have increased dramatically in the past several decades leading to an increase in the incidence and emergence of tick-borne diseases. Management strategies that can effectively reduce tick populations while better understanding regional tick phenology is needed. One promising management strategy is prescribed burning. However, the efficacy of prescribed burning as a mechanism for tick control is unclear because past studies have provided conflicting data, likely due to a failure of some studies to simulate operational management scenarios and/or account for other predictors of tick abundance. Therefore, our study was conducted to increase knowledge of tick population dynamics relative to long-term prescribed fire management. Furthermore, we targeted a region, southwestern Georgia and northwestern Florida (USA), in which little is known regarding tick dynamics so that basic phenology could be determined. Twenty-one plots with varying burn regimes (burned surrounded by burned [BB], burned surrounded by unburned [BUB], unburned surrounded by burned [UBB], and unburned surrounded by unburned [UBUB]) were sampled monthly for two years while simultaneously collecting data on variables that can affect tick abundance (e.g., host abundance, vegetation structure, and micro- and macro-climatic conditions). In total, 47,185 ticks were collected, of which, 99% were Amblyomma americanum, 0.7% were Ixodes scapularis, and fewer numbers of Amblyomma maculatum, Ixodes brunneus, and Dermacentor variabilis. Monthly seasonality trends were similar between 2010 and 2011. Long-term prescribed burning consistently and significantly reduced tick counts (overall and specifically for A. americanum and I. scapularis) regardless of the burn regimes and variables evaluated. Tick species composition varied according to burn regime with A. americanum dominating at UBUB, A. maculatum at BB, I. scapularis at UBB, and a more even composition at BUB. These data indicate that regular prescribed burning is an effective tool for reducing tick populations and ultimately may reduce risk of tick-borne disease. |
PLoS One. 2014 Nov 6;9(11):e112174. | tick; tick management; lone star tick |
| Glynn De'M, Halma J, Welch H, Shakhnovich V, Friesen C. | 2023 | Non-anaphylactic Variant of Alpha-gal Syndrome as an Etiology for Chronic Gastrointestinal Symptoms in Children We report 3 pediatric patients who present with only non-anaphylactic symptoms of alpha-gal syndrome. This report highlights the necessity of not discounting alpha-gal syndrome from a differential diagnosis for patients with recurrent gastrointestinal distress and emesis after consuming mammalian meat, even in the absence of an anaphylactic reaction. |
The Journal of Pediatrics. 2023 May 17:113486. | pediatric; gastroenterological; GI variant; GI phenotype; gastroenterology |
| Gonzales-González VA, Díaz AM, Fernández K, Rivera MF. | 2018 | Prevalence of food allergens sensitization and food allergies in a group of allergic Honduran children. Background: Food allergy is a public health problem that has increased in the last decade. Despite the increasing rates in children, quality data on the burden of these diseases is lacking particularly in developing countries. Honduras has no studies in pediatric patients. Objectives: The objective of this research was to identify the most common sensitization patterns to food through epicutaneous skin testing and food allergy rates in children and their correlation with common allergic diseases in a group of patients from Hospital of Pediatrics Maria. . Methods: Cross-sectional retrospective, descriptive study in which records and database of all allergic patients in the immunology outpatient clinic from Hospital of Pediatrics Maria were reviewed between the periods of January 2015 through June 2016. . Results: A total of 365 children were analyzed, the age of participants were in the range from 1 to 18 years, with an average of 9.8 years. Sensitization to food allergens were found in 23, and 58.3% were poly-sensitized. The most common food allergens that patients were sensitized to: milk 9.0%, eggs 6.9%, peanut 4.9% and pork meat 4.4%. Food allergy was confirmed via oral food challenged in 9.3% of the patients. The most frequent food allergies found were: cow’s milk allergy 6%, hen’s egg allergy 5.2% and wheat allergy 1.9%.. Conclusions: Milk and egg were the most common a food allergens found in the population studied. Most of the patients were found to be poly-sensitized. The frequent food allergies confirmed via oral food challenge were cow’s milk allergy, hen’s egg allergy and wheat allergy. |
Allergy, Asthma & Clinical Immunology. 2018 Dec 1;14(1):23. | Latin America; Honduras; prevalence |
| González-de-Olano D. | 2023 | A case of transient pork-cat syndrome in a child due to albumin sensitization. |
J Investig Allergol Clin Immunol. 2024;34(3). | pork-cat syndrome; pediatric; remission |
| Gonzalez‐Quintela A, Dam Laursen AS, Vidal C, Skaaby T, Gude F, Linneberg A. | 2014 | IgE antibodies to alpha-gal in the general adult population: relationships with tick bites, atopy, and cat ownership. Letter to the editor: Background: The carbohydrate alpha-gal epitope is present in many animal proteins, including those of red meat and animal immunoglobulins, such as cat IgA. Systemic anaphylaxis to the alpha-gal epitope has recently been described. Objective: To investigate and compare the prevalence of alpha-gal-specific (s)IgE and its associated factors in the general adult population from two separated (Northern and Southern) European regions (Denmark and Spain, respectively). Methods: Cross-sectional study of 2297 and 444 randomly selected adults from 11 municipalities in Denmark and one in Spain. Alpha-gal sIgE was assessed by ImmunoCAP to bovine thyroglobulin. Additional assessments included a panel of skin prick test (SPT) to common aeroallergens and epidemiological factors, including the history of tick bites in the Danish series. Results: The prevalence of positive (>= 0.1 kU(A)/L) sIgE to alpha-gal was 5.5% and 8.1% in the Danish and Spanish series, respectively. The prevalence of sIgE >= 0.35 kU(A)/L was 1.8% and 2.2% in Denmark and Spain, respectively. Alpha-gal sIgE positivity was associated with pet ownership in both series and, particularly, cat ownership (data available in the Danish series). Alpha-gal sIgE positivity was associated with atopy (SPT positivity) in both series, although it was not associated with SPT positivity to cat or dog dander. Alpha-gal sIgE positivity was strongly associated with a history of tick bites. Conclusions and Clinical Relevance: The prevalence of alpha-gal sIgE antibodies in these general adult European populations is similarly low. The presence of alpha-gal sIgE antibodies is associated with a history of tick bites, atopy, and cat ownership. |
Clinical & Experimental Allergy. 2014 Aug;44(8):1061-8. | Europe; Spain; Denmark; prevalence |
| Gosnell H, Stein A, Acosta DE. | 2022 | Postoperative fever secondary to enoxaparin usage with pork allergy. Postoperative fevers are common in hospitalised patients and warrant workup beyond the early post-op period. A 50-year-old man was admitted after sustaining a tibial plateau fracture. Fevers began 3 days after external fixation and persisted through a second surgery despite initial negative workup. Careful review of medications revealed enoxaparin as the instigating agent of a febrile drug reaction, and the fevers resolved after discontinuing the drug. On further questioning, it was discovered the patient had an allergy to pork, from which the main components of enoxaparin are typically derived. To our knowledge, this is the first reported enoxaparin-induced fever in the setting of a pork allergy. Enoxaparin-induced fevers should be considered in patients with unexplained post-op fever. Our case demonstrates the importance of analysing newly administered medications. Simple detailed history may significantly reduce patient morbidity and help to broaden differentials during investigation. |
BMJ Case Reports CP. 2022 Jan 1;15(1):e246904. | Perioperative; surgery; blood thinner; medical products; porcine; enoxaparin; febrile; fever; post-operative fever |
| Gowda DC, Glushka J, Halbeek HV, Thotakura RN, Bredehorst R, Vogel CW. | 2001 | N-linked oligosaccharides of cobra venom factor contain novel α (1-3) galactosylated Lex structures. Cobra venom factor (CVF), a nontoxic, complement-activating glycoprotein in cobra venom, is a functional analog of mammalian complement component C3b. The carbohydrate moiety of CVF consists exclusively of N-linked oligosaccharides with terminal α1-3-linked galactosyl residues, which are antigenic in human. CVF has potential for several medical applications, including targeted cell killing and complement depletion. Here, we report a detailed structural analysis of the oligosaccharides of CVF. The structures of the oligosaccharides were determined by lectin affinity chromatography, antibody affinity blotting, compositional and methylation analyses, and high-resolution 1H-NMR spectroscopy. Approximately 80% of the oligosaccharides are diantennary complex-type, ∼12% are tri- and tetra-antennary complex-type, and ∼8% are oligomannose type structures. The majority of the complex-type oligosaccharides terminate in Galα1-3Galβ1-4(Fucα1-3)GlcNAcβ1, a unique carbohydrate structural feature abundantly present in the glycoproteins of cobra venom. |
Glycobiology. 2001 Mar 1;11(3):195-208. | |
| Gray CL, Van Zyl A, Strauss L. | 2016 | Midnight anaphylaxis: to red meat in patients with alpha-gal sensitisation : a recent discovery in the food allergy world and a case report from South Africa : guest review. A syndrome of delayed anaphylaxis to red meat, occurring in geographical clusters; initially identified in the United States, was first described in 2009. A few years later, this enigmatic anaphylactic reaction was ascribed to IgE antibodies to galactose-alpha-1,3-galactose (alphagal), an oligosaccharide, which is a major blood group substance in non-primate mammals. It appears that the predominant source of sensitisation to alpha-gal is bites from certain ticks. Since 2009, several hundreds to thousands of cases of delayed red-meat allergy have been described worldwide, but very few reports have come out of Africa. This case series describes 2 cases of an acquired form of delayed anaphylaxis to beef and mutton in patients who were subsequently found to be highly sensitised to alpha-gal, residing in the same region. |
Current Allergy & Clinical Immunology. 2016 Jun 1;29(2):102-4. | Africa; South Africa; non-tick vectors; helminth; scabies; |
| Greenhawt M, Oppenheimer J, Shaker M. | 2019 | Fearing the Bark That Has No Bite Parsing Practical From Theoretical Risk Editorial repy to: Mawhirt S.L. Banta E. Successful intravenous heparin administration during coronary revascularization surgery in a patient with alpha-gal anaphylaxis history [published online May 28, 2019]. Ann Allergy Asthma Immunol. 2019; |
Annals of Allergy, Asthma & Immunology. 2019 Oct 1;123(4):327-8. | Pharmacy; pharmaceutical; medication; heparin; perioperative |
| Grönlund H, Adédoyin J, Commins SP, Platts-Mills TA, van Hage M. | 2009 | The carbohydrate galactose-alpha-1,3-galactose is a major IgE binding epitope on cat IgA. Letter to the editor: Cross-reactive carbohydrate determinants are widely occurring IgE epitopes. Glycan-related IgE reactivity has been demonstrated in most allergen sources, especially in the plant kingdom. The clinical effect of these cross-reactive carbohydrate determinants is debated. We were recently able to show that IgE Abs to the cat IgA, present in cat-sensitized patients, are mainly directed to a glycan moiety localized on the α-chain. In addition, we have reported that these carbohydrates are present on IgM Abs from cat, as well as on IgM from many different mammalian species, but not human immunoglobulins. Interestingly, IgE antibodies to cat IgM and cat IgA show a complete cross-reactivity, whereas cat IgG does not, suggesting an identical oligosaccharide on the two former immunoglobulin classes. Because this is the first mammalian carbohydrate IgE epitope found, it is of major interest to identify the carbohydrate structure responsible for the broad cross-reactivity. |
Journal of allergy and clinical immunology. 2009 May 1;123(5):1189-91. | Europe; Sweden; cat |
| Guillier A, Fauconneau A, De Barruel F, Guez S, Doutre MS. | 2015 | Allergic hypersensitivity to red meat induced by tick bites: a French case report. An increasing number of cases of delayed anaphylactic reactions after the consumption of red meat have been reported in the United States but few similar cases have been reported in Europe. We report herein a French observation. A 54-year-old man first developed generalized urticaria, tachycardia, abdominal pain, nausea and vomiting 4 hours after eating beef kidneys. He subsequently had several similar episodes after eating beef, lamb and pork meat. He ate chicken and fish without problems. He did not drink alcohol nor exercise during these episodes. The patient reported a tick bite a few months before the onset of symptoms. The patient lived in the Southeast of France where exposure to Ixodes ricinus is common. He had no atopy, previous food or respiratory allergy. Allergological investigations showed positive specific IgE to pork (6.15 kU/l, N< 0.10 kU/L), beef (5.10 kU/L, N<0.10 kU/L) and Galactose-alpha-1,3-galactose (alpha-gal) IgE (77 kU/L, N<0.10 kU/L). Specific IgE to chicken (0.10 kU/L) and turkey (0.10 kU/L) were negative. After the withdrawal of red meat, he has remained free from urticaria and digestive symptoms |
European Journal of Dermatology. 2015 Jun 30;25(3):277. | Europe; France |
| Gulbin K, Keskin Ö, Asilsoy S, Zeyrek D, Kilic M, Altintas D, Kucukosmanoglu E, Yilmaz M, Kendirli S. | 2012 | Food allergy profile in tertiary clinics in southeast part of Turkey:‘a multi center study: 1336. No abstract available |
Journal of Allergy and Clinical Immunology. 2012 Nov; 67. | Asia; Europe; Turkey; prevalence |
| Gülsen A, Wedi B, Jappe U. | 2020 | Hypersensitivity reactions to biologics (part II): classifications and current diagnostic and treatment approaches. |
Allergo Journal International. 2020 Jun 19:1-6. | Gulsen; biologics |
| Guo RR, Heijs B, Wang WJ, Wuhrer M, Liu L, Lageveen-Kammeijer GS, Voglmeir J. | 2024 | Insight into distribution and composition of nonhuman N-Glycans in mammalian organs via MALDI-TOF and MALDI-MSI. Both α-Gal- and Neu5Gc-containing N-glycans were present in all samples, with α-Gal-modified N-glycans being the most abundant nonhuman carbohydrate motif. The abundance of N-glycans terminating with α-Gal or Neu5Gc was higher in heart and kidney samples than livers. MSI revealed kidneys had the highest glycosylation levels, and α-Gal-containing N-glycans were abundant in the kidney cortex but scarce in the medulla. |
Carbohydrate Polymers. 2024 Nov 26:123065. | glycosylation; Neu5Gc; kidney; heart; liver |
| Guo RR, Lageveen-Kammeijer GS, Wang W, Dalebout H, Zhang W, Wuhrer M, Liu L, Heijs B, Voglmeir J. | 2023 | Analysis of Immunogenic Galactose-α-1, 3-galactose-Containing N-Glycans in Beef, Mutton, and Pork Tenderloin by Combining Matrix-Assisted Laser Desorption/Ionization-Mass Spectroscopy and Capillary Electrophoresis Hyphenated with Mass Spectrometry via Electrospray Ionization. Severe allergic reactions to certain types of meat following tick bites have been reported in geographic regions which are endemic with ticks. This immune response is directed to a carbohydrate antigen (galactose-α-1,3-galactose or α-Gal), which is present in glycoproteins of mammalian meats. At the moment, asparagine-linked complex carbohydrates (N-glycans) with α-Gal motifs in meat glycoproteins and in which cell types or tissue morphologies these α-Gal moieties are present in mammalian meats are still unclear. In this study, we analyzed α-Gal-containing N-glycans in beef, mutton, and pork tenderloin and provided for the first time the spatial distribution of these types of N-glycans in various meat samples. Terminal α-Gal-modified N-glycans were found to be highly abundant in all analyzed samples (55, 45, and 36% of N-glycome in beef, mutton, and pork, respectively). Visualizations of the N-glycans with α-Gal modification revealed that this motif was mainly present in the fibroconnective tissue. To conclude, this study contributes to a better understanding of the glycosylation biology of meat samples and provides guidance for processed meat products, in which only meat fibers are required as an ingredient (i.e., sausages or canned meat). |
Journal of Agricultural and Food Chemistry. 2023 Feb 21. | Connective tissue; bioprosthetic valves; surgical implants; medical products |
| Gupta M, Schuyler A, Workman L, Commins S, Platts-Mills T, Wilson J. | 2018 | Galactose-A-1,3-Galactose Sensitization and the A-Gal Syndrome: Characteristics of Subjects Seeking Emergency Care. Introduction: Galactose -α-1,3- galactose (α-Gal) is an oligosaccharide of non-primate mammals and the culprit allergen in a syndrome of delayed anaphylaxis to mammalian meat (ie, α-Gal syndrome). We sought to describe the clinical presentations of a large cohort of subjects from Central Virginia, with or without IgE to α-Gal, who presented for emergent care for allergic reactions. Methods: A detailed questionnaire regarding clinical reactions was completed by patients who received care at a Virginia allergy clinic and who reported a history of anaphylaxis or urticaria. Many, but not all, related their reactions to mammalian meat. Serum was obtained and total IgE and α-Gal specific IgE (sIgE) were measured by ImmunoCAP. Results: Of 408 patients who completed the survey, 224 had sought urgent care (195 of which were in the emergency department) for allergic reactions. Of these, 191 were α-Gal sIgE positive, of whom 82% perceived an association between consumption of mammalian meat and allergic symptoms. When compared to non-sensitized subjects, α-Gal sensitized subjects were more commonly male (45% vs. 18%, p2 hours after a perceived trigger (82% vs. 25%, p Conclusions: The α-Gal syndrome is commonly adult-onset, has a characteristic delay of onset >2 hours following mammalian meat ingestion, and frequently results in presentation for emergent medical care. |
Annals of Allergy, Asthma & Immunology. 2018 Nov 1;121(5):S11. | ER emergency care |
| Gupta M, Workman L, Schuyler AJ, Commins SP, Platts-Mills TA, Wilson JM. | 2019 | Description of Subjects Reporting Reactions to Mammalian Meat Who Test Negative for IgE to Galactose-alpha-1,3-galactose (alpha-Gal). RATIONALE: The oligosaccharide a-Gal has recently emerged as a regionally important cause of a syndrome of IgE-mediated delayed anaphylaxis to mammalian meat; however, other allergens can also contribute to meat allergy. We sought to describe subjects who were evaluated for suspicion of mammalian meat allergy but who tested negative for IgE to a-Gal. METHODS: As part of an IRB-approved observational study, 254 patients with histories of suspected allergic reactions (urticaria and anaphylaxis) to mammalian meat were enrolled from central Virginia. Serum was obtained and subjects completed detailed questionnaires. Assays were conducted for total IgE, as well as specific IgE (sIgE) to aGal, cat, beef, pork, gelatin, cat serum albumin, bovine serum albumin and pork serum albumin using standard ImmunoCAP assays. RESULTS: Using a cut-off of 0.35 IU/mL, sIgE to a-Gal was detected in 238 of the 254 subjects. Of the 16 remaining subjects, 10 (63%) described onset of symptoms occurring >_ 2 hrs after mammalian meat ingestion. Specific IgE testing supported a diagnosis of pork-cat syndrome in 3 subjects (sIgE detected to cat, pork and cat serum albumin >_ 0.1 IU/mL), 5 were found to have low-titer a-Gal sIgE (ie, 0.1-0.34 IU/mL) and 3 had detectable sIgE to beef (>_ 0.1 IU/mL) suggestive of primary beef allergy. CONCLUSIONS: In central Virginia sIgE to a-Gal is a common cause of anaphylaxis to mammalian meat, however other causes such as pork-cat syndrome, primary beef allergy, and gelatin allergy should also be considered. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB256. | pork-cat syndrome primary meat allergy gelatin gelatine |
| Gupta S, Rabinovitch N. | 2019 | M059 CHOLINERGIC URTICARIA WITH ANAPHYLAXIS IN A PATIENT DIAGNOSED WITH ALPHA-GAL ALLERGY. Introduction: Cholinergic urticaria is a form of inducible urticaria triggered by passive elevation of core body temperature or by strong emotion. This form of physical urticaria may range from isolated cutaneous involvement to anaphylaxis. Diagnosis should be considered in young women who present with cutaneous, upper airway, lower airway, and/or GI symptoms. Case Description: A 16-year-old girl presented with a history of sudden onset episodes of abdominal pain, vomiting, hives, and difficulty breathing without identifiable trigger. Due to demonstration of alpha-gal sensitization, the patient was strictly avoiding all mammalian meat products with significant impact on quality of life and persistent symptoms. Examination showed dermatographism after scratching and urticaria on pressured areas suggestive of physical urticaria. Sweat chloride testing resulted in a well demarcated localized wheel. Free run exercise challenge resulted in immediate development of skin changes, difficulty breathing with audible stridor, and nausea. Spirometry demonstrated a 13% drop in FEV1. Vitals remained stable. Serum tryptase performed prior to and after challenge remained unchanged. Symptoms resolved within 30 minutes of cooling down and with Zyrtec. She was started on Zyrtec 10mg twice daily. Two days later, free run exercise challenge was repeated with nebulized beta agonist and anticholinergic pretreatment. She remained asymptomatic throughout with stable exam and spirometry. Later, beef was reintroduced into the diet after passing oral food challenge. Discussion: Our case demonstrates the importance of considering cholinergic urticaria with anaphylaxis in patients presenting with idiopathic anaphylaxis as the prevention and treatment can vary dramatically depending on etiology. |
Annals of Allergy, Asthma & Immunology. 2019 Nov 1;123(5):S80. | Dermatology ??? |
| Guyot L, Beauvillain C, Lemeunier V, Bourneau-Martin D, Morisset M. | 20225 | Is bovine gelatin anaphylaxis always associated with α-Gal syndrome? Two case reports and a literature review. |
Explor Asthma Allergy. 2025;3:100970. https://doi.org/10.37349/eaa.2025.100970 | gelatin; drugs and medical devices |
| Haji-Ghassemi O, Müller-Loennies S, Saldova R, Muniyappa M, Brade L, Rudd PM, Harvey DJ, Kosma P, Brade H, Evans SV. | 2014 | Groove-type recognition of chlamydiaceae-specific lipopolysaccharide antigen by a family of antibodies possessing an unusual variable heavy chain N-linked glycan. The structure of the antigen binding fragment of mAb S25-26, determined to 1.95 A resolution in complex with the Chlamydiaceae family-specific trisaccharide antigen Kdo(2-->8)Kdo(2-->4)Kdo (Kdo = 3-deoxy-alpha-d-manno-oct-2-ulopyranosonic acid), displays a germ-line-coded paratope that differs significantly from previously characterized Chlamydiaceae-specific mAbs despite being raised against the identical immunogen. Unlike the terminal Kdo recognition pocket that promotes cross-reactivity in S25-2-type antibodies, S25-26 and the closely related S25-23 utilize a groove composed of germ-line residues to recognize the entire trisaccharide antigen and so confer strict specificity. Interest in S25-23 was sparked by its rare high mum affinity and strict specificity for the family-specific trisaccharide antigen; however, only the related antibody S25-26 proved amenable to crystallization. The structures of three unliganded forms of S25-26 have a labile complementary-determining region H3 adjacent to significant glycosylation of the variable heavy chain on asparagine 85 in Framework Region 3. Analysis of the glycan reveals a heterogeneous mixture with a common root structure that contains an unusually high number of terminal alphaGal-Gal moieties. One of the few reported structures of glycosylated mAbs containing these epitopes is the therapeutic antibody Cetuximab; however, unlike Cetuximab, one of the unliganded structures in S25-26 shows significant order in the glycan with appropriate electron density for nine residues. The elucidation of the three-dimensional structure of an alphaGal-containing N-linked glycan on a mAb variable heavy chain has potential clinical interest, as it has been implicated in allergic response in patients receiving therapeutic antibodies. |
Journal of Biological Chemistry. 2014 Jun 13;289(24):16644-61. | |
| Hallerman E, Bredlau J, Camargo LS, Dagli ML, Karembu M, Kovich D, Muia AN, Murrone ML, Rocha-Salavarrieta PJ, Romero-Aldemita R, Tizard M. | 2024 | Enabling regulatory policy globally will promote realization of the potential of animal biotechnology. |
CABI Agriculture and Bioscience. 2024 Dec;5(1):1-28. | policy; regulatory framework; GMO; food |
| Hamsten C, Starkhammar M, Tran TA, Johansson M, Bengtsson U, Ahlen G, Sällberg M, Grönlund H, van Hage M. | 2013 | Identification of galactose-alpha-1,3-galactose in the gastrointestinal tract of the tick Ixodes ricinus; possible relationship with red meat allergy. Patients with IgE antibodies against the carbohydrate epitope galactose-alpha-1,3-galactose (alpha-Gal) have reported severe allergic reactions after consumption of red meat. Investigations have revealed associations between IgE to alpha-Gal and tick bites. We provide the first direct evidence that alpha-Gal is present within ticks thus potentially explaining the relationship between tick exposure and sensitization to alpha-Gal, with development of red meat allergy as a secondary phenomena. Serum from Swedish patients with delayed severe reactions to red meat was included in the study. A dose-dependent inhibition of IgE responses to alpha-Gal by the tick Ixodes ricinus is demonstrated. Furthermore, using cryostat-cut sections of I. ricinus, we show that both a monoclonal and a polyclonal antibody against alpha-Gal stains the gastrointestinal tract of the tick. The same pattern is seen when staining with patient sera IgE positive to alpha-Gal. These results confirm that the alpha-Gal epitope is present in I. ricinus and imply host exposure to alpha-Gal during a tick bite. This provides further evidence that tick bites are associated with IgE responses to alpha-Gal and red meat allergy. |
Allergy. 2013 Apr;68(4):549-52. | Europe; Sweden; vector; tick; Ixodes ricinus |
| Hamsten C, Tran TA, Starkhammar M, Brauner A, Commins SP, Platts-Mills TA, van Hage M. | 2013 | Red meat allergy in Sweden: Association with tick sensitization and B-negative blood groups. Letter to the Editor: ... |
Journal of allergy and clinical immunology. 2013 Dec 1;132(6):1431-4. | Europe; Sweden; vector; tick; Ixodes ricinus |
| Hansson GK, Hermansson A. | 2011 | The immune system in atherosclerosis Cardiovascular disease, a leading cause of mortality worldwide, is caused mainly by atherosclerosis, a chronic inflammatory disease of blood vessels. Lesions of atherosclerosis contain macrophages, T cells and other cells of the immune response, together with cholesterol that infiltrates from the blood. Targeted deletion of genes encoding costimulatory factors and proinflammatory cytokines results in less disease in mouse models, whereas interference with regulatory immunity accelerates it. Innate as well as adaptive immune responses have been identified in atherosclerosis, with components of cholesterol-carrying low-density lipoprotein triggering inflammation, T cell activation and antibody production during the course of disease. Studies are now under way to develop new therapies based on these concepts of the involvement of the immune system in atherosclerosis. |
Cellular and Molecular Life Sciences. 2013 Oct 1;70(20):3847-69. | Atherosclerosis |
| Harper V, Wagner A, Sowa P, Rutkowski K | 2019 | Allergy in frequent travelers: the alpha-gal story and the first UK case series. Galactose-α-(1,3)-galactose (alpha-gal) is found in most nonprimate mammalian cell membranes. 1 Humans, apes, and Old World monkeys lack alpha-1,3 galactosyltransferase required for the synthesis of this carbohydrate. 2 It is therefore highly immunogenic to humans and implicated in alpha-gal syndrome/allergy—the first noninfectious tickborne disease in humans. 3 Alpha-gal moiety has been found in tick salivary proteins, and primary immunoglobulin E (IgE) sensitization to alpha-gal is thought to occur through inoculation of saliva during a tick bite. 2 , 4 Recurrent tick bites induce high levels of anti-alpha-gal IgE antibodies, which in some individuals results in hypersensitivity reactions on consumption of red meat, innards, dairy, and gelatin. 2 Different tick species seem responsible: lone star tick ( Amblyomma americanum) (United States), Ixodes ricinus (Europe), and Ixodes holocyclus and I australianises (Australia), Amblyomma variegatum (Africa—Ivory coast), Haemaphysalis longicornis (Korea), H longicornis and Amblyomma testudinarium (Japan), Amblyomma cajennense (Panama, Costa Rica), Amblyomma sculptum (Brazil). 2 , 5 , 6 In the United Kingdom, a culprit tick species is yet to be identified, but I ricinus is likely given its distribution in Europe. 6 Hypersensitivity reactions of varying severity. They can present with cutaneous (pruritus, urticaria, angioedema), gastrointestinal, and systemic symptoms, including anaphylaxis, and are often delayed (3-8 hours post food). 1 Alpha-gal also might be responsible for hypersensitivity reactions to cetuximab, snake anti-venom, and Varicella zoster vaccine. 2 , 7 |
Annals of Allergy, Asthma & Immunology. 2019 Dec 1;123(6):616-8. | United Kingdom UK |
| Hasegawa K, Powers EM, Yoneda ZT, Richardson TD, Siegrist KK, Stevenson WG. | 2023 | Importance of Alpha-Gal Syndrome in Patients Undergoing Catheter Ablation. |
HeartRhythm Case Reports. | perioperative; surgery; cardiac; cardiovascular; cardiology; medical products; pharmacy; pharmaceutical; heparin; premedication; catheter ablation; thrombus |
| Hashizume H, Fujiyama T, Umayahara T, Kageyama R, Walls AF, Satoh T. | 2018 | Repeated Amblyomma testudinarium tick bites are associated with increased galactose-a-1,3-galactose carbohydrate IgE antibody levels: a retrospective cohort study in a single institution. Background: Alpha-gal syndrome is a hypersensitivity reaction to red meat mediated by IgE antibody specific to galactose-α-1,3-galactose carbohydrate (alpha-gal). Amblyomma tick bites are associated with this condition, but the pathophysiology is not understood. Objective: To clarify the mechanism of development of alpha-gal syndrome after tick bites. Methods: We compared alpha-gal antibody levels between patients with and without a history of tick bites and examined histologic stainings of tick bite lesions between patients with and without detectable alpha-gal IgE antibody. Results: Patients who had ≥2 tick bites had higher levels of alpha-gal IgE antibody compared with those with only 1 tick bite or healthy individuals. On histologic investigation, greater numbers of basophils and eosinophils, but not mast cells, were observed infiltrating lesions of patients with ≥2 tick bites compared with those with 1 tick bite. Type 2 cytokine-producing T-cell infiltration was predominantly observed in such patients. Limitations: The study was conducted at a single institution in Japan. Conclusion: In Amblyomma tick bite lesions, basophils; eosinophils; and type 2, cytokine-producing T cells infiltrate the skin and alpha-gal IgE antibodies are produced. These findings provide a potential mechanistic connection between Amblyomma bites and red meat hypersensitivity. |
Journal of the American Academy of Dermatology. 2018 Jun 1;78(6):1135-41. | Vector; Amblyomma testudarium; tick bites; multiple tick bites; increases in alpha-gal Ige; mechanism of induction |
| Hatfield G, Tepliakova L, Tran J, Lu H, Gilbert M, Tam RY. | 2023 | Bivalent non-human gal-α1-3-gal glycan epitopes in the Fc region of a monoclonal antibody model can be recognized by anti-Gal-α1-3-Gal IgE antibodies. Monoclonal antibody (mAb) production using non-human cells can introduce non-human glycan epitopes including terminal galactosyl-α1–3-galactose (α1–3-Gal) moieties. Cetuximab is a commercial mAb associated with causing anaphylaxis in some patients due to the binding of endogenous anti-α1–3-Gal IgE to the Fab (containing bi-α1–3-galactosylated glycans) but not to the Fc region (containing mono-α1–3-galactosylated glycans). Despite being low in abundance in typical commercial mAbs, the inherent sensitivity of cell culture conditions on glycosylation profiles, and the development of novel glycoengineering strategies, novel antibody-based modalities, and biosimilars by various manufacturers with varying procedures, necessitates a better understanding of the structural requirements for anti-α1–3-Gal IgE binding to the Fc region. Herein, we synthesized mAb glycoforms with varying degrees and regioisomers of α1–3-galactosylation and tested their binding to two commercial anti-α1–3-Gal human IgE antibodies derived from a human patient with allergies to red meat (comprising α1–3-Gal epitopes), as well as to the FcγRIIIA receptor. Our results demonstrate that unexpectedly, anti-α1–3-Gal human IgE antibodies can bind to Fc glycans, with bi-α1–3-galactosylation being the most important factor, highlighting that their presence in the Fc region may be considered as a potential critical quality attribute, particularly when using novel platforms in mAb-based biotherapeutics. |
InMabs 2023 Dec 31 (Vol. 15, No. 1, p. 2239405). Taylor & Francis. | pharmacy; pharmaceutical; biologic; monoclonal antibody |
| Hatfield G, Tepliakova L, Tran J, Lu H, Gilbert M, Tam RY. | 2023 | Bivalent non-human gal-α1-3-gal glycan epitopes in the Fc region of a monoclonal antibody model can be recognized by anti-Gal-α1-3-Gal IgE antibodies. Monoclonal antibody (mAb) production using non-human cells can introduce non-human glycan epitopes including terminal galactosyl-α1–3-galactose (α1–3-Gal) moieties. Cetuximab is a commercial mAb associated with causing anaphylaxis in some patients due to the binding of endogenous anti-α1–3-Gal IgE to the Fab (containing bi-α1–3-galactosylated glycans) but not to the Fc region (containing mono-α1–3-galactosylated glycans). Despite being low in abundance in typical commercial mAbs, the inherent sensitivity of cell culture conditions on glycosylation profiles, and the development of novel glycoengineering strategies, novel antibody-based modalities, and biosimilars by various manufacturers with varying procedures, necessitates a better understanding of the structural requirements for anti-α1–3-Gal IgE binding to the Fc region. Herein, we synthesized mAb glycoforms with varying degrees and regioisomers of α1–3-galactosylation and tested their binding to two commercial anti-α1–3-Gal human IgE antibodies derived from a human patient with allergies to red meat (comprising α1–3-Gal epitopes), as well as to the FcγRIIIA receptor. Our results demonstrate that unexpectedly, anti-α1–3-Gal human IgE antibodies can bind to Fc glycans, with bi-α1–3-galactosylation being the most important factor, highlighting that their presence in the Fc region may be considered as a potential critical quality attribute, particularly when using novel platforms in mAb-based biotherapeutics. |
InMabs 2023 Dec 31 (Vol. 15, No. 1, p. 2239405). Taylor & Francis. | medical product; biologic; monoclonal antibody |
| Hattori N, Matsumoto M, Chinuki Y, Takenaka M, Tomimura S, Tsukazaki N, Murota H. | 2024 | TWO CASES OF α-GAL SYNDROME CAUSED BY INGESTION OF WILD BOAR MEAT. |
Arerugi=[Allergy]. 2024;73(8):995-9. | Boar |
| Hawkins A, Wilson JM, Hawkins RB, Moskaluk C, Li RC, Tracci M. | 2023 | α-Gal as a Cause for Recurrent Femoral Artery Stenosis after Patch Angioplasty with Bovine Pericardium. α-Gal syndrome (AGS) is an allergy to meat and other products derived from non-primate mammals resulting from development of IgE antibodies against the oligosaccharide galactose-α,1,3-galactose (α-Gal). Sensitivity to α-Gal is linked to tick bites, particularly bites from Amblyomma americanum (lone star tick). Recent studies demonstrate early failure of bioprosthetic valves in the setting of chronic inflammation following exposure to animal-derived surgical implants. We report a case of AGS associated with restenosis of prior bovine pericardium used for a common femoral patch angioplasty requiring reoperation. |
Annals of Vascular Surgery-Brief Reports and Innovations. 2023 May 1:100192. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; pharmacy; pharmaceutical |
| Hawkins RB, Frischtak HL, Kron IL, Ghanta RK. | 2016 | Premature Bioprosthetic Aortic Valve Degeneration Associated with Allergy to Galactose-Alpha-1,3-Galactose. We present the cases of two patients with bioprosthetic aortic valves who developed an allergy to alpha-gal. Each had premature degeneration of their bioprosthesis and demonstrated rapidly increasing transvalvular gradients after development of their allergy. Each underwent successful replacement with a mechanical aortic valve within 1-2 years of symptom onset. ...Although there is little evidence that device companies are aggressively developing solutions for carbohydrate antigens, the process for bringing these advances to market is long; the Food and Drug Administration regulates not only the new valve but also the genetically modified animal. With 3 potential solutions to alleviate α-gal–related bioprosthetic valve degeneration, we hope that the academic and biotechnology communities can come together to find the best option and bring this to market rapidly. We must work together to continue improving the care of our patients. |
Journal of cardiac surgery. 2016 Jul;31(7):446-8. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; pharmacy; pharmaceutical |
| Hawkins RB, Ghanta RK. | 2017 | Mammalian Meat Allergy and Advances in Bioprosthetic Valve Technology Reply. Letters to the Editor. We read with interest the letter to the editor by Ankersmit and colleagues. ‘‘When Meat Allergy Meets Cardiac Surgery: A Driver for Humanized Bioprosthesis.’’ The University of Virginia has led the epidemiologic characterization of the mammalian meat allergy to galactose-a-1,3-galactose (a-gal). |
The Journal of thoracic and cardiovascular surgery. 2017 Oct;154(4):1327. | bioprosthetic heart valve; cardiac; cardiothoracic surgery; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; pharmacy; pharmaceutical |
| Hawkins RB, Wilson JM, Mehaffey JH, Platts-Mills TA, Ailawadi G. | 2020 | Safety of Intravenous Heparin for Cardiac Surgery in Patients with Alpha-Gal Syndrome. Background:Alpha-gal syndrome is a tick-acquired disease caused by IgE to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal), causing allergic reactions to meat and products sourced from non-primate mammals. As heparin is porcine-derived, we hypothesized that patients with alpha-gal syndrome who received high-dose heparin for cardiac surgery would have increased risk of anaphylaxis. MethodsAll cardiac surgery patients at an academic medical center from 2007-2019 were cross-referenced with research and clinical databases for the alpha-gal IgE blood test. Clinical data was obtained through the institutional Society of Thoracic Surgeons Adult Cardiac Database and chart review. Patients were stratified by development of an allergic reaction for univariate statistical analysis. ResultsOf the 8,819 patients, 17 (0.19%) had a positive alpha-gal test prior to cardiac surgery. Of these 17 patients, 4 (24%) had a severe allergic reaction. The median alpha-gal titer was significantly higher in patients with a reaction (75 [61-96] vs 8 [3-18] IU/mL, p=0.006). There were no differences in median heparin loading dose, total dose, or maximum activated clotting time (all p>0.05). In a subgroup of 8 patients with recent alpha-gal IgE level, 4 (50%) developed an allergic reaction. ConclusionsAlthough alpha-gal is rare in patients undergoing cardiac surgery, there is up to a 50% risk of serious allergic reaction to heparin for cardiopulmonary bypass. Higher preoperative alpha-gal titers may confer a higher risk of severe allergic reaction. For patients with a clinical suspicion of alpha-gal syndrome, we recommend pre-screening with IgE levels and pre-medicating prior to receiving high doses of intravenous heparin. |
The Annals of Thoracic Surgery. 2020 Oct 5. | Cardiac surgery; cardiothoracic; cardiology; heart; pharmaceutical; pharmacy; medical prroducts; heparin, perioperative; anesthesia |
| Heffes-Doon A, Banta E, Horne N. | 2023 | α-Gal Syndrome: A Case Report of Diagnosis and Meat Reintroduction. |
Annals of Internal Medicine: Clinical Cases. 2023 Jun 20;2(6):e220836. | Oral challenge; meat reintroduction |
| Heffes-Doon A, McGintee E, Akerman M, Banta E. | 2022 | Abstract only A017 ALPHA-GAL SYNDROME ON EASTERN LONG ISLAND: IGE RATIOS MORE GENERALIZABLE THAN ALPHA-GAL SIGE ALONE. Conclusion This represents the first study describing AGS on Long Island; AGS should be on the differential for cases of idiopathic anaphylaxis. The difference between alpha-gal sIgE levels for males and females suggests isolated use of these levels should be replaced by ratios or percentages. Weight may be one of many contributors explaining the difference in alpha-gal sIgE between males and females. |
Annals of Allergy, Asthma & Immunology. 2022 Nov 1;129(5):S6. | New York; Long Island; diagnosis; ratio |
| Heffes-Doon A, McGintee E, Akerman M, Banta E. | 2023 | CHARACTERIZATION OF ALPHA-GAL SYNDROME IN PEDIATRIC PATIENTS ON EASTERN LONG ISLAND. |
Annals of Allergy, Asthma & Immunology. 2023 Nov 1;131(5):S8. | pediatric; New York; Long Island |
| Heffes-Doon A, McGintee E, Akerman M, Banta E. | 2024 | Characterization of alpha-gal syndrome and sensitization on Eastern Long Island. |
The Journal of Allergy and Clinical Immunology: In Practice. 2024 Feb 28. | New York; Long Island; |
| Helm J, Mereiter S, Oliveira T, Gattinger A, Markovitz DM, Penninger JM, Altmann F, Stadlmann J. | 2024 | Non-targeted N-glycome profiling reveals multiple layers of organ-specific diversity in mice. |
Non-targeted N-glycome profiling reveals multiple layers of organ-specific diversity in mice. Nature Communications. 2024 Nov 9;15(1):9725. | |
| Hene SR, Kress JR, Looper JT, Beyer ES, O'Quinn TG, Chao MD. | 2025 | Influence of Degree of Doneness on the Alpha-Gal Content of Striploins and its Relationship with Red Meat Allergy. |
Kansas Agricultural Experiment Station Research Reports. 2025;11(1):20. | Cooking; heat stable |
| Hennings L, Artaud C, Jousheghany F, Monzavi-Karbassi B, Pashov A, Kieber-Emmons T. | 2011 | Carbohydrate mimetic peptides augment carbohydrate-reactive immune responses in the absence of immune pathology. Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses. |
Cancers. 2011 Dec;3(4):4151-69. | peptide mimetics |
| Herman-Giddens ME, Herman-Giddens DM. | 2017 | Retrospective Case Reports of Two Central North Carolina Residents: Frequency of Tick Bites and Associated Illnesses, 2001-2014. BACKGROUND: Tick bites are a source of illness and disease agents that may lead to morbidity and occasional fatalities in North Carolina. Public health interest in tick-borne illness and disease has increased due to continuing discoveries of tick-borne diseases and their increasing geographic spread and disease incidence. There are no data published on lay individuals with cumulative tick bites and associated illnesses over a period of years. METHODS: We learned of a married couple living on a central North Carolina property who had used reasonable bite prevention methods, kept attached ticks after removal, and recorded dates and related illness records from 2001–2014. We obtained permission to analyze their records. Ticks were identified by an entomologist. RESULTS: The male subject had a total of 219 bites from identifiable ticks comprising 213 Amblyomma americanum, 4 Dermacentor variabilis, and 2 Ixodes scapularis. He was treated for possible Rocky Mountain spotted fever once and presumed Southern Tick Associated Rash Illness once. The female subject had 193 bites comprising 168 A. americanum, 23 D. variabilis, and 2 I. scapularis. She was treated for 4 episodes of presumed Southern Tick Associated Rash Illness and one possible case of a tick-borne infection. Several years of data were missing for both subjects. LIMITATIONS: This retrospective report relied on the subjects' own records for much of the data. The experience of these individuals cannot be generalized. Diagnoses of these tick-related illnesses are inexact due to lack of tests for the Southern Tick Associated Rash Illness and cross-reactivity in tests for spotted fever rickettsiosis. CONCLUSIONS: This report demonstrates that tick-associated illnesses, including episodes fitting the Center for Disease Control and Prevention's definition of the Southern Tick Associated Rash Illness, may be more common than realized. Use of personal tick protection measures for tick bite illness and disease prevention may not be sufficiently protective. Further subject-based research on tick and disease burden on selected populations would be informative, and could aid in planning appropriate actions to mitigate the effects of tick-borne disease in North Carolina. |
North Carolina Medical Journal. 2017 May 1;78(3):156-63. | |
| Hess S, O'Leary D. | 2015 | ALPHA GAL ALLERGY DIAGNOSIS MADE BY LISTENING TO PATIENT'S FAMILY: A CASE REPORT. |
ANNALS OF ALLERGY ASTHMA & IMMUNOLOGY. 2015 Nov 1; 115( 5): A68-A69. | |
| Higuita NI, Franco-Paredes C, Henao-Martínez AF. | 2021 | The expanding spectrum of disease caused by the Lone Star Tick, Amblyomma americanum. Ticks are remarkable vectors of a diverse and growing list of infectious agents of importance to both medical and veterinary disciplines. The tick Amblyomma americanum is one of the most frequently identified ticks in the United States with an expanding spectrum of human disease given its vast geographic range. The recently described Bourbon and Heartland viruses are likely transmitted by the Lone Star tick and are just two of the several novel tick-borne pathogens discovered in recent decades. The review will focus on these two viruses that can cause illness with similar characteristics to other diseases transmitted by the Lone Star tick. Healthcare professionals should consider these viruses in patients presenting with an ailment suggestive of a tick-born rickettsial disease that fails to improve with treatment with doxycycline. Additionally, some individuals may develop life-threatening allergic reactions triggered by the bite of the Lone Star tick. |
life.;11:12. | lone star tick; tick borne disease; tickborne disease; heartland virus; bourbon virus; differential |
| Hilger C, Clark E, Swiontek K, Chiriac AM, Caimmi DP, Demoly P, Bourrain JL. | 2020 | Anaphylaxis to bovine serum albumin tissue adhesive in a patient without meat allergy No abstract available |
J Investig Allergol Clin Immunol. 2020;30(5). | Pharmacy; pharmaceutical; bovine serum albumin; bioglue; cyolife; pork-cat syndrome; cat allergy |
| Hilger C, Fischer J, Swiontek K, Hentges F, Lehners C, Eberlein B, Morisset M, Biedermann T, Ollert M. | 2016 | * Two galactose-alpha-1,3-galactose carrying peptidases from pork kidney mediate anaphylactogenic responses in delayed meat allergy. Background: Serum IgE antibodies directed at galactose-alpha-1,3-galactose (alpha-Gal) are associated with a novel form of delayed anaphylaxis occurring upon consumption of red meat or innards. Pork kidney is known as the most potent trigger of this syndrome, but the culprit allergens have not yet been identified. The aim of this study was the identification and characterization of pork kidney proteins mediating delayed anaphylactic reactions through specific IgE to alpha-Gal. Methods: A cohort of 59 patients with specific IgE to alpha-Gal was screened by immunoblot for IgE-reactive proteins in pork kidney. Proteins were identified by peptide mass fingerprinting. Isolated proteins were assayed in ELISA and ELISA inhibition, basophil activation and skin prick test. Results: Several IgE-binding proteins of high molecular weight (100- >200 kDa) were detected in pork kidney extracts by immunoblot using patient sera and an anti-alpha-Gal antibody. Two major IgE-binding proteins were identified as porcine angiotensin-I-converting enzyme (ACE I) and aminopeptidase N (AP-N). Reactivity of patient sera and anti-alpha Gal antibody to both proteins was abolished by carbohydrate oxidation. The alpha-Gal IgE epitopes were resistant to heat denaturation. Pork kidney extract, isolated ACE I, and AP-N were able to activate patient basophils and elicit positive responses in skin prick tests. Conclusion: Two cell-membrane proteins carrying alpha-Gal epitopes were identified in pork kidney. For the first time, isolated meat proteins were shown to induce basophil activation in patients with delayed anaphylaxis to red meat providing further confirmation for the clinical relevance of these alpha-Gal-carrying proteins. |
Allergy. 2016 May;71(5):711-9. | Alpha-gal carrying proteins; organs; kidney; lungs; intestines; heat stability; thermal stability |
| Hilger C, Fischer J, Wölbing F, Biedermann T. | 2019 | Role and mechanism of galactose-alpha-1,3-galactose in the elicitation of delayed anaphylactic reactions to red meat. Purpose of Review: The alpha-Gal (α-Gal) syndrome is characterized by the presence of IgE antibodies directed at the carbohydrate galactose-alpha-1,3-galactose (α-Gal). In this article, we review the presence of α-Gal in food and non-food sources; we discuss the evolutionary context of the antibody response to α-Gal and highlight immune responses to α-Gal and other carbohydrates. Recent findings: IgE antibodies have been associated with delayed allergy to red meat. In addition to food, drugs, and other products of animal origin are increasingly perceived as a risk for patients sensitized to α-Gal. The link between tick bites and anti-α-Gal IgE-antibody production that has been established first by epidemiological studies has now been confirmed in mouse models. Summary: The anti-α-Gal immune response is complex and characterized by a unique feature. IgM and IgG antibodies have been found to confer protection against pathogens whereas the IgE-response to α-Gal is detrimental and causes severe reactions upon exposure to mammalian meat and other products. |
Current allergy and asthma reports. 2019 Jan 1;19(1):3. | Wolbing; review article |
| Hilger C, Kohnen M, Grigioni F, Lehners C, Hentges F. | 1997 | Allergic cross‐reactions between cat and pig serum albumin: Study at the protein and DNA levels. After observing a patient allergic to cat dander and pork but devoid of other allergies, we prospectively screened patients known to be allergic to cat for a second sensitization to pork. After collecting the sera of 10 young patients found to contain specific IgE to cat dander and pork, we undertook this study to detect the possible cross‐reactive allergen, define its molecular characteristics, and evaluate its clinical relevance. Through immunoblotting techniques, cat and porcine serum albumin were found to be jointly recognized molecules. These findings were further analyzed by specific anti‐albumin IgE titrations and cross‐inhibition experiments. Cat serum albumin cDNA was obtained from cat liver, and the corresponding amino acid sequence was deduced and compared to the known porcine and human serum albumin sequences. Inhibition experiments showed that the spectrum of IgE reactivity to cat serum albumin completely contained IgE reactivity to porcine serum albumin, suggesting that sensitization to cat was the primary event. In two cohorts of cat‐allergic persons, the frequency of sensitization to cat serum albumin was found to lie between 14% and 23%. Sensitization to porcine albumin was found to lie between 3% and 10%. About 1/3 of these persons are likely to experience allergic symptoms in relation to pork consumption. Sensitization to cat serum albumin should be considered a useful marker of possible cross‐sensitization not only to porcine serum albumin but also to other mammalian serum albumins. |
Allergy. 1997 Feb;52(2):179-87. | |
| Hilger C, Swiontek K, Codreanu-Morel F, Morisset M. | 2018 | Alpha-Gal beyond meat. | Journal of general internal medicine. 2013 Feb 1;28(2):322-5. | |
| Hils M, Hoffard N, Iuliano C, Kreft L, Chakrapani N, Swiontek K, Fischer K, Eberlein B, Köberle M, Fischer J, Hilger C, Ohnmacht C, Kaesler S, Wölbing F, Biedermann T. | 2023 | IgE and anaphylaxis specific to the carbohydrate alpha-gal depend on interleukin-4. Background: Alpha-gal (Galα1-3Galβ1-4GlcNAc) is a carbohydrate with the potential to elicit fatal allergic reactions to mammalian meat and drugs of mammalian origin. This type of allergy is induced by tick bites and therapeutic options for this skin-driven food allergy are limited to the avoidance of the allergen and treatment of symptoms. Thus, a better understanding of the immune mechanisms resulting in sensitization through the skin is crucial, especially in the case of a carbohydrate allergen for which underlying immune responses are poorly understood. Objective: We aimed to establish a mouse model of alpha-gal allergy for in-depth immunological analyses. Methods: GGTA1-deficient mice devoid of alpha-gal glycosylations were sensitized with the alpha-gal-carrying self-protein mouse serum albumin via repetitive intracutaneous injections in combination with the adjuvant aluminum hydroxide. The role of basophils and IL-4 in sensitization was investigated by using antibody-mediated depletion. Results: Alpha-gal-sensitized mice displayed increased levels of alpha-gal-specific IgE and IgG1 and developed systemic anaphylaxis upon challenge with both alpha-gal-containing glycoproteins and glycolipids. In accordance with alpha-gal-allergic patients, we detected elevated numbers of basophils at the site of sensitization as well as increased numbers of alpha-gal-specific B cells, germinal center B cells and B cells of IgE and IgG1 isotypes in skin-draining lymph nodes. By depleting IL-4 during sensitization, we demonstrated for the first time that sensitization and elicitation of allergy to alpha-gal and correspondingly to a carbohydrate allergen is dependent on IL-4. Conclusion: These findings establish IL-4 as a potential target to interfere with alpha-gal allergy elicited by tick bites. |
Journal of Allergy and Clinical Immunology. 2023 Dec 21. | pathogenesis; molecular mechanism; cellular mechanism; IL-4; cell subsets; Germany; Luxembourg; Dupilumab |
| Hils M, Wölbing F, Hilger C, Fischer J, Hoffard N, Biedermann T. | 2020 | The history of carbohydrates in type I allergy. Although first described decades ago, the relevance of carbohydrate specific antibodies as mediators of type I allergy had not been recognized until recently. Previously, allergen specific IgE antibodies binding to carbohydrate epitopes were considered to demonstrate a clinically irrelevant cross-reactivity. However, this changed following the discovery of type I allergies specifically mediated by oligosaccharide structures. Especially the emerging understanding of red meat allergy characterized by IgE directed to the oligosaccharide alpha-gal showed that carbohydrate-mediated reactions can result in life threatening systemic anaphylaxis which in contrast to former assumptions proves a high clinical relevance of some carbohydrate allergens. Within the scope of this review article, we illustrate the historical development of carbohydrate-allergen-research, reaching from only diagnostically relevant crossreactive-carbohydrate-determinants to clinically important antigens mediating type I allergy. Focusing on clinical and immunological features of the alpha-gal syndrome, we highlight the discovery of oligosaccharides as potentially highly immunogenic antigens and mediators of type I allergy, report what is known about the route of sensitization and the immunological mechanisms involved in sensitization and elicitation phase of allergic responses as well as currently available diagnostic and therapeutic tools. Finally, we briefly report on carbohydrates being involved in type I allergies different from alpha-gal. |
Frontiers in Immunology. 2020;11:2493. | carbohydrate allergy |
| Hinterholzer A, Moises J, Regl C, Schwap S, Rapp E, Huber CG, Schubert M. | 2022 | Unambiguous identification of α-Gal epitopes in intact monoclonal antibodies by NMR spectroscopy. The α-Gal epitope consisting of the terminal trisaccharide Galα1,3Galβ1,4GlcNAc exposed on cell or protein surfaces can cause severe immune reactions, such as hypersensitivity reactions, in humans. This epitope is also called the xenotransplantation epitope because it is one of the main reasons for the rejection of non-human organ transplants by the human innate immune response. Recombinant therapeutic proteins expressed in murine cell lines may contain α-Gal epitopes, and therefore their absence or presence needs to be tightly monitored to minimize any undesired adverse effects. The analytical identification of α-Gal epitopes in glycoproteins using the common standard techniques based on liquid chromatography and mass spectrometry is challenging, mainly due to the isobaricity of hexose stereoisomers. Here, we present a straightforward NMR approach to detect the presence of α-Gal in biotherapeutics based on a quick screen with sensitive 1H-1H TOCSY spectra followed by a confirmation using 1H-13C HSQC spectra. |
InmAbs 2022 Dec 31 (Vol. 14, No. 1, p. 2132977). Taylor & Francis. | pharmacy; pharmaceutical; biologic; monoclonal antibodies; chemical detection; NMR |
| Hodgeman N, Horn CL, Paredes A. | 2019 | An Unusual Mimicker of Irritable Bowel Disease: 1855. INTRODUCTION: Delayed anaphylactic reaction to red meat is a rare phenomenon that was first recognized during clinical trials for cetuximab. Through careful retrospective study of the patients afflicted, it was discovered there was a geographic overlap with the Amblyomma americanum tick, also known as the lone star tick. These patients were also found to have IgE antibodies to the peptide galactose-alpha-1,3-galactose (α-gal), commonly found in non-primate mammalian meat. Since the trials with cetuximab, allergic reactions to red meat has been documented in patients who have not been exposed to cetuximab, believed to be caused by the bite of the lone star tick. We present the case of a 46-year-old male who was evaluated for 6 months of progressive gastrointestinal symptoms and was ultimately found to have elevated α-gal IgE levels. CASE DESCRIPTION/METHODS: A 46-year-old male was evaluated for 6 months of progressive abdominal distress following consumption of red meat. He reported severe nausea, vomiting and diarrhea that persisted for hours after consumption of red meat. He had not experienced anaphylaxis, but had a 40 pound weight loss since symptom onset. He had recently moved to Texas from Maryland and denied any outdoor recreation, to include camping, hiking, or known tick bites. Initial work up was unrevealing for infectious or inflammatory cause of his symptoms, and cross-sectional imaging was noncontributory. EGD and colonoscopy were notable only for mild esophagitis and duodenitis. Due to concern for α-gal syndrome and at the prompting of the patient and his wife, total serum IgE and α-gal IgE were drawn, both noted to be elevated at 6215 IU/mL and 0.2 kU/L (ULN < 0.10 kU/L) respectively. A presumptive diagnosis of α-Gal syndrome was made and he was referred to nutrition for dietary counseling. Following removal of red meat from his diet, he reported his gastrointestinal symptoms had markedly improved. DISCUSSION: This case demonstrates the unique and uncommon condition known as α-gal syndrome. Our presentation’s presentation was not as dramatic as other documented cases, which likely led to a delay in his initial diagnosis. Diagnosis is made by first noting an elevated serum IgE. Specific α-gal IgE levels can then be drawn, which if elevated has high sensitivity and specificity for this syndrome. Improvement on a red meat restricted diet is ultimately diagnostic. As was seen in this case, improvement |
American Journal of Gastroenterology. 2019 Oct 1;114(2019 ACG Annual Meeting Abstracts):S1039. | diagnosis; differential; gastroenterology; IBD; symptoms; GI |
| Hodžić A, de la Fuente J, Cabezas-Cruz A. | 2020 | COVID-19 in the Developing World: Is the Immune Response to α-Gal an Overlooked Factor Mitigating the Severity of Infection? Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the causative agent of coronavirus disease 2019 (COVID-19), which has affected millions of people worldwide. Considerably lower prevalence and fatality rates resulting from COVID-19 are reported in Africa and Asia than in the industrialized world. In this Viewpoint, we discuss the possibility that this intriguing phenomenon could be, among other factors, due to protective immunity of the oligosaccharide galactose-α-1,3-galactose (α-Gal). The α-Gal immunity induced by gut microbiota that express the same glycan modification may prevent COVID-19 through the activation of different mechanisms involved in SARS-CoV-2 neutralization and the downregulation of the inflammatory response in the lungs of infected patients. |
ACS Infectious Diseases. 2020 Nov 12. | Hodzic; virus; coronavirus; Covid-19 |
| Hodžić A, Mateos-Hernández L, de la Fuente J, Cabezas-Cruz A. | 2019 | Delayed hypersensitivity reaction to mammalian galactose-alpha-1,3-galactose (alpha-gal) after repeated tick bites in a patient from France. The alpha-Gal syndrome is a tick-associated and emerging IgE-mediated hypersensitivity reaction directed against the carbohydrate Galalpha1-3Galbeta1-(3)4GlcNAc-R (alpha-Gal) epitope after red meat intake. Herein, we describe a clinical case of a 44-year-old French patient who suffered from recurrent anaphylactic reactions after mammalian meat consumption for five years before the final diagnosis of the alpha-Gal syndrome was established in 2018. The patient also reported multiple tick bites prior to symptom onset. This unique type of allergy has increasingly been reported across the world, but it is still unknown in many European countries. Therefore, the present clinical case should increase awareness among primary care practitioners and further improve the early diagnosis of the alpha-Gal syndrome in affected individuals. |
Ticks and tick-borne diseases. 2019 Aug 1;10(5):1057-9. | Hodzic Mateos-Hernandez |
| Hodžić A, Mateos-Hernández L, Fréalle E, Román-Carrasco P, Alberdi P, Pichavant M, Risco-Castillo V, Le Roux D, Vicogne J, Hemmer W, Auer H. | 2020 | Infection with Toxocara canis Inhibits the Production of IgE Antibodies to α-Gal in Humans: Towards a Conceptual Framework of the Hygiene Hypothesis?. α-Gal syndrome (AGS) is a type of anaphylactic reaction to mammalian meat characterized by an immunoglobulin (Ig)E immune response to the oligosaccharide α-Gal (Galα1-3Galβ1-4GlcNAc-R). Tick bites seems to be a prerequisite for the onset of the allergic disease in humans, but the implication of non-tick parasites in α-Gal sensitization has also been deliberated. In the present study, we therefore evaluated the capacity of helminths (Toxocara canis, Ascaris suum, Schistosoma mansoni), protozoa (Toxoplasma gondii), and parasitic fungi (Aspergillus fumigatus) to induce an immune response to α-Gal. For this, different developmental stages of the infectious agents were tested for the presence of α-Gal. Next, the potential correlation between immune responses to α-Gal and the parasite infections was investigated by testing sera collected from patients with AGS and those infected with the parasites. Our results showed that S. mansoni and A. fumigatus produce the terminal α-Gal moieties, but they were not able to induce the production of specific antibodies. By contrast, T. canis, A. suum and T. gondii lack the α-Gal epitope. Furthermore, the patients with T. canis infection had significantly decreased anti-α-Gal IgE levels when compared to the healthy controls, suggesting the potential role of this nematode parasite in suppressing the allergic response to the glycan molecule. This rather intriguing observation is discussed in the context of the 'hygiene hypothesis'. Taken together, our study provides new insights into the relationships between immune responses to α-Gal and parasitic infections. However, further investigations should be undertaken to identify T. canis components with potent immunomodulatory properties and to assess their potential to be used in immunotherapy and control of AGS. |
Vaccines. 2020 Jun;8(2):167. | Hodzic A; Mateos-Hernandez L; Frealle E; ectoparasites; endoparasites; |
| Hodžić A, Mateos-Hernández L, Leschnik M, Alberdi P, Rego RO, Contreras M, Villar M, De La Fuente J, Cabezas-Cruz A, Duscher GG | 2019 | Tick bites induce anti-α-Gal antibodies in dogs. Due to the functional inactivation of the gene encoding for the enzyme that is involved in the oligosaccharide galactose-alpha-1,3-galactose (alpha-Gal) synthesis, humans and Old-World primates are able to produce a large amount of antibodies against the glycan epitope. Apart from being involved in the hyperacute organ rejection in humans, anti-alpha-Gal antibodies have shown a protective effect against some pathogenic agents and an implication in the recently recognized tick-induced mammalian meat allergy. Conversely, non-primate mammals, including dogs, have the ability to synthetize alpha-Gal and, thus, their immune system is not expected to naturally generate the antibodies toward this self-antigen molecule. However, in the current study, we detected specific IgG, IgM, and IgE antibodies to alpha-Gal in sera of clinically healthy dogs by an indirect enzyme-linked immunosorbent assay (ELISA) for the first time. Furthermore, in a tick infestation experiment, we showed that bites of Ixodes ricinus induce the immune response to alpha-Gal in dogs and that the resulting antibodies (IgM) might be protective against Anaplasma phagocytophilum. These findings may help lead to a better understanding of the underlying mechanisms involved in mammalian meat allergy and tick-host-pathogen interactions, but they also open up the question about the possibility that dogs could develop an allergy to mammalian meat after tick bites, similar to that in humans. |
Vaccines. 2019 Sep;7(3):114. | Hodzic Mateos-Hernandez dogs |
| Holbert SE, Patel D, Rizk T, Dimitri NG, Jones M. | 2020 | Intraoperative Anaphylaxis in Response to Hemostatic Agents With Protein Derivatives. Topical hemostatic agents are commonly used in a wide variety of surgical procedures to assist in hemostasis. However, the use of these agents is not without risk as many contain biologically active agents derived from human and animal products that have the potential to cause adverse reactions. This case report covers a 44-year-old man with a history of alpha-gal syndrome who was scheduled for an open reduction and internal fixation of a left distal radius fracture. Alpha-gal syndrome is characterized by an IgE-mediated type 1 hypersensitivity reaction to a mammalian oligosaccharide epitope. Patients with this condition have a history of a past tick bite and subsequent development of an allergic reaction to mammalian protein products, most notably red meat. The patient had concerns about products used during surgery and potential reactions based on his allergy. The intent of this case report is to promote physician awareness of the widespread use of mammalian products in surgical hemostatic agents and potential immunogenic reactions. By increasing awareness of the alpha-gal syndrome, the goal is that medical device companies will actively disclose product components that could potentiate these adverse reactions and continue to develop alternative agents. |
Cureus. 2020 Aug;12(8). | Pharmaceutical; medical product; hemostatic agent; surgifoam; recothrom |
| Homann A, Schramm G, Jappe U. | 2017 | Glycans and glycan-specific IgE in clinical and molecular allergology: Sensitization, diagnostics, and clinical symptoms. Glycan-specific IgE antibodies cross-react with highly similar or even identical carbohydrate structures on a variety of different natural allergens, the so-called cross-reactive carbohydrate determinants (CCDs). In clinical practice CCDs often interfere with the specificity of in vitro allergy diagnostics, thus impairing allergy therapy decisions for individual patients. Strikingly, these IgE antibodies directed against CCDs often do not cause clinically relevant allergy symptoms. On the other hand, the IgE-binding glycan allergen galactose-alpha-(1,3)-galactose (alpha-Gal) is associated with IgE-mediated delayed anaphylaxis in meat allergy. The reason for this discrepancy is not known. The discovery of alpha-Gal stimulated new discussions and investigations regarding the relevance of anti-glycan IgE for allergic diseases. In this review the effect of glycans and glycan-specific IgE on sensitization to allergens and allergy diagnosis is described. Because parasite infections elicit a similar immunologic environment as allergic diseases, the association of glycan-specific antibodies against parasite glycoproteins with glycan structures on allergens is discussed. |
Journal of Allergy and Clinical Immunology. 2017 Aug 1;140(2):356-68. | review article |
| Hon KL, Chan IH, Chow CM, Wang SS, Lam CW, Ng PC, Leung TF. | 2011 | Specific IgE of common foods in Chinese children with eczema. Food atopy is important but inadequately studied among children with atopic dermatitis (AD). We evaluated whether any association existed between AD severity, quality of life, total IgE, eosinophil counts, and the number of food items sensitized. Specific IgE of ten common food items was measured for a group of consecutive AD patients (n = 85) enrolled during a randomized trial and correlated the findings with eczema severity. Twenty‐four patients (28%) were negative for any of the ten common food items. The most commonly sensitized foods were shrimp (54%), egg white (43%), wheat (42%), and peanut (41%). Atopy to beef as a protein and orange as a fruit were least common among the food items studied, even among patients positive for 8–9 IgE items. Patients with severe AD (objective SCORAD > 40) were more likely to be positive for at least one of the food items (Yates corrected p = 0.024 for ≥1 food‐specific IgE in severe vs. moderate AD, OR 3.42 and 95% CI 1.15–10.32); and for at least seven of the food items (p = 0.001 for ≥7 food‐specific IgE vs. nil with OR 11.67 and 95% CI 2.29–67.77), respectively. The Spearman coefficients between the number of positive food‐specific IgE and total SCORAD, objective SCORAD, area of AD involvement, Children’s Dermatology Life Quality Index (CDLQI), total IgE levels, and eosinophil counts were 0.42 (p < 0.001), 0.45 (p < 0.001), 0.50 (p < 0.001), 0.17 (p = 0.116), 0.80 (p < 0.001), and 0.22 (p = 0.043), respectively. Specific IgE levels for beef correlated with all the other food‐specific IgE levels, including cow’s milk (ρ = 0.061, p < 0.001) and soy (ρ = 0.70, p < 0.001). The number of common food items sensitized correlated with disease severity, extent, and total IgE levels. IgE sensitization to beef protein is unlikely in the majority of children with AD, but its serum IgE level is associated with disease severity and risk of sensitization to other foods. |
Pediatric allergy and immunology. 2011 Feb;22(1‐Part‐I):50-3. | Asia; China; pediatric; prevalence; dermatology; eczema |
| Honda Y, Yamamoto M, Nakajima K, Chinuki Y, Sano S. | 2015 | Delayed Anaphylaxis after Eating Beef Likely Due to IgE Antibody Specific for Galactose-a-1,3-galactose. A 67-year-old Japanese man experienced 4 episodes of delayed anaphylaxis between March, 2012 and October, 2013. Delayed anaphylactic attacks occurred several hours after eating egg-bearing flatfish or beef. The skin prick allergen test was positive for beef, pork, and cow's milk. Moreover, CAP-RAST testing revealed the presence of IgE antibodies specific to beef, pork, cow's milk, and dandruff of cat and dog. Western blotting analysis using the patient's sera showed a putative IgE with high affinity for the 50-kDa protein of the mouse chimeric antibody, cetuximab, which contains the oligosaccharide galactose-α-1, 3-galactose (α-gal), a common epitope for the delayed anaphylaxis response to beef meat. Since the patient lived in an area where Japanese spotted fever, for which a tick bites are a cause, is endemic, he might have a history of unnoticed tick bites that sensitized him to α-gal. Furthermore, we speculate that some medicines including aspirin might lower the threshold for exposure to this allergen above which anaphylactic symptoms occur. |
本田由美, 山本真有子, 中島喜美子, 千貫祐子, 佐野栄紀. 牛肉による遅発型アナフィラキシー. 西日本皮膚科. 2015 Oct 1;77(5):453-5. | Japan; fish; roe; flounder |
| Hong DI, Bankova L, Cahill KN, Kyin T, Castells MC, Maggi, Peck, Garai, Castells, Hanauer, Cheifetz. | 2012 | Allergy to monoclonal antibodies: cutting-edge desensitization methods for cutting-edge therapies. Monoclonal antibodies are important therapeutic tools, but their usefulness is limited in patients who experience acute infusion reactions, most of which are consistent with type I hypersensitivity reactions including anaphylaxis. Patients who experience acute infusion reactions face the prospect of stopping treatment or switching to an alternative, and potentially more toxic or inferior treatment. Another option that overcomes the treatment hurdle of these reactions is rapid desensitization, a procedure in which the offending agent is re-administered in a step-wise, highly controlled fashion. While the risk of reactions is not completely eliminated, desensitization has proven to be a highly effective re-administration strategy for most patients who otherwise would not be able to tolerate their monoclonal antibody therapy owing to drug-induced anaphylaxis. This article reviews the current literature on desensitization and other readministration protocols to monoclonal antibodies with an emphasis on four agents: rituximab, infliximab, cetuximab and trastuzumab. |
Expert review of clinical immunology. 2012 Jan 1;8(1):43-54. | mAb; monoclonal antibody; biologic; biological agent |
| Hopps S, Medina P, Pant S, Webb R, Moorman M, Borders E. | 2013 | Cetuximab hypersensitivity infusion reactions: Incidence and risk factors. INTRODUCTION: Cetuximab is a chimeric mouse-human (30:70) IgG1 monoclonal antibody that competitively inhibits the binding of epidermal growth factor. Cetuximab is generally well tolerated; however, hypersensitivity infusion reactions have been reported. The incidence at the University of Oklahoma was currently unknown, though anecdotally high. The purpose of this study was to determine the incidence of severe HIRs and secondarily to determine risk factors for cetuximab-induced hypersensitivity infusion reactions. METHODS AND RESULTS: A retrospective chart review was conducted and included all patients that received cetuximab from 2005 to 2010 at the outpatient clinics of the Oklahoma University Health Sciences Center. A total of 153 patients were included in the analysis. The overall incidence proportion of severe hypersensitivity infusion reactions was 12.4%. Male patients had an increased incidence of severe hypersensitivity infusion reactions compared to female patients (20.6% vs. 5%, p = 0.0036). Current smokers had an increased incidence of severe hypersensitivity infusion reactions of 23.6% when compared to never smokers or former smokers, p = 0.0012. Cervical cancer had a significantly decreased risk of severe hypersensitivity infusion reactions when compared to other tumor types (5.3% vs. 16.7%, p = 0.0387). Multivariate analysis identified risk factors associated with severe HIRs to be: male gender, RR = 3.9, p = 0.01 and current smokers, RR = 3.98, p = 0.0048. . CONCLUSION: Patients at the University of Oklahoma had an increased incidence of severe hypersensitivity infusion reactions when compared to the national average. Male patients and current smokers were found to be at increased risk for severe hypersensitivity infusion reactions in our study. Further investigation is warranted. |
Journal of Oncology Pharmacy Practice. 2013 Sep;19(3):222-7. | |
| Hosen J, Perzanowski M, Carter MC, Odhiambo J, Ngari P, Satinover S, Platts-Mills TA. | 2008 | IgE antibodies to helminths and the cross-reactive oligosaccharide galactose-alpha-1,3-galactose (alphaGal) among children in a village in Africa. Rationale: Recent reports have identified IgE antibodies to alphaGal as a cause of anaphylactic reactions to the mAb cetuximab. These IgE antibodies cross-react with proteins from cat, dog, beef and pork. Previous reports showed that children in Africa had IgE ab to cat allergens despite negative skin tests and no exposure to cats. We report here the connection between IgE ab to alphaGal, cat proteins and helminth parasites. Methods: Sera from children (age 9-11) in rural (Kabati) and urban (Thika) Kenya and Atlanta, GA were assayed for IgE ab to alphaGal, cat, mite, Ascaris and Echinococcus, using ImmunoCAP or the modified assay with biotinylated antigens bound to Streptavidin CAP. . Results: Of 130 sera tested from Kabati 100 were positive for alphaGal IgE (GM: 3.96 IU/mL). In Thika 36 out of 123 were positive, in Atlanta 0 out of 52 were. In Kabati 95 of 130 sera were positive for Ascaris and 75 were positive for Echinococcus. The correlation with IgE to alphaGal was much stronger for Echinococcus (r = 0.84; p < 0.001) than for Ascaris (r = 0.19; p = 0.05). There was a close correlation between IgE ab to cat and IgE to alphaGal (r = 0.86; p < 0.001). . Conclusions: IgE ab to alphaGal is widespread among children in an African village, less common in a small town and virtually non-existent among African American children in Atlanta. While the cause of sensitization is unclear, the correlation with Echinococcus suggests a tapeworm could be responsible. The correlation with IgE ab to alphaGal explains the previously enigmatic IgE ab to cat found in African sera. |
Journal of Allergy and Clinical Immunology. 2008 Feb 1;121(2):S140. | Africa; Kenya; helminths |
| Houchens N, Hartley S, Commins SP, Claar D, Saint S. | 2021 | Hunting for a Diagnosis A 47-year-old man presented to a Michigan emergency department in January with a 1-day history of presyncope, swelling of the eyelids, and a diffuse pruritic rash. He also reported a 3-week history of postprandial watery bowel movements, without blood. Beginning 5 days before presentation, he had noted diffuse crampy abdominal pain and nausea with occasional nonbloody emesis. |
New England Journal of Medicine. 2021 Feb 4;384(5):462-7. | diagnosis; GI variant; gastroenterology |
| Howanietz H, Lubec G. | 1985 | Idiopathic nephrotic syndrome, treated with steroids for five years, found to be allergic reaction to pork. No abstract available. |
The Lancet. 1985 Aug 24;326(8452):450. | Nephrology; nephrotic syndrome; kidney |
| Howell JL, Neaves B, Coop C. | 2024 | Alpha-Gal Syndrome in a Military Member. |
Cureus. 2024 Oct 21;16(10). | Military |
| Hsieh YH, Ofori JA. | 2011 | Blood-derived products for human consumption. Blood, the first by-product obtained after the slaughter of an animal, has long been used in European and Asian countries as an ingredient in traditional foods such as blood sausages, puddings, blood soups, breads and crackers (Mandal, Rao, Kowale, & Pal, 1999). For many years US slaughter houses used to discard blood as an unwanted by-product (Halliday, 1973) but its high nutritional value, coupled with serious disposal issues, has fueled recent research and industrial efforts to incorporate blood proteins into a wide range of food products. Commercial blood products, either from plasma or the cellular fraction of blood including whole blood, serve particular functions in different products. Although they are mainly used in meat products, primarily to increase protein levels and enhance water binding and emulsifying capacity (Mandal, et al., 1999), advances in food technology mean that blood derived products are beginning to be found as ingredients in non-meat processed food and dietary supplements. Consumers are often unaware that some of these products are now being used in sectors of the food industry that hitherto did not use blood ingredients, with these often being declared on the label merely by their brand name or the name of the protein. This is a serious issue for Jews and Muslims, who are forbidden to eat anything derived from blood as a result of the dietary restrictions imposed by their religions, as well as others who avoid blood-tainted food or any product of animal origin due to ethical, cultural, or health reasons, or simple personal preference. Regulatory guidance in the proper labeling of these products is now crucial to protect consumers and the development of effective analytical methods for the detection of hidden ingredients derived from blood in food products is thus urgently needed. |
Revelation and Science. 2011;1(01). | Food; byproduct; ingredient; blood |
| Huai G, Qi P, Yang H, Wang Y. | 2016 | Characteristics of a-Gal epitope, anti-Gal antibody, a1,3 galactosyltransferase and its clinical exploitation (Review). The α-Gal epitope (Galα1,3Galα1,4GlcNAc‑R) is ubiquitously presented in non-primate mammals, marsupials and New World Monkeys, but it is absent in humans, apes and Old World monkeys. However, the anti-Gal antibody (~1% of immunoglobulins) is naturally generated in human, and is found as the immunoglobulin G (IgG), IgM and IgA isotypes. Owing to the specific binding of the anti‑Gal antibody with the α‑Gal epitope, humans have a distinct anti‑α‑gal reactivity, which is responsible for hyperacute rejection of organs transplanted from α‑gal donors. In addition, the α1,3 galactosyltransferases (α1,3GT) can catalyze the synthesis of the α‑Gal epitope. Therefore, the α1,3GT gene, which encodes the α1,3GT, is developed profoundly. The distributions of the α‑Gal epitope and anti‑Gal antibody, and the activation of α1,3GT, reveal that the enzyme of α1,3GT in ancestral primates is ineffective. Comparison of the nucleotide sequence of the human α1,3‑GT pseudogene to the corresponding different species sequence, and according to the evolutionary tree of different species, the results of evolutionary inactivation of the α1,3GT gene in ancestral primates attribute to the mutations under a stronger selective pressure. However, on the basis of the structure, the mechanism and the specificity of the α‑Gal epitope and anti‑Gal antibody, they can be applied to clinical exploitation. Knocking out the α1,3GT gene will eliminate the xenoantigen, Gal(α1,3)Gal, so that the transplantation of α1,3GT gene knockout pig organ into human becomes a potential clinically acceptable treatment for solving the problem of organ shortage. By contrast, the α‑Gal epitope expressed through the application of chemical, biochemical and genetic engineering can be exploited for the clinical use. Targeting anti‑Gal‑mediated autologous tumor vaccines, which express α‑Gal epitope to antigen‑presenting cells, would increase their immunogenicity and elicit an immune response, which will be potent enough to eradicate the residual tumor cells. For tumor vaccines, the way of increasing immunogenicity of certain viral vaccines, including flu vaccines and human immunodeficiency virus vaccines, can also be used in the elderly. Recently, α‑Gal epitope nanoparticles have been applied to accelerate wound healing and further directions on regeneration of internally injured tissues. |
International Journal of Molecular Medicine. 2016 Jan 1;37(1):11-20. | |
| Huang Z, Zhu H, Lin R, Wu L, An N, Zheng P, Sun B. | 2021 | Serum Albumin as a Cross-Reactive Component in Furry Animals May Be Related to the Allergic Symptoms of Patients with Rhinitis. Background: The prevalence of allergies has increased significantly in the past decade. Further research on allergic diseases caused by furry animals is of great importance for the clinical prevention, diagnosis and treatment of allergies. Objective: To identify the sensitization profile and clinical association of various furry animal crude extracts and components based on component resolved diagnosis (CRD). Methods: A total of 211 patients with allergic rhinitis with sensitivities to cats and/or dogs were recruited, and the specific immunoglobulin E (sIgE) against various furry animals (such as dog/cat extracts and their components, pigeon, parrot, duck, chicken, sheep, rat, mouse, goose, cow and horse extracts) were measured to analyze the sensitization profiles, crossreactivity and clinical relevance with regards to allergies. Results: A total of 91.67% of cat-sensitized patients were sensitive to Fel d 1, while only 16.03% of cat-sensitized patients responded to Fel d 2. Can f 1 and Can f 5 were the major components of dogs, and the positive rates were 23.53% and 16.18%, respectively. Twenty percent of patients were sensitized to 10 other furry animals, and the positive rate was between 0% and 19.12%. There was a significant correlation between components (Can f 1–5 and Fel d 2) and 5 furry animals (mouse, sheep, Horse, rat, cow), especially between serum albumin (SA) (Can f 3, Fel d 2) and furry animals. Most of the animal crude extracts and components sensitization rates in patients who were SA-positive were significantly higher than that of patients who were SA-negative. In particular, for sensitization to mice, sheep, horses, rats and cows, more than 10-fold higher in patients who were SA-positive than in patients who were SA-negative. The VAS of symptoms and life of quality (LoQ) in the SA-sensitized patients was higher than that in unsensitized patients, and the patients with lipocalin sensitivities had a worse LoQ. Conclusion: Serum albumin Fel d 2 and Can f 3, as minor allergens in cats and dogs, but not lipocalin or prostatic kallikrein, is associated with other furry animals presumably due to serum albumin cross-reactivity. Patients sensitized with serum albumin had a significantly higher risk of sensitization to other animals and had a higher rhinitis VAS score. |
Journal of Asthma and Allergy. 2021;14:1231. | |
| Hudey S, Glaum M. | 2021 | M238 A RARE CASE OF ALPHA (A)-GAL SYNDROME DUE TO BISON MEAT. |
Annals of Allergy, Asthma & Immunology. 2021 Nov 1;127(5):S116. | Bison; Tampa, Florida |
| Huvier AD, Tetart F, Bauvin, O, Martinet J, Joly P. | 2018 | Recurring acute urticaria and abdominal pain: Consider a diagnosis of alpha-galactose anaphylaxis. BACKGROUND: Food urticaria is common and generally benign, and it may be of viral or idiopathic aetiology. A food origin of the allergy is frequently sought but rarely found. Mammalian meat anaphylaxis, or alpha-galactose (alpha-gal) anaphylaxis, is a rare and recently discovered entity. PATIENTS AND METHODS: Herein, we report a case of alpha-galactose (alpha-gal) anaphylaxis in a 60-year-old woman presenting four episodes of acute urticaria with signs of anaphylaxis occurring a few hours after meals containing mammalian meat (beef meat, pork meat and offal). The diagnosis was confirmed by a positive gelatine prick-test and the presence of alpha-gal IgE. DISCUSSION: In the event of acute urticaria associated with systemic symptoms, in particular gastrointestinal signs, allergy to alpha-galactose should be considered. |
Annales de Dermatologie et de Vénéréologie. 2018 Nov 1; 145(11): 690-693. | Recurrent urticaria; dermatology |
| Iglesia EG, Kwan M, Virkud YV, Iweala OI. | 2024 | Management of Food Allergies and Food-Related Anaphylaxis. |
JAMA. 2024 Feb 13;331(6):510-21. | |
| Iglesia EG, Stone C, Commins SP. | 2019 | Regional and Temporal Patterns of Alpha-Gal Allergy Using Google Trends. RATIONALE: An increasing number of cases of alpha-gal allergy (AGA) have been reported in the U.S. and in several parts of the world over the past decade. In the U.S., cases of AGA are most often reported in the southeastern region, overlapping with the distribution of the Lone Star tick. However, epidemiological and time trend studies on AGA are lacking. METHODS: Using Google Trends (GT), a web-based surveillance tool that captures data on search engine terms, time and geographic trends were explored from January 2004 - August 2018 for the following queries: alpha-gal allergy (topic), alpha gal (search term), alpha-gal (search term), red meat allergy (search term), and meat allergy (search term). For each query, search interest over time and search interest by country and subregion of the U.S. were quantified according to relative search volume (RSV). RESULTS: Search interest for all AGA queries have increased since 2012. There is interest in alpha-gal allergy (topic) in 47 out of 50 U.S. states, with the highest RSV in Arkansas, Kentucky, Tennessee, North Carolina, and Virginia. There is also interest in AGA on 6 continents, with Sweden, the U.S., Australia, Canada, and South Africa having the highest RSV among countries. CONCLUSIONS: By GTanalysis, there is widespread awareness of AGA in the U.S. and search interest in AGA continues to increase. The countries and subregions with the highest GT RSV coincide with the highest reported rates of AGA. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB161. | |
| Inam M, Shafique RH, Roohi N, Irfan M, Abbas S, Ismail M. | 2016 | Prevalence of sensitization to food allergens and challenge proven food allergy in patients visiting allergy centers in Rawalpindi and Islamabad, Pakistan. In this study, we estimated the prevalence of food allergy in the adult allergic patients of Rawalpindi and Islamabad , Pakistan, based on self-report, skin prick test (SPT) and oral food challenge test (OFC). SPT was used for the estimation of sensitization to wheat, egg, milk, beef, chicken, mutton, fish, corn, lentils, rice, soya, peanut and banana. Among 689 patients, 39.19 % showed sensitivity to one or more foods, where, sensitization to wheat (156; 22.6 %) was highest, followed by egg (148; 21.48 %) and milk (138; 20.03 %). Sensitization to various proteins ranged between 15.53–15.97 %, while lentils, corn, rice, soya and peanut sensitization was 15.4, 16, 12.5, 12 and 11.5 % respectively. Only 7.1 % patients were SPT positive for banana allergen. SPT was performed in patients with self-reported food allergy (341/689) and also with no self-reported history of food allergy (348/689). SPT results were positive in 69.8 % of the self-report group, whereas, in the patients with no self-reported food allergy 9.2 % were found sensitized to one or more tested food allergens. 101 patients were recruited for OFC, 61 % of these were confirmed of food allergy. The prevalence of food allergy in the study population was 9 %. Food specific OFC results show that wheat allergy is affecting 1.6 % (95 % CI 0.9–2.84 %) of the total allergy patients, followed by egg allergy 1.31 % (95 % CI 0.70–2.47 %). Furthermore, corn allergy, rice allergy and peanut allergy were 1.02, 0.87 and 0.73 %, respectively. In conclusion, wheat allergy is the most prevalent, followed by egg, chicken, beef and fish allergy, respectively. |
SpringerPlus. 2016 Dec 1;5(1):1330. | |
| Ionova Y, Wilson L. | 2020 | Biologic excipients: Importance of clinical awareness of inactive ingredients Due to the complexity and fragility of biological drug products, several challenges exist in their formulation development. Excipients are added to increase product stability, maintain tonicity, and facilitate drug delivery. The potential implications of these additive substances merit clinical consideration. We assessed the safety risk of excipients on the basis of their type and variability through an assessment framework, which quantifies excipient complexity in 230 biological formulations, and identifies excipient-related adverse events through published case reports. A biologic on average contained 4.45 excipients, half of that found in oral medications. The frequency distribution was heavily skewed towards the most commonly occurring excipients: water (40.4%), sodium chloride (38.3%), polysorbate 80 (28.7%), sucrose (24.4%), and mannitol (20.9%), with 44.4% of formulations not listing the concentration of the most commonly occurring inactive ingredients. A literature search revealed only 17 case reports of excipient-related adverse events, suggesting the need for more clarity for clinicians on the safety of chemical additives. These cases included injection site reactions, anaphylaxis, hyperglycemia, and acute renal failure. With the expansion of the biopharmaceutical market, it is important to consider the safety data of biologic excipients, so that therapy can be tailored appropriately for a specific patient. |
PloS one. 2020 Jun 25;15(6):e0235076. | biologics; mAb; monoclonal antibody; biological agent; inactive ingredients; gelatin |
| Irfan M, Bakhsh M, Ghazali MH, Maqsood A, Alsayeqh A, Imran M, Javed HS, Kauser S. | 2023 | Tick bites and red meat allergy. |
One Health Triad, Unique Scientific Publishers, Faisalabad, Pakistan. 2023;3:39-44. | Asia; Pakistan |
| Iwamoto T, Okamoto A, Ishinaga H, Shimizu K, Gayle AA, Arai N, Takeuchi K, Okuda M. | 2016 | A novel approach to predict cetuximab-induced hypersensitivity reaction: detection of drug-specific IgE on basophils. Cetuximab is remarkable for the relatively high rate and severity of hypersensitivity reactions (HR) being reported in the literature. Screening for cetuximab-specific IgE in serum via immunoassay has been found to be useful in preventing HR; however, these tests are known to have a low positive predictive rate. In an attempt to remedy this, we evaluated the interaction between cetuximab and IgE on basophils for predicting severe cetuximab-induced HR. Twelve head and neck cancer patients were enrolled in this single-institution study: four with a history of cetuximab-induced HR and eight with no such history. Cetuximab-specific and galactose-alpha-1,3-galactose (alpha-gal) specific IgEs in serum were measured in vitro using an enzyme-linked immunosorbent assay (ELISA). IgE-cetuximab binding on basophils was also analyzed to evaluate the decrease in cetuximab molecules on basophils after dissociation of IgE from FcepsilonRI. The positive predictive value associated with the presence of cetuximab- or alpha-gal-specific IgE in serum was found to be only 0.67, whereas the negative predictive value was 1.00. On the other hand, in all four patients who developed HR, the cetuximab molecules on basophils were decreased significantly due to the dissociation of IgE from basophils (P < 0.05). However, this was not the case in patients who did not develop HR. In conclusion, our results strongly imply that the IgE-cetuximab interaction on basophils may be key to developing improved methods for predicting severe cetuximab-induced HR. |
Cancer medicine. 2016 Jun;5(6):1004-12. | |
| Iweala O, Brennan PJ, Commins SP. | 2017 | Serum IgE Specific for Alpha-Gal Sugar Moiety Can Bind Glycolipid. RATIONALE: Alpha-gal meat allergy, characterized by anaphylaxis to mammalian meats like beef, pork or lamb three or more hours after consumption, has been associated with specific IgE (sIgE) antibodies against the sugar moiety galactose-alpha-1,3-galactose (alpha-gal) lining the surface of non-primate mammalian tissues. Meat fat content appears to impact reaction severity in alpha-gal-allergic patients. Because antigenic lipids are presented in complex with CD1 antigen-presenting molecules, we hypothesized that delayed anaphylaxis in alpha-gal allergy may be explained by alpha-gal sIgE binding to glycolipids complexed with CD1, since CD1-based presentation of glycolipids requires additional time for assembly and loading. Because CD1d presents the canonical invariant NK T cell glycolipid agonist alpha-galactosylceramide, a molecule structurally similar to alpha-gal, we measured sIgE-binding to this isoform. METHODS: Sera from alpha-gal allergic subjects containing alpha-gal sIgE (n55) were incubated with biotinylated human CD1d monomers unloaded or loaded with either alpha-gal containing glycosphingolipid isogloboside 3 (iGb3) or galactose-alpha-1,4-containing globotriaosylceramide (GB3) coupled with streptavidin attached to the solid phase of a sandwich immunoassay. . RESULTS: CD1d monomers loaded with alpha-gal containing iGB3 bound IgE (2.6 6 0.7 IU/mL) whereas unloaded CD1d did not. Less IgE binding (0.49 6 0.2 IU/mL) was present in GB3 loaded monomers. In contrast, serum from a subject without alpha-gal sIgE was negative for iGB3 and GB3 binding. . CONCLUSIONS: Alpha-gal sIgE from mammalian meat-allergic subjects binds glycolipid complexed with human CD1d and does so with increased specificity to glycolipids containing the alpha-1,3 linkage. Thus, antigen presentation of dietary lipid through CD1 molecules may represent a mechanism of delayed food allergy. |
Journal of Allergy and Clinical Immunology. 2017 Feb 1;139(2):AB88. | |
| Iweala O, Fereydouni M, Motaghed M, Choudhary S, Kapita C, Commins S, Kepley C. | 2020 | Alpha-gal Induced Mediator Release by Human Mast Cells. RATIONALE: Alpha-gal syndrome, typically characterized by delayed allergic reactions to mammalian meat, is associated with IgE to galactosealpha-1,3-galactose (alpha-gal), a carbohydrate moiety found in nonprimate mammals. Greater than 90% of alpha-gal allergic patients report urticaria following ingestion of alpha-gal. However, no one has demonstrated that alpha-gal-containing compounds can activate human mast cells sensitized with alpha-gal-specific IgE. METHODS: Primary human skin and lung mast cells were sensitized overnight with human plasma containing alpha-gal-specific IgE ranging from 0.1 to 58 IU/ml. The next day, cells were washed and challenged with anti-FcEpsilonRI antibodies, beef thyroglobulin (BTG), or cetuximab for 30 minutes. Mast cell mediators released into cell culture supernatants were measured. . RESULTS: Alpha-gal-containing compounds, including BTG and cetuximab, induced mediator release from skin, but not lung, mast cells. The extent of skin mast cell degranulation and cytokine production correlated with plasma alpha-gal-specific IgE levels. . CONCLUSIONS: Alpha-gal-containing compounds activate primary skin-derived human mast cells sensitized with plasma from alpha-gal allergic subjects, resulting in mast cell degranulation and cytokine production. Notably, lung-derived human mast cells sensitized with alpha-gal allergic plasma do not respond to challenge with the doses of |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB187. | |
| Iweala OI, Burks AW. | 2016 | Food Allergy: Our Evolving Understanding of Its Pathogenesis, Prevention, and Treatment. Food allergy is defined as an IgE-mediated hypersensitivity response to ingested food with allergic symptoms ranging from urticaria to life-threatening anaphylaxis. Food allergy is thought to develop because of (1) failed induction of tolerance upon initial exposure to food antigen or (2) breakdown of established tolerance to food antigen. We review current understanding of the pathogenesis, epidemiology, and natural history of food allergy, including the unconventional IgE-mediated food allergy to mammalian meat known as alpha-gal food allergy. We highlight emerging data on food allergy treatment and prevention, emphasizing the growing appeal of manipulating the gut microenvironment using probiotics and helminth products to blunt systemic allergic responses to food. |
Current allergy and asthma reports. 2016 May 1;16(5):37. | |
| Iweala OI, Choudhary SK, Addison CT, Batty CJ, Kapita CM, Amelio C, Schuyler AJ, Deng S, Bachelder EM, Ainslie KM, Savage PB | 2020 | Glycolipid-mediated basophil activation in alpha-gal allergy. Letter to the editor: ...Allergic reactions to alpha-gal may not occur with every allergen exposure. This variability depends on the amount of allergen ingested and the biologic macromolecules within the alpha-gal–containing food. During food challenges, we found that lipid-rich mammalian meats were associated with more consistent, severe reactions.2 Thus, we hypothesized that glycolipid could activate allergic effector cells in alpha-gal allergy. A role for lipids in enhancing allergenic potency has been described in peach3 and cow’s milk allergies.4 We now demonstrate that alpha-gal sIgE binds mammalian glycolipids and that alpha-gal–containing glycolipids can activate basophils sensitized with alpha-gal sIgE, highlighting a potential role for glycolipid in alpha-gal meat allergy. ...To our knowledge, this is the first demonstration that mammalian glycolipid can activate allergic effector cells via surface-bound sIgE. Given the delayed onset of a reaction after ingestion of mammalian meat in individuals with alpha-gal allergy, perhaps failure of the antigen to appear rapidly in the circulation or packaging of immunogenic lipids with plasma proteins or CD1d glycolipid antigen-presenting molecules delays allergic effector cell activation, which possibly explains the delay in allergic symptoms. These results suggest a unique role for glycolipid that has been rarely described in IgE-mediated food allergy. |
Journal of Allergy and Clinical Immunology. 2020 Feb 20. | |
| Iweala OI, Choudhary SK, Addison CT, Commins SP | 2021 | T and B Lymphocyte Transcriptional States Differentiate between Sensitized and Unsensitized Individuals in Alpha-Gal Syndrome. The mechanisms of pathogenesis driving alpha-gal syndrome (AGS) are not fully understood. Differences in immune gene expression between AGS individuals and non-allergic controls may illuminate molecular pathways and targets critical for AGS development. We performed immune expression profiling with RNA from the peripheral blood mononuclear cells (PBMCs) of seven controls, 15 AGS participants, and two participants sensitized but not allergic to alpha-gal using the NanoString nCounter PanCancer immune profiling panel, which includes 770 genes from 14 different cell types. The top differentially expressed genes (DEG) between AGS subjects and controls included transcription factors regulating immune gene expression, such as the NFκB pathway (NFKBIA, NFKB2, REL), antigen presentation molecules, type 2/allergic immune responses, itch, and allergic dermatitis. The differential expression of genes linked to T and B cell function was also identified, including transcription factor BCL-6, markers of antigen experience (CD44) and memory (CD27), chemokine receptors (CXCR3, CXCR6), and regulators of B-cell proliferation, cell cycle entry and immunoglobulin production (CD70). The PBMCs from AGS subjects also had increased TNF and IFN-gamma mRNA expression compared to controls. AGS is associated with a distinct gene expression profile in circulating PBMCs. DEGs related to antigen presentation, antigen-experienced T-cells, and type 2 immune responses may promote the development of alpha-gal specific IgE and the maintenance of AGS |
International journal of molecular sciences. 2021 Jan;22(6):3185. | Pathogenesis; genetics; T cell; B cell |
| Iweala OI, Hardy LC, Choudhary S, Hsing-Hui W, Addison CT, Milind N, Orgel KA, Kulis MD, Urban JF, Nagler CR, Burks AW. | 2019 | Epigenetic Dysfunction in T cells is Associated with Enhanced Type-2 and Blunted Regulatory Immunity. RATIONALE: Epigenetic alterations partly mediated by histone H3 lysine 27 (H3K27) demethylase UTX are critical for humoral and cellular immunity against chronic viral infections. Whether UTX-modulated epigenetic changes impact type 2 immunity in allergic sensitization and type 2/regulatory immunity associated with chronic helminth infection is unclear. METHODS: We used mice with UTX-deficient T cells (UTX-TCD) to assess whether T cell-specific UTX expression affects 1) IgE production following subcutaneous sensitization to galactose-alpha-1,3-galactose (alpha-gal) and 2) the immunosuppressive effects of preexisting intestinal helminth infection on antibody responses to intramuscular vaccination. We sensitized wildtype (WT) C57Bl/6J or UTX-TCD mice 3 times at 1 to 2- week intervals with 50 micrograms of lone star tick (Amblyomma americanum)-derived salivary gland extract (TSGE). We examined polyclonal and antigen-specific IgE and CD4+ T cell responses 2 weeks after the last subcutaneous injection. In separate experiments, WT and UTX-TCD mice were infected or not with the mouse intestinal parasitic nematode Heligmosomoides polygyrus bakeri and vaccinated intramuscularly twice at 1-week intervals with chicken-egg ovalbumin adsorbed to alum (OVA-alum). Polyclonal and antigen-specific IgE and IgG1 responses were assessed. . RESULTS: Without UTX expression in T cells, TSGE injection enhanced polyclonal IgE production and CD4+ IL4+ Th2 cell frequency despite reduced CD4+ T cell frequency. Polyclonal IgE production was preserved during chronic intestinal helminth infection, but Th2-skewed OVA-specific IgG1 responses to OVA-alum vaccination were not significantly reduced. . CONCLUSIONS: Our results suggest that epigenetic factors like UTX in T cells may regulate cellular and humoral immunity associated with type 2 and immunoregulatory responses during allergic sensitization and helminth infection |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB205. | |
| Iweala OI, Savage PB, Commins SP. | 2018 | A Role for CD1d-restricted Invariant Natural Killer T Cells and Glycolipids in Alpha-Gal Allergy. RATIONALE: Alpha-gal meat allergy is associated with IgE-mediated sensitization to galactose-alpha-1,3-galactose (alpha-gal), a carbohydrate moiety found in non-primate mammals. Lipid content of consumed meat drives reaction severity, suggesting that mammalian meat-derived glycolipids containing alpha-gal may act as immunogens. Immunogenic lipids complexed to CD1d antigen-presenting molecules activate iNKT cells. We have shown that alpha-gal-specific IgE binds mammalian glycosphingolipids complexed with CD1d. Thus, we hypothesized that iNKT cells and CD1d-mediated presentation of glycolipid are involved in the pathogenesis of alpha-gal allergy. METHODS: PBMCs from alpha-gal allergic subjects and controls were stained with fluorochrome-labeled human CD1d tetramers bound to PBS57 (analog of canonical iNKT cell immunogen alpha-galactosylceramide) and antibodies against CD3 and the activation marker CD69. In separate experiments, basophils from a control subject were stripped of IgE; primed with plasma from subjects with and without alpha-gal allergy; stimulated with glycolipids PBS-112 (contains galactose-alpha-1,4-galactose) or PBS-113 (contains alpha-gal); and stained with fluorochrome-labeled antibodies against basophil marker CD123 and activation markers CD63 and CD203c. RESULTS: PBMCs from subjects with alpha-gal allergy (n58) contained double the frequency of activated CD69+ iNKT cells than control PBMCs (n55). The frequency of activated CD203c+CD63+ basophils among PBMCs stimulated with IL-3 and PBS-113 increased 9-fold when PBMCs were sensitized with plasma from alpha-gal-allergic versus control subjects. CONCLUSIONS: Alpha-gal-containing glycolipids robustly activated basophils sensitized with alpha-gal sIgE compared to glycolipid without alpha-gal. Circulating activated CD1d-restricted iNKT cells were present at higher frequencies in alpha-gal allergic subjects than controls, suggesting unique roles for iNKT cells and glycolipid rarely described in IgEmediated food allergy. |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB288. | |
| Iweala OI. | 2023 | α-Gal Syndrome: Busting Paradigms in Food Allergy |
Annals of Internal Medicine: Clinical Cases. 2023 Jun 20;2(6):e230578. | |
| Jackson WL. | 2018 | Mammalian meat allergy following a tick bite: a case report. The alpha-gal allergy is an emerging IgE-mediated reaction against the galactose-alpha-1,3-galactose carbohydrate found in mammalian meats. Patients with this condition will develop anaphylactic symptoms 3-6 h after the ingestion of mammalian meat food products such as beef, pork or lamb. The prevalence of this allergy is drastically increasing and severe reactions including anaphylactic shock have been reported, yet many patients experience symptoms for years before a diagnosis is made. We describe the presentation, diagnosis and management of a patient with the alpha-gal allergy in attempt to improve early recognition and management of patients with this condition. |
Oxford medical case reports. 2018 Feb;2018(2):omx098. | |
| Jacquenet S, Moneret-Vautrin DA, Bihain BE. | 2009 | Mammalian meat-induced anaphylaxis: clinical relevance of anti-galactose-alpha-1,3-galactose IgE confirmed by means of skin tests to cetuximab. Letter to the Editor. Severe anaphylaxis is often associated with food allergy. Classically, the diagnosis of food allergy is established through a careful evaluation of a patient’s allergy history, including skin tests and in vitro tests. If the specific trigger cannot be established, then the patient might be diagnosed with idiopathic anaphylaxis, which is a major concern for both the patient and the physician. Some of these cases are due to rare food allergies.1 Recently, a new specific IgE to galactose-a-1,3-galactose (a-gal) was shown to be linked with anaphylaxis or angioedema reactions to mammalian meats.2,3 The present study reports on 2 cases of anaphylaxis to mammalian meats, which were evaluated by using an in-house a-gal IgE immunoassay4 and novel intradermal tests (IDTs) to cetuximab. Cetuximab is an mAb presenting the a-gal oligosaccharide in the Fab portion of the heavy chain. |
Journal of Allergy and Clinical Immunology. 2009 Sep 1;124(3):603. | |
| Jacquenet S. | 2016 | Alpha-gal, from invertebrate to vertebrate. No abstract available |
Frontiers in Immunology. 2019;10:1996. | |
| Jaison PL, Kannan VM, Geetha M, Appukuttan PS. | 1993 | Epitopes recognized by serum anti-α-galactoside antibody are present on brain glycoproteins in man. |
Journal of biosciences. 1993 Jun;18(2):187-93. | Brain |
| James H, Commins S, Hosen J, Cooper P, Kocan K, Platts-Mills T. | 2010 | Tick Bites From Amblyomma Americanum As A Major Cause Of Ige Antibodies Specific To Galactose-alpha-1,3-galactose. RATIONALE: The high prevalence of IgE to galactose-a-1,3-galactose (alpha-gal) in Virginia, North Carolina, Tennessee, Arkansas, Oklahoma, and Missouri correlates with an area where tick bites are common. METHODS: Using a modified ImmunoCAP assay, we measured IgE to biotinylated proteins from two tick species, A. americanum and D. variabilis. Sera were obtained from three subjects who had experienced extensive tick bites, 100 subjects who presented with delayed anaphylaxis to red meat and were found to have IgE to alpha-gal, and from 60 children living in rural Ecuador. Ticks for extracts were obtained from OSU Tick Rearing Facility. . RESULTS: Two of the three subjects who developed IgE to alpha-gal also developed IgE to A. americanum, the species responsible for the bites. Among the 100 alpha-gal positive subjects, 93% reported a recent episode of tick bites and 60% had detectable IgE to A. americanum. Only 15% had detectable IgE to D. variabilis. In Virginia, serum titers of tick IgE have been observed up to 11 IU/ml. In a cohort of children from rural Ecuador, higher titer IgE to tick has been observed (38.5 IU/ml). Although the presence of IgE to tick correlates closely with IgE to alpha-gal, there was only a weak quantitative correlation (r 5 0.234, p 5 0.014). Absorption experiments confirmed that the IgE to tick antigens cannot be explained by IgE to alpha-gal. . CONCLUSION: The evidence strongly suggests that ticks, primarily A. americanum, are an important cause of IgE antibodies to alpha-gal and can also induce IgE to tick protein. |
Journal of Allergy and Clinical Immunology. 2010 Feb 1;125(2):AB28. | |
| James H, Commins S, Hosen J, Cooper P, Kocan K, Platts-Mills T. | 2018 | Meat allergy associated with galactosyl‐α‐(1,3)‐galactose (α‐Gal)—Closing diagnostic gaps by anti‐α‐Gal IgE immune profiling Background: Glycoproteins and glycolipids of some mammalian species contain the disaccharide galactosyl--(1,3)-galactose (-Gal). It is known that -Gal is immunogenic in humans and causes glycan-specific IgG and also IgE responses with clinical relevance. -Gal is part of the IgE-reactive monoclonal therapeutic antibody cetuximab (CTX) and is associated with delayed anaphylaxis to red meat. In this study, different -Gal-containing analytes are examined in singleplex and multiplex assays to resolve individual sensitization patterns with IgE against -Gal. Methods: Three serum groups, -Gal-associated meat allergy (MA) patients, idiopathic anaphylaxis (IA) patients with suspected MA, and non-meat-allergic healthy control individuals (HC), were analyzed via singleplex allergy diagnostics and a newly established immunoblot diagnostic system. The new dot blot detection system resolved individual IgE sensitization profiles for -Gal-containing analytes CTX, bovine thyroglobulin (Bos d TG), and human serum albumin (HSA)-conjugated -Gal. Results: Singleplex allergy diagnostics using the -Gal analytes CTX and Bos d TG confirms the history of MA patients in 91% and 88% of the cases, respectively. A novel dot blot-based assay system for the detection of IgE against -Gal reveals individual IgE sensitization profiles for -Gal-containing analytes. An -Gal-associated IgE cross-reactivity profile (IgE against CTX, Bos d TG, and HSA--Gal) was identified, which is associated with MA. Conclusions: Detection of individual sensitization patterns with different -Gal-containing analytes provides the basis for an individual allergy diagnosis for -Gal-sensitized patients. Higher amounts of -Gal in pork and beef innards compared to muscle meat as indicated by a higher staining intensity are a plausible explanation for the difference in allergic symptom severity. |
Allergy. 2018 Jan;73(1):93-105. | idiopathic anaphylaxis; testing; immunoblot |
| James H, Kennedy JL, Platts-Mills T, Stallings AP, Workman LJ, Tripathi A, Pochan S, Lane C, Matos LA, Eapen SS, McBride DC. | 2013 | Pediatric Alpha-Gal: IgE Antibodies to Galactose-Alpha-1,3-Galactose in Children Presenting with Delayed Urticaria or Anaphylaxis. RATIONALE: Chronic urticaria, recurrent acute urticaria, and idiopathic anaphylaxis in children commonly present without a cause. Recent research established IgE to galactose-alpha-1,3-galactose (alpha-gal) as an important cause of delayed urticaria and anaphylaxis in adults living in the southeastern United States. We posited that a similar disease could be present in children with delayed urticaria and anaphylaxis in a similar geographical distribution. METHODS: Children with a history of delayed urticaria or anaphylaxis after consuming mammalian meat were enrolled at the University of Virginia and two private practice clinics in Lynchburg, Virginia. Serum was assayed for total IgE and specific IgE to alpha-gal, beef, pork, lamb, milk, dog, cat dander, Fel d 1, and cat albumin. RESULTS: Forty-five children with IgE antibodies specific for alpha-gal and history of recurrent idiopathic urticaria or anaphylaxis were identified. All subjects reported tick bites and 39/45 had experienced persistent pruritis and erythema at the site of the bite. Titers of IgE to cat, dog, pork, beef, and milk were positive in most subjects and were significantly correlated with IgE to alpha-gal (p<0.001). Additionally, although 32/45 children had IgE specific for both cat and dog, only 9/32 reported rhinitis symptoms upon exposure to these animals. Although a majority reported urticaria (92%), many subjects also reported anaphylaxis (44%). CONCLUSIONS: Delayed anaphylaxis or urticaria following consumption of mammalian meat has been found in children with IgE antibodies specific for alpha-gal. Diagnosis by skin testing is difficult, but alpha-gal should be considered in children with recurrent idiopathic urticaria living in the southeastern United States |
Journal of Allergy and Clinical Immunology. 2013 Feb 1;131(2):AB217. | |
| James HR, Commins SP, Kelly LA, Pochan SL, Workman LJ, Mullins RJ, Platts-Mills TA. | 2011 | Further Evidence For Tick Bites As A Cause Of The IgE Responses To Alpha-gal That Underlie A Major Increased In Delayed Anaphylaxis To Meat. RATIONALE: Delayed onset of urticaria or anaphylaxis after eating meat in patients who have IgE to alpha-gal is now a common presenting cause of food allergy in Virginia. The evidence that ticks are related to this IgE response comes from histories of bites, absence of this ab in areas where tick bites are rare, and from following IgE responses after tick bites. METHODS: Detailed histories and assays for IgE were compared in a population of anaphylaxis, asthma, and clinic controls. RESULTS: Among those with full histories (n5100), a report of prolonged or severe reactions to tick bites correlated with titer of IgE to alpha-gal (Chi-square 5 17.6, p<0.001). The IgE responses following tick bites have distinctive features: a) they can increase to high level (i.e., greater than 50 IU/ml within a month), b) IgE to cat and dog epithelium and beef increase in parallel with IgE to alpha-gal, while IgE to other allergens remain negative or unchanged, and c) absorption experiments confirm that these IgE responses to alpha-gal explain up to 50% of total serum IgE. In keeping with this, titers of total IgE and IgE to alpha-gal correlate closely (r50.7, p<0.001). CONCLUSION: Some of the patients have had episodes of delayed anaphylaxis for over 15 years; however, the bulk of these cases are of recent onset. At present, the best explanation for increasing incidence of this syndrome is a major increase in tick bites related to the massive increase in the population of their primary host, the white-tailed deer. |
Journal of Allergy and Clinical Immunology. 2011 Feb 1;127(2):AB243. | |
| James HR, Kelly LA, Pochan SL, Commins SP, Workman LJ, Nganga LW, Cooper P, Platts-Mills TA. | 2012 | Parasite-related IgE Antibodies, Including IgE to Galactose-alpha-1,3-galactose, in Sera from Virginia and Ecuador. RATIONALE: IgE antibodies to galactose-alpha-1,3-galactose (alphagal) have become increasingly prevalent in the southeastern United States. These antibodies have recently been linked to bites from the tick Amblyomma americanum, but the possibility of a role for other parasites remains. . METHODS: Assays for IgE were performed on patients with delayed urticaria or anaphylaxis to meat and controls in Virginia (n5125), as well as a cohort from Esmeraldas Province, Ecuador (n5295) where Echinococcus is not endemic. . RESULTS: The significant association between IgE antibodies to alphagal and IgE to Echinococcus was strongest in Virginia (r50.74 vs r50.62 for Ecuador, both p<0.001). Further, only 3/37 Echinococcus IgE-positive subjects in Virginia were not positive for IgE to alpha-gal. In Ecuador, 118/ 223 Ascaris-positive sera were negative for IgE to alpha-gal; by contrast, in Virginia 52/79 alpha-gal positive sera were negative for Ascaris and only one sera was Ascaris-positive and alpha-gal negative. Virginia sera with IgE to Echinococcus (class 2 and 3) were absorbed with alpha-gal linked to Sepharose beads, which removed all detectable IgE to Echinococcus. . CONCLUSIONS: We think that the limited number of positive assays for Echinococcus and Ascaris in Virginia can be explained by cross-reactivity with alpha-gal, which may also be relevant for Echinococcus in Esmeraldas. By contrast, many sera in Ecuador had high titer IgE to Ascaris with negative responses to alpha-gal. None of these IgE antibodies were significantly associated with asthma in the United States, while IgE to Ascaris was significantly associated with asthma in Ecuador. |
Journal of Allergy and Clinical Immunology. 2012;129(2):AB82. | Latin America; Ecuador; platyhelminthes; endoparasites |
| Jappe U, Kuehn A. | 2016 | Diagnostically relevant single allergens from plant and animal source foods - an update. Over the past years, considerable progress has been made in the field of molecular allergology. Some new single allergens have been isolated from various sources of food allergens, and some of these single allergens are already available for routine allergy diagnosis, which results in a higher sensitivity and specificity of IgE determination. Furthermore, the underlying cause of a new disease entity delayed-type anaphylaxis has been found: galactose alpha-1,3-galactose, a disaccharide of mammalian meat. Now, meat allergy can be confirmed more frequently and does not have to be classified as idiopathic anaphylaxis so often. In addition, completely new allergens could be isolated: hydrophobic and lipophilic peanut allergens, the defensins and oleosins. With this, it might be possible to close a diagnostic gap, i.e., the allergens of the lipid fractions of oilseeds. |
ALLERGOLOGIE. 2016 Sep 1;39(9):425-38. | |
| Jappe U, Minge S, Kreft B, Ludwig A, Przybilla B, Walker A, Varga R, Seidel P, Biedermann T, Anemüller W, Kromminga A. | 2018 | Meat allergy associated with galactosyl‐α‐(1, 3)‐galactose (α‐Gal)—Closing diagnostic gaps by anti‐α‐Gal IgE immune profiling. BackgroundGlycoproteins and glycolipids of some mammalian species contain the disaccharide galactosyl‐α‐(1,3)‐galactose (α‐Gal). It is known that α‐Gal is immunogenic in humans and causes glycan‐specific IgG and also IgE responses with clinical relevance. α‐Gal is part of the IgE‐reactive monoclonal therapeutic antibody cetuximab (CTX) and is associated with delayed anaphylaxis to red meat. In this study, different α‐Gal‐containing analytes are examined in singleplex and multiplex assays to resolve individual sensitization patterns with IgE against α‐Gal.MethodsThree serum groups, α‐Gal‐associated meat allergy (MA ) patients, idiopathic anaphylaxis (IA ) patients with suspected MA, and non‐meat‐allergic healthy control individuals (HC ), were analyzed via singleplex allergy diagnostics and a newly established immunoblot diagnostic system. The new dot blot detection system resolved individual IgE sensitization profiles for α‐Gal‐containing analytes CTX, bovine thyroglobulin (Bos d TG), and human serum albumin ( HSA )‐conjugated α‐Gal.ResultsSingleplex allergy diagnostics using the α‐Gal analytes CTX and Bos d TG confirms the history of MA patients in 91% and 88% of the cases, respectively. A novel dot blot‐based assay system for the detection of IgE against α‐Gal reveals individual IgE sensitization profiles for α‐Gal‐containing analytes. An α‐Gal‐associated IgE cross‐reactivity profile (IgE against CTX, Bos d TG, and HSA ‐α‐Gal) was identified, which is associated with MA.ConclusionsDetection of individual sensitization patterns with different α‐Gal‐containing analytes provides the basis for an individual allergy diagnosis for α‐Gal‐sensitized patients. Higher amounts of α‐Gal in pork and beef innards compared to muscle meat as indicated by a higher staining intensity are a plausible explanation for the difference in allergic symptom severity. |
Allergy. 2018 Jan;73(1):93-105. | diagnosis; intestine |
| Jappe U. | 2014 | Anaphylaxis caused by hidden food allergens: the alpha-Gal syndrome. Hidden allergens may be defined as allergen deliberately added to food but unlabeled in the ingredient list or present due to unintentional cross contact during food manufacturing itself and, therefore, not recognizable for the consumer. An allergen present in food may also be considered as "hidden" if causing reactions in a patient because of so far unknown cross-reactivity. A novel food allergen is one that has been introduced to human diet for the first time, e.g., kiwi at the beginning of the 1980s, and to which patients develop sensitivity after exposure. A new allergen also can be an IgE-binding molecule that has never been described and identified before in a particular species as allergen source, a-Gal is an ubiquitous glycan moiety expressed on cells and tissue of nonprimate mammals, but not in humans, which is the reason for its strong immunogenicity for the latter. a-Gal is located on the Fab portion of the monoclonal treatment antibody Cetuximab. In 2008, it has been identified as being responsible for severe, sometimes fatal anaphylactic reactions to Cetuximab. Anti-alpha-Gal-IgE also seem to be responsible for severe allergy to red meat, innards and to gelatine, however, fatal reactions have not been reported so far. Anti-a-Gal-IgE are associated with a novel food allergy, a delayed anaphylaxis (more than 3 hours) following the ingestion of red meat and innards, a phenomenon which is still to be elucidated. An additional characteristic feature is that for most of these patients conventional skin prick tests with commercial reagents proved insufficient for diagnosis. Anti-a-Gal-IgE were first detected in sera from patients in an area of the southeastern U.S. and bound to a wide range of mammalian allergens. The geographic distribution prompted investigations of sensitization routes apart from the ingestion of red meat, like tick bites und parasitic infections. |
Allergologie. 2014 Jul 1;37(7):265-74. | |
| Jappe U. | 2012 | Update on meat allergy. alpha-Gal: a new epitope, a new entity? The association between the carbohydrate galactose-[alpha]-1,3-galactose (alpha-Gal) and anaphylaxis was first documented after severe hypersensitivity reactions to cetuximab, a chimeric mouse-human IgG1 monoclonal antibody approved for targeted therapy of carcinomas of colon, as well as of the head and neck region. alpha-Gal is a ubiquitous glycan moiety expressed on cells and tissue of non-primate mammals. Since this epitope is not expressed in humans, it is very immunogenic for them. alpha-Gal is located on the Fab portion of cetuximab and thus on the murine part of the chimera. The anaphylactic reactions to the antibody were mediated by IgE specific for alpha-Gal. Anti-alpha-Gal-IgE were first detected in sera of patients from the southeastern U.S. and reacted with a wide range of mammalian allergens. The geographic distribution prompted investigations of sensitization routes apart from the ingestion of red meat, such as tick bites und parasitic infections. Anti-alpha-Gal-IgE seems to be of clinical relevance for allergy to red meat and for the pork-cat syndrome. It is also associated with a novel form of delayed anaphylaxis, which appears more than 3 hours following the ingestion of red meat (beef, pork and lamb), a phenomenon which is still to be elucidated. For most of these patients conventional skin prick tests with commercial reagents proved insufficient for diagnosis. |
Der Hautarzt; Zeitschrift fur Dermatologie, Venerologie, und verwandte Gebiete. 2012 Apr;63(4):299. | |
| Jayanth SH, Chandra YP, Singh YK. | 2014 | Fatal Anaphylaxis to Pork: A Case Report. Food allergy is a common cause of anaphylaxis, which affects up to 10% of young children and 2–3% of adults, and its prevalence appears to be increasing constantly; however the precise incidence of food-induced fatal anaphylaxis among people is unknown. In the case of anaphylactic shock death is likely to occur rapidly and without any warning in seemingly healthy subjects. The lack of reliable laboratory biomarkers and common standard definitions of signs and symptoms makes it difficult for clinicians to diagnose a suspected anaphylactic event. Furthermore at autopsy the findings might hint at the allergic reaction, but classic manifestations may not be appreciated thereby making postmortem diagnosis of anaphylaxis difficult. Here we report one such case of death due to anaphylaxis in a young women with childhood history of allergy to pork. |
Journal of Allergy and Clinical Immunology. 1999 May 1;103(5):717-28. | Asia; India; anaphylaxis; mortality |
| Jeimy S, Zhu R. | 2023 | Five things to know about ... Tick-borne red meat allergy (α-gal syndrome) |
CMAJ. 2023 Oct 3;195(38):E1305-6. | review; Canada |
| Jeimy S, Zhu R. | 2024 | Allergie à la viande rouge transmise par les tiques (syndrome α-gal). |
CMAJ. 2024 Jan 28;196(3):E108-E109. French. doi: 10.1503/cmaj.231067-f. PMID: 38286489; PMCID: PMC10833098. | review; Canada; French |
| Jensen L, Ushinsky A. | 2024 | Management of acute hemorrhage without the use of mammalian products in a patient with alpha-gal syndrome. A 49-year-old male with clinically and serologically confirmed AGS presented for ultrasound-guided biopsy of a suspected hepatic metastasis. Immediately post biopsy, hemorrhage was identified along the biopsy tract (Figure 1). AGS precluded the use of gelatin or thrombin-based hemostatic agents which would otherwise be routinely used in the authors’ practice. The patient underwent angiography where active extravasation was identified from the artery of hepatic segment 6. n-BCA (TRUFILL, Cerenovus, Miami, FL) was chosen for embolization because it contains no mammalian components. A suture-mediated vascular closure device (VCD) was chosen rather than a collagen plug-based VCD. The patient developed no allergic symptoms in the peri-procedural period. |
Journal of Vascular and Interventional Radiology. 2024 May 3. | perioperative; surgery; hemorrhage; medical products; vascular closure device |
| Jeong BY, Kim DY, Fan JP, Chung HC, Han GD. | 2009 | Studies on the Prevalence of Meat Allergy and Potential Beef Allergens The prevalence of food allergies was investigated using questionnaires with 300 subjects whose ages ranged from 19 to 24 years old and the causative food allergens was analyzed using immunological analysis with serum of the subjects who answered that they have/had food allergy. The questionnaire showed that 11.33Uo of subjects have/had experience of food hypersensitivity, where the main causative foods were fish, beef, chicken, milk, egg, and pork in order. The meat allergy shared 4.659o f2.337c for beef, 1.669c for chicken, 0.669n for pork) in the prevalence of food allergies. The causative beef allergens were investigated with the serum of 6 subjects who have had beef allergy. Western blots were carried ‹but with the serum of P6 subject who showed a positive reaction to beef extract in ELISA. The two specific bands were detected in beef extract on the PVDF membrane, and no band was detected in extracts of pork and chicken. A calculation of the distance of migration by SDS-PAGE enabled the molecular masses of the two bands to be estimated as 67 kDa and 31 kDa, respectively. The 67 kDa was revealed as bovine serum albumin (BSA) which is one of the important beef allergens as reported previ- ously though an analysis of the N-terminal amino acid sequence. However we could not identify the sequence of 31 kDa, probably because they comprised several subunits and were modified proteins such as glycoprotein that were unlikely to be easily degraded by the Edman method. The 31 kDa band were dyed with the PAS tperiodic acid-schiff reagent), suggesting that it might be a glycoprotein. These results suggested that the 31 kDa might be considered as a novel potential beef aller- gen which is not reported previously, although further studies are needed. |
Food Science of Animal Resources. 2009;29(2):151-6. | Asia; Korea; prevalence |
| Jerath MR, Sheikh SZ. | 2013 | Characteristics of Patients with Delayed Allergic Reactions to Mammalian Meat Presenting to a Tertiary Care Academic Medical Center in North Carolina. Rationale: This study aims to describe the characteristics of patients who were diagnosed at our institution with an allergy to galactose-a1,3-galactose (‘alpha-gal’), mediating a delayed reaction to mammalian meat. Little is known about the epidemiology and clinical features of this condition. Methods: We performed a retrospective chart review to collect demographic, clinical, and laboratory data on 100 adult patients diagnosed with this condition. Results: In our sample, 52% of patients were male and the mean age was 49. The mean time to reaction was 5 hours. Urticaria was reported by 86% and anaphylaxis by 30%. Epinephrine was used to treat 21% of reactions. Ninety-six percent of individuals reported a history of tick/chigger bite, with 85% of patients reporting one in the past year. Eighty-five percent denied any reactions to cow’s milk and 83% reported no reactions after avoidance of mammalian meat. Hypertension (25%), hyperlipidemia (19%), hypothyroidism (10%), and diabetes mellitus (10%) were the main associated co-morbidities. Venom hypersensitivity was seen in 6% of the patients. The mean alpha-gal IgE was 20 IU/ml, mean total IgE was 323 kU/L, and mean IgE receptor antibody was 9.5%. The concurrent rate of other atopic disease was 46%, significantly higher than that of the general population (25%), p<.0001. Conclusions: We report a large cohort of patients diagnosed with ‘alpha-gal’ allergy in North Carolina, with similar demographic characteristics as previously reported from the University of Virginia. As our database grows, we hope to determine risk factors for developing this condition and identify predictors of severity. |
Journal of Allergy and Clinical Immunology. 2013 Feb 1;131(2):AB217. | North Carolina; prevalence; symptom prevalence |
| Jiang X, Rao Q, Mittl K, Hsieh YH. | 2019 | Monoclonal antibody-based sandwich ELISA for the detection of mammalian meats. In order to (1) reduce the risk of intentional or unintentional contamination of foods, (2) better comply with food regulations, and (3) decrease economic loss to the food industry caused by recall, it is necessary to develop reliable methods for the detection of different food adulterants/contaminants. This study was conducted to characterize two mammalian skeletal troponin (sTn) specific monoclonal antibodies (mAbs 6G1 and 8F10), and use them to develop a mAb-based sandwich enzyme-linked immunosorbent assay (ELISA) for the detection of mammalian meats. From our results, both mAbs were positive to porcine sTnI and sTnC but negative to sTnT. The extractability and antigenicity of target analytes in pork were enhanced by the addition of urea and β-mercaptoethanol into the extraction buffer. The optimized sandwich ELISA was specific to heated mammalian meats and was adequate to analyze samples subject to the most severe heat treatment (132 °C/2 bar/120 min). Mammalian fat (10–30%, g/g) did not significantly affect the assay signal. The optimized assay could detect as low as 1% (g/g) of heated mammalian meats adulterated in poultry meats. Overall, this assay has the potential to fight food fraud, comply with food regulations, and decrease food recalls, which may open up new diagnostic methods for the food industry and the food regulatory authorities. "Around 10% of the foods produced in the U.S. were adulterated and 7% contain fraudulent ingredients (Layton, 2010). From 1980 to 2013, (1) the leading reported type of fraudulent foods was animal products including meat and meat products (7%); (2) 65% of the total incidents were due to substitution or dilution; and (3) in about 30% of the total incidents, the involved food products were produced in the U.S. (National Center for food Protection and Defense, 2015)" |
International journal of environmental research and public health. 2013 Apr;10(4):1598-608. | Food safety; food adulteration; meat adulteration |
| Jiang Y, Yuan IH, Dutille EK, Bailey R, Shaker MS. | 2019 | Preventing iatrogenic gelatin anaphylaxis. Objective:To assess the iatrogenic risks of gelatin allergy and identify resources for patient management. Data Sources:A literature review was performed using PubMed and public databases provided by the National Library of Medicine. Study Selections:Reports of iatrogenic gelatin allergy associated with vaccines, hemostatic agents, intravenous colloids, medicinal capsules, and intraoperative surgical supplies. Results:Gelatin ingredients may not be identified by electronic medical record safeguards, and an exhaustive listing of potential iatrogenic exposures is elusive. The National Library of Medicine AccessGUDID (https://accessgudid.nlm.nih.gov/) can be a useful resource in evaluating medical devices for gelatin content. Unexpected sources of iatrogenic gelatin exposure include hemostatic agents, vascular grafts, intravascular cannulas, bone replacement implants, and emergency resuscitation fluids. Conclusion:Vigilance is important within medical systems to avoid inadvertent gelatin exposure when caring for patients with gelatin allergy. Additional safeguards are needed to remove latent health care system errors that fail to prevent gelatin administration in this at-risk population. |
Annals of Allergy, Asthma & Immunology. 2019 Oct 1;123(4):366-74. | pharmacy; pharmaceutical; perioperative; gelatin |
| Jin HJ, Nam YH, Hwang EK, Shin YS, Ye YM, Park HS. | 2011 | Immunologic evaluation of delayed hypersensitivity to meat in adults Background: Mammalian meat allergy is not common in adults, but increasing in recent years. Although the pathogenic mechanisms are not understood, various immunological and non-immunologic mechanisms were suggested. The aim of this study was to evaluate clinical and immunological characteristics of the patients with delayed hypersensitivity developed after consumption of meat. Methods: Thirty patients with delayed hypersensitivity to beef and/or pork (developed 2 hrs later) were enrolled from Ajou University Hospital. Skin prick tests were performed with commercial beef and pork extracts (Bencard, Bradford, UK) and considered positive if they produced a wheal with a diameter ≥ 3 mm. Serum specific IgE antibodies to beef, pork and galactose- α-1,3- galactose (α-gal) were measured by immunoCAP (Phadia, Sweden). Serum specific IgG1 and G4 antibodies to beef and pork were measured by ELISA. Results: Twenty (66.7%) were female and 25 (83%) were atopics. The most common symptoms were urticaria/angioedema (83.3%) followed by anaphylaxis (16.7%) and gastrointestinal symptoms (13.3%). The skin prick test to beef and pork extracts showed negative results in all, while serum specific IgE to beef and pork was found in 16.7% and 10% of them. The specific IgE to α-gal was found in 3(10%) patients. High serum specific IgG1 to beef and pork was detected in 2(6.7%) and 3 patients (10%), while serum specific IgG4 was detected in 3(10%) and 1 patient (3.3%). Conclusion: We suggested that IgE mediated response to α-gal as well as IgE and IgG responses to beef and pork may induce delayed hypersensitivity to meat. Future investigations will be needed on cellular immune mechanisms. This study was supported by a grant from the Korea Science and Engineering Foundation (KOSEF) funded by the Korean government (MEST, 2009-0078646). |
대한내과학회 추계학술발표논문집. 2011;2011(1):307-. | Asia; Korea |
| Jin R, Greenwald A, Peterson MD, Waddell TK. | 2006 | Human monocytes recognize porcine endothelium via the interaction of galectin 3 and α-GAL. Monocytes are one of the key inflammatory cells recruited to xenografts and play an important role in delayed xenograft rejection. Previous studies have demonstrated the ability of monocytes to bind to the major xenoantigen Gal-α(1,3)Gal-β(1,4)GlcNAc-R; however, the receptor that mediates this interaction has yet to be identified. We provide evidence that it is Galectin-3, a ∼30-kDa lectin that recognizes β-galactosides (Gal-β(1–3/4)GlcNAc) and plays diverse roles in many physiological and pathological events. Human monocyte binding is strikingly increased on porcine aortic endothelial cells (PAEC), which express high levels of Gal-α(1,3)Gal-β(1,4)GlcNAc-R, compared with human aortic endothelial cells. Human monocytes obtained from healthy donors bind to Gal-α(1,3)Gal-β(1,4)GlcNAc-R at variable intensities. This variation of binding intensity was consistent and reproducible in individual donors. Galectin-3 is mainly expressed in human monocytes, not lymphocytes. Purified Galectin-3 is able to bind directly to Gal-α(1,3)Gal-β(1,4)GlcNAc-R. Galectin-3 can also be affinity isolated from monocytes (and not lymphocytes) using an Gal-α(1,3)Gal-β(1,4)GlcNAc-R-biotin/streptavidin-bead pull-down system. Soluble Galectin-3 binds preferentially to PAEC vs human aortic endothelial cells, and this binding can be inhibited by lactose, indicating dependence on the carbohydrate recognition domain of Galectin-3. Gal-α(1,3)Gal-β(1,4)GlcNAc-R is at least partly responsible for this phenomenon, as binding decreased after digestion of PAEC with α-galactosidase. Furthermore, monocytes pretreated with a blocking anti-Galectin-3 Ab show decreased adhesion to PAEC when compared with isotype control in a parallel plate flow chamber perfusion assay. Thus, we conclude that Galectin-3 expressed in human monocytes is a receptor for the major xenoantigen (Gal-α(1,3)Gal-β(1,4)GlcNAc-R), expressed on porcine endothelial cells. |
The journal of Immunology. 2006 Jul 15;177(2):1289-95. | xenotransplantation |
| Johansen KL, Rasmussen K. | 2014 | IgE-induced anaphylactic reaction after eating lamb meat. This article presents the case of a 54-year-old male, who was admitted to hospital after suffering a severe anaphylactic reaction after tasting a spoonful of chili con carne and four months later after eating lamb meat. Galactose-alpha-1,3-galactose allergy was suspected and the subsequent blood test showed highly elevated specific IgE levels. Delayed allergy to meat is a relatively new type of allergy and the delayed onset of allergic symptoms poses a diagnostic challenge to the physician. This type of allergy should be considered when there has been no obvious allergen exposition prior to the allergic reaction. |
Ugeskrift for laeger. 2014 Aug 1;176(35). | Europe; Denmark; lamb |
| Johnson RW, Roden-Reynolds P, Snow AA, Rich SM. | 2024 | The Spread of Lone Star Ticks (Amblyomma americanum) and Persistence of Blacklegged Ticks (Ixodes scapularis) on a Coastal Island in Massachusetts, USA. |
Insects. 2024 Sep 17;15(9):709. | vector; tick; lone star tick; Amblyomma americanum; Massachusetts; Martha's Vineyard |
| Jones CA. | 2024 | Perioperative Anesthesia Considerations for Patients with Alpha Gal Syndrome. |
A Project Report Submitted to the Faculty of The School of Nursing at The University of North Carolina at Greensboro In Partial Fulfillment Of the Requirements for the Doctorate in Nursing Practice | perioperative; surgery; medical products; nursing |
| Joral A, Azketa N, Sanchez P, Vélez-del-Burgo A, Aranzabal-Soto MA, Lizarza S, Martínez J, Postigo I. | 2022 | The Quantification of IgG Specific to α-Gal Could Be Used as a Risk Marker for Suffering Mammalian Meat Allergy. The alpha‐Gal Syndrome is a delayed meat allergy characterized by the presence of sIgEagainst α‐Gal epitope. It is known that the α‐Gal present in tick saliva induces the sensitization to this epitope ending in the production of sIgG and sIgE to α‐Gal. It could be considered that the more times a person is bitten by tick species, the higher the probability of making the switch from sIgG to sIgE to α‐Gal and developing allergy, but it is no clear when the switch occurs. To determine the likelihood that a subject bitten by ticks but without AGS be at risk of developing this allergy, we quantified the levels of sIgG to α‐Gal by an automated system (ImmunoCap). To stablish a cut‐off value for sIgG to α‐Gal, a receiving operating curve (ROC) was constructed. The statistical analysis demonstrated that the risk of suffering AGS in individuals bitten by ticks was 35% when the sIgG to α‐Gal was greater than or equal to 40 μg/mL. Our data indicate that the sIgG values against α‐Gal could be used as a prognostic marker for developing mammalian meat allergy. |
Foods. 2022 Jan;11(3):466. | IgG; markers; anti-gal; pathogenesis |
| Josko D. | 2019 | Anaphylactic Reaction After Beef Consumption Due to the Development of IgE Antibodies Against the Carbohydrate Galactose-Alpha-1,3-Galactose. A 52-year old female was seen in the emergency department with symptoms of anaphylaxis. History revealed that shortly after eating dinner she developed hives, which quickly evolved into wheezing, throat tightness, and difficulty breathing. Her symptoms intensified even after taking Benadryl. Once in the emergency department she was treated with epinephrine as well as 125 mg of Solu-Medrol. She was later admitted for observation. The patient stated she had several visits to the emergency department in the past few years with hives possibly due to food allergies but not this severe. Subsequent laboratory testing revealed elevated levels of IgE specific antibodies to the beef allergen. An alpha-gal panel was performed for beef, lamb/mutton, and pork IgE levels which were all elevated. The patient was advised to avoid eating these types of meats in the future. Individuals with IgE antibodies to galactose-alpha-1,3galactose (alpha-gal) are at risk for delayed anaphylaxis, angioedema, or urticaria following consumption of these products. The patient lives in a rural area in New Jersey and has been bitten numerous times by ticks. Recently, several cases in Virginia have been reported of hives and difficulty breathing in 45 children aged 4–17 after ingesting red meat. All described being bitten by a tick within the past year. It is believed the Lone Star tick, which is endemic in the southern and eastern United States, carries the carbohydrate alpha-gal in its saliva and once bitten, the patient develops antibodies against this sugar, which can result in life-threatening anaphylaxis. Although there is currently no treatment, individuals who experience symptoms such as hives and difficulty breathing after ingesting meat should be tested for alpha-gal sensitivity and if positive, should avoid consumption of mammalian meat in the future. |
American Journal of Clinical Pathology. 2014 Oct 1;142(suppl 1):A027. | |
| Jungewelter S, Airaksinen L, Pesonen M. | 2019 | Occupational rhinitis, asthma, and contact urticaria from IgE‐mediated allergy to pork. We describe four cases of slaughterhouse workers with occupational immediate allergy to raw pork allergens, confirmed by positive skin prick testing and specific immunoglobulin E (IgE) antibodies. Our first patient was diagnosed with occupational asthma from raw pork allergens. Two patients were diagnosed with occupational rhinitis caused by raw pork allergens, which was confirmed by a nasal provocation test. One of these also had occupational contact urticaria caused by raw pork meat. We were unable to diagnose an occupational respiratory or skin disease in the fourth patient, despite signs of immediate sensitization to raw pork meat from occupational exposure. Based on proper diagnoses, measures to prevent allergen exposure were taken, which led to the improvement of symptoms in these four patients. The present patient cases highlight the importance of recognition of early signs of occupational allergy and identification of causative allergens in order to allow avoidance of allergens, with the aim of preventing persistence and worsening of symptoms. |
American journal of industrial medicine. 2019 Jan;62(1):80-4. | airborne reactions; occupational medicine |
| Kageyama R, Fujiyama T, Satoh T, Keneko Y, Kitano S, Tokura Y, Hashizume H. | 2019 | The contribution made by skin-infiltrating basophils to the development of alpha-gal syndrome. No abstract available |
Allergy. 2019 Sep;74(9):1805-7. | |
| Kaloga M, Kourouma S, Kouassi YI, Ecra EJ, Gbery IP, Allou AS, Diabate A, Djeha D, Sangaré A, Yoboue YP. | 2016 | Allergy to Red Meat: A Diagnosis Made by the Patient and Confirmed by an Assay for IgE Antibodies Specific for Alpha-1,3-Galactose. We report the first case of allergy to red meat observed in Ivory Coast. A 49-year-old male presented with pruritus. The diagnosis of allergy to red meat was confirmed by an assay for IgE antibodies specific for alpha-1,3 galactose. Interestingly, the disease was considered a spell to the patient who was suspected of being a sorcerer by the community. |
Case reports in dermatology. 2016;8(1):10-3. | Sangare; Africa; Ivory Coast; Côte d'Ivoire; self-diagnosis; dermatology; pruritus; vector; insect |
| Kaman K, Robertson D. | 2018 | ALPHA-GAL ALLERGY; MORE THAN MEAT? Introduction: Galactose-alpha-1,3-galactose (alpha-gal) is a carbohydrate moiety found on non-primate mammalian cell membranes. Over the last 10 years, delayed allergic reactions caused by IgE to alpha-gal has drastically changed the way we think about food allergy. Patients with alpha gal allergy classically present with delayed allergic reactions, including anaphylaxis, hours after consuming mammalian meats. Alpha-gal has also been found to be present in other mammalian products via immunoblot, primarily in dairy that contains higher fat content, but the vast majority of patients tolerate other mammalian byproducts (e.g. milk) with no issue. We present a case of delayed urticaria in a patient with known alpha-gal allergy associated with whey consumption. Case Description: A 37 y/o M presented with delayed urticaria x3 after consuming hamburgers. He was employed as a camp counselor with positive tick exposures. Negative skin prick and specific IgE testing to beef, but positive to Galactose-alpha-1,3-galactose. He subsequently developed delayed urticaria after consuming high doses of whey protein concentrate. Specific IgE testing was negative to whey and other milk proteins. Discussion: Delayed allergic reactions to alpha-gal caused by meat ingestion is well established. We present a case of delayed reaction to alpha-gal in the from of ingested whey, which has not been well documented in the literature. We hypothesize that the bovine-gamma-globulin component in both mammalian meat and whey contains the alpha-gal moiety. Additionally, the form in which bovine-gamma-globulin is consumed or processed may affect reactivity to the alpha component. |
Frontiers in Immunology. 2020;11. | dairy; dairy byproducts; mammalian byproducts; whey |
| Kamdar S, Baker M. | 2024 | CHILD WITH MILK AND NEW BEEF ALLERGY: COEXISTING ALLERGIES OR ALPHA-GAL SYNDROME?. | CHILD WITH MILK AND NEW BEEF ALLERGY: COEXISTING ALLERGIES OR ALPHA-GAL SYNDROME?. Annals of Allergy, Asthma & Immunology. 2024 Nov 1;133(6):S194. | |
| Kaplan AC, Carson MP. | 2018 | Diagnosing Meat Allergy After Tick Bite Without Delay. ...Here, we present a case of delayed urticarial angioedema due to a mammalian meat allergy caused by alpha-gal immunoglobulin E acquired after tick exposures, and the knowledge and patient education required to prevent recurrences. It is estimated that approximately 0.5% to 1.0% of the general population will experience an episode of angioedema in their lifetime, and this case demonstrates why clinicians in areas that are inhabited by ticks, particularly the Lone Star species, should include this cause in their differential. |
The Journal of the American Board of Family Medicine. 2018 Jul 1;31(4):650-2. | |
| Kappler K, Hennet T. | 2020 | Emergence and significance of carbohydrate-specific antibodies. Carbohydrate-specific antibodies are widespread among all classes of immunoglobulins. Despite their broad occurrence, little is known about their formation and biological significance. Carbohydrate-specific antibodies are often classified as natural antibodies under the assumption that they arise without prior exposure to exogenous antigens. On the other hand, various carbohydrate-specific antibodies, including antibodies to ABO blood group antigens, emerge after the contact of immune cells with the intestinal microbiota, which expresses a vast diversity of carbohydrate antigens. Here we explore the development of carbohydrate-specific antibodies in humans, addressing the definition of natural antibodies and the production of carbohydrate-specific antibodies upon antigen stimulation. We focus on the significance of the intestinal microbiota in shaping carbohydrate-specific antibodies not just in the gut, but also in the blood circulation. The structural similarity between bacterial carbohydrate antigens and surface glycoconjugates of protists, fungi and animals leads to the production of carbohydrate-specific antibodies protective against a broad range of pathogens. Mimicry between bacterial and human glycoconjugates, however, can also lead to the generation of carbohydrate-specific antibodies that cross-react with human antigens, thereby contributing to the development of autoimmune disorders. |
Brain. 2002 Dec 1;125(12):2591-625. | |
| Karasuyama H, Tabakawa Y, Ohta T, Wada T, Yoshikawa S. | 2018 | Crucial role for basophils in acquired protective immunity to tick infestation. |
Frontiers in Physiology. 2018 Dec 7;9:1769. | Arthropod; Acari; tick; acquired tick immunity; evolution |
| Karim S, Leyva-Castillo JM, Narasimhan S. | 2023 | Tick salivary glycans–a sugar-coated tick bite. Ticks are hematophagous arthropods that transmit disease-causing pathogens worldwide. Tick saliva deposited into the tick-bite site is composed of an array of immunomodulatory proteins that ensure successful feeding and pathogen transmission. These salivary proteins are often glycosylated, and glycosylation is potentially critical for the function of these proteins. Some salivary glycans are linked to the phenomenon of red meat allergy - an allergic response to red meat consumption in humans exposed to certain tick species. Tick salivary glycans are also invoked in the phenomenon of acquired tick resistance wherein non-natural host species exposed to tick bites develop an immune response that thwarts subsequent tick feeding. This review dwells on our current knowledge of these two phenomena, thematically linked by salivary glycans. |
Trends in Parasitology. 2023 Oct 12. | ticks; acquired tick resistance ATR; glycosylation; tick saliva |
| Karim S, Ribeiro JM. | 2015 | An insight into the sialome of the lone star tick, Amblyomma americanum, with a glimpse on its time dependent gene expression. Hard ticks feed for several days or weeks on their hosts. Blood feeding is assisted by tick saliva, which is injected in the host skin regularly, alternating with blood ingestion. Tick saliva contains hundreds or thousands of different peptides and other bioactive compounds that assist feeding by inhibiting their hosts’ blood clotting, platelet aggregation, vasoconstriction, as well as pain and itching. Immunomodulatory and antimicrobial peptides are also found in tick saliva. Molecular characterization of tick salivary compounds, or its sialome (from the Greek sialos = saliva), helps identification of possible antigens that might confer anti-tick immunity, as well as identifying novel pharmacologically active compounds. Amblyomma americanum is a major nuisance tick in Eastern and Southern US, being a vector of Theileria and Ehrlichia bacteria to animals and humans. Presently we report an RNAseq study concerning the salivary glands of adult female A. americanum ticks, which involved sequencing of four libraries collected at different times of feeding. A total of 5,792 coding sequences were deduced from the transcriptome assembly, 3,139 of which were publicly deposited, expanding from the previously available 146 salivary sequences found in GenBank. A remarkable time-dependent transcript expression was found, mostly related to secretory products, supporting the idea that ticks may have several “sialomes” that are expressed at different times during feeding. The molecular nature of this sialome switching remains unknown. The hyperlinked spreadsheet containing the deduced coding sequences can be found at http://exon.niaid.nih.gov/transcriptome/Amb_americanum/Ambame-web.xlsx. |
PLoS One. 2015 Jul 1;10(7):e0131292. | |
| Kasi PM, Afable MG, Herting C, Lukanowski M, Jin Z. | 2023 | Anti-EGFR Antibodies in the Management of Advanced Colorectal Cancer. |
The Oncologist. 2023 Sep 29:oyad262. | oncology; cancer; medical products; biologic; monoclonal antibodies; cetuximab; death |
| Kato T, Yoshizawa A, Manabe S, Takanashi S, Kawamura A, Yoshizawa S, Kuwaki K. | 2021 | Xenoimmune Response Can Elicit Postoperative Bioprosthetic Valve Degeneration. |
The Journal of Heart and Lung Transplantation. 2021 Apr 1;40(4):S299. | Pharmacy; pharmaceutical; medical products; cardiac surgery; cardiovascular; bioprosthetic heart valve |
| Kaushik P, Kaushik AA. | 2023 | Palindromic rheumatism as a feature of alpha-gal syndrome: Initial observation on 18 patients from the capital of the Cherokee Nation |
Int J Rheum Dis. Published online December 2, 2023. doi:10.1111/1756-185X.14991 |
Native American; American Indian; Cherokee; rheumatology; arthritis; palindromic arthritis; joint pain |
| Kaushik P, Suresh S, Alexander CS. | 2024 | Alpha-gal Syndrome Presenting as Fibromyalgia in an American Indian Population. |
Indian Journal of Rheumatology. 2024 Dec;19(4):329-30. | Native American; American Indian; Cherokee; rheumatology; Oklahoma; fibromyalgia |
| Kazimírová M, Stibraniova I. | 2013 | Tick salivary compounds: their role in modulation of host defences and pathogen transmission Ticks require blood meal to complete development and reproduction. Multifunctional tick salivary glands play a pivotal role in tick feeding and transmission of pathogens. Tick salivary molecules injected into the host modulate host defence responses to the benefit of the feeding ticks. To colonize tick organs, tick-borne microorganisms must overcome several barriers, i.e., tick gut membrane, tick immunity, and moulting. Tick-borne pathogens co-evolved with their vectors and hosts and developed molecular adaptations to avoid adverse effects of tick and host defences. Large gaps exist in the knowledge of survival strategies of tick-borne microorganisms and on the molecular mechanisms of tick-host-pathogen interactions. Prior to transmission to a host, the microorganisms penetrate and multiply in tick salivary glands. As soon as the tick is attached to a host, gene expression and production of salivary molecules is upregulated, primarily to facilitate feeding and avoid tick rejection by the host. Pathogens exploit tick salivary molecules for their survival and multiplication in the vector and transmission to and establishment in the hosts. Promotion of pathogen transmission by bioactive molecules in tick saliva was described as saliva-assisted transmission (SAT). SAT candidates comprise compounds with anti-haemostatic, anti-inflammatory and immunomodulatory functions, but the molecular mechanisms by which they mediate pathogen transmission are largely unknown. To date only a few tick salivary molecules associated with specific pathogen transmission have been identified and their functions partially elucidated. Advanced molecular techniques are applied in studying tick-host-pathogen interactions and provide information on expression of vector and pathogen genes during pathogen acquisition, establishment and transmission. Understanding the molecular events on the tick-host-pathogen interface may lead to development of new strategies to control tick-borne diseases. |
Frontiers in cellular and infection microbiology. 2013 Aug 20;3:43. | vector; tick; tick saliva |
| Keating K, Walko C, Stephenson B, O’Neil BH, Weiss J. | 2014 | Incidence of cetuximab-related infusion reactions in oncology patients treated at the University of North Carolina Cancer Hospital. Purpose: The primary purpose of this study was to determine the rate of infusion reactions to cetuximab in oncology patients treated at the University of North Carolina Cancer Hospital. Secondarily, we sought to evaluate predictors of grade 3–4 hypersensitivity, including geography. Methods: Data were collected by retrospective chart review for patients treated with cetuximab at the University of North Carolina Cancer Hospital between 15 November 2006 and 31 December 2010. Data were analyzed for occurrence of hypersensitivity reaction in 125 patients with various cancer types. Results: Of the 125 subjects, 31 (24.8%) experienced an infusion reaction of any grade. Of 125, 18 (14.4%) experienced a grade 3 or 4 reaction. The odds ratio for patients with an allergy history having a grade 3 or 4 reaction was 2.57 (95% CI 0.93 to 7.09, p = 0.07). Pretreatment with steroids was associated with absence of grade 3 or 4 reaction with an odds ratio of 0.21 (95% CI 0.05 to 0.83, p = 0.04). Mapping of reaction rates by county revealed higher rates in some of the more rural counties of North Carolina, however, statistical power was lacking. Conclusions: Rates of hypersensitivity reaction at UNC are similar to rates seen in other areas of the southeastern United States and higher than in other regions of the United States and Europe. Rates of both hypersensitivity reactions and grade 3 to 4 hypersensitivity reactions have not substantially changed over time. Geography, allergy history, and perhaps smoking or cancer type may help predict who will react to cetuximab. Steroids should be strongly considered as premedication in addition to diphenhydramine. |
Journal of Oncology Pharmacy Practice. 2014 Dec;20(6):409-16. | prevalence; biologic; biological agent; monoclonal antibody; mAb, cetuximab |
| Keet C, McGowan EC, Jacobs D, Post WS, Richards NE, Workman LJ, Platts-Mills TA, Manichaikul A, Wilson JM. | 2023 | IgE to common food allergens is associated with cardiovascular mortality in the National Health and Examination Survey and the Multi-Ethnic Study of Atherosclerosis. |
Journal of Allergy and Clinical Immunology. 2023 Nov 9. | cardiovascular disease; coronary artery disease; atherosclerosis; immunoglobulin E; IgE |
| Keleş Ş, Gündüz M. | 2019 | Alpha gal specific IgE positivity due to tick bites and red meat allergy: the first case report in Turkey. Galactose-alpha-1,3-galactose is a carbohydrate moiety found in the cell membranes of many organisms, commonly known as alpha-gal (alpha-Gal). This oligosaccharide is not found in the group of primates in which humans are involved. It has been found that alpha-Gal plays a key role in delayed IgE-mediated red meat allergy and this allergen is triggered by tick bites. Here we present a 7-year-old boy with alpha-gal allergy from Turkey. |
Turk J Pediatr. 2019;61(4):615-617. | Keles; GunduzAsia; Europe; Turkey; |
| Kelly EA, Pochan SL, James HR, Workman LJ, Heymann PW, Commins SP, Platts-Mills TA. | 2011 | IgE Antibodies To The Oligosaccharide Galactose-Alpha-1,3-Galactose (Alpha-Gal) Cross-React With Cat Allergens But Are Not Associated With Asthma. RATIONALE: In contrast to most food allergic patients, relatively few patients with delayed anaphylaxis after ingestion of mammalian meat and IgE specific for galactose-alpha-1,3-galactose (a-gal) suffer from atopic diseases. While these individuals frequently have IgE to cat, only a minority report symptoms of asthma. METHODS: Sera from 97 subjects with mammalian meat allergy, 42 asthmatics, and 52 controls were assayed for total serum IgE and IgE to a-gal and several inhalant allergens. Spirometry and eNO were performed as markers of asthma. RESULTS: The prevalence of asthma amongst these meat allergic subjects was 17%, surprisingly low given that 86% of these subjects have IgE to cat epithelium. The mean FEV1/FVC amongst meat allergic subjects was 0.78, not significantly different from controls at 0.82 (p5NS), compared to 0.72 in asthmatics (p50.02). Likewise, the mean eNO of meat allergic subjects was 22 ppb (16 ppb in controls, p5NS), significantly lower than that of asthmatics at 56 ppb (p50.001). While most had IgE to cat epithelium, only 22% had IgE to Fel d 1, the difference attributed to a-gal moieties present in cat epithelium. Separating out those subjects with IgE to both a-gal and cat epithelium, but not Fel d 1, who were living with a cat in the home, we found the prevalence of asthma dropped to 9%, mean FEV1 of 101%, FEV1/FVC 0.81, and eNO 18 ppb. . CONCLUSIONS: Despite a history of food-related urticaria, angioedema, and anaphylaxis, elevated total IgE, and IgE to cat, patients with mammalian food allergy do not have increased risk for asthma. |
Curr Allergy Asthma Rep. 2017 Jan; 17(1): 8. | cat; asthma |
| Kelly LA, Pochan SL, James HR, Workman LJ, Heymann PW, Commins SP, Platts-Mills TA. | 2012 | Ectoparasite Induced Elevations of alpha-gal Specific IgE are Associated with Increased Total Serum IgE and Cat Sensitization but not with Asthma. PURPOSE OF REVIEW: The objective is to discuss recent progress in our understanding of the role of the indoor environment in asthma, focusing on the special role of cat allergens. RECENT FINDINGS: Sensitization to Fel d 1 is the dominant event in inhalant responses to cat; however, there are also IgE responses to the lipocalin (Fel d 4), to cat albumin (Fel d 2), and to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) on cat IgA (Fel d 5w) and other molecules. The dose response and routes of sensitization for these allergens are now thought to be diverse. It is important to remember that exposure outside a house with a cat is sufficient to cause sensitization. Furthermore, the only solid evidence about a role in asthma relates to Fel d 1. Recently, it has been shown that tolerance associated with early exposure to cats can persist to age 18 and that IgE to alpha-gal (on cat IgA) is not related to asthma. In addition, a recent study of anti-IgE reinforces the evidence that IgE antibodies to indoor allergens make a major contribution to asthma severity. SUMMARY: Exposure to Fel d 1 in a home with a cat is far higher than the levels necessary to induce an allergic (IgE antibody) response. In keeping with that, children may develop tolerance, which can be long-lived. In addition, there is increasing evidence that IgE antibodies to an inhalant allergen, such as Fel d1, dust mite, or cockroach, are causally related to lung inflammation and asthma. |
Journal of Allergy and Clinical Immunology. 2012 Feb 1;129(2):AB7. | cat; asthma |
| Kelly LA, Pochan SL, James HR, Workman LJ, Heymann PW, Commins SP, Platts-Mills TA. | 2011 | Delayed Anaphylactic Reactions to Mammalian Meat are not Associated with an Increased Prevalence of Asthma. RATIONALE: In contrast to most food allergic patients, relatively few patients with delayed anaphylaxis after ingestion of mammalian meat and IgE specific for galactose-alpha-1,3-galactose (a-gal) suffer from atopic diseases. While these individuals frequently have IgE to cat, only a minority report symptoms of asthma. METHODS: Sera from 97 subjects with mammalian meat allergy, 42 asthmatics, and 52 controls were assayed for total serum IgE and IgE to a-gal and several inhalant allergens. Spirometry and eNO were performed as markers of asthma. . RESULTS: The prevalence of asthma amongst these meat allergic subjects was 17%, surprisingly low given that 86% of these subjects have IgE to cat epithelium. The mean FEV1/FVC amongst meat allergic subjects was 0.78, not significantly different from controls at 0.82 (p5NS), compared to 0.72 in asthmatics (p50.02). Likewise, the mean eNO of meat allergic subjects was 22 ppb (16 ppb in controls, p5NS), significantly lower than that of asthmatics at 56 ppb (p50.001). While most had IgE to cat epithelium, only 22% had IgE to Fel d 1, the difference attributed to a-gal moieties present in cat epithelium. Separating out those subjects with IgE to both a-gal and cat epithelium, but not Fel d 1, who were living with a cat in the home, we found the prevalence of asthma dropped to 9%, mean FEV1 of 101%, FEV1/FVC 0.81, and eNO 18 ppb. . CONCLUSIONS: Despite a history of food-related urticaria, angioedema, and anaphylaxis, elevated total IgE, and IgE to cat, patients with mammalian food allergy do not have increased risk for asthma. |
Journal of Allergy and Clinical Immunology. 2011 Feb 1;127(2):AB4. | cat; asthma |
| Kelso JM. | 2022 | The adverse reactions to vaccines practice parameter 10 years on-what have we learned?. Objective: To provide updated information on the evaluation and management of adverse reactions to vaccines. Data Sources: PubMed (MEDLINE) search since publication of a practice parameter in 2012. Study Selections: Original articles and guidelines on adverse reactions to vaccines, including vaccines against severe acute respiratory syndrome coronavirus 2 or coronavirus disease 2019 (COVID-19). Results: Current guidelines conclude that patients with egg allergy are not at increased risk for reaction to egg-based influenza vaccines. Except for gelatin, most patients with allergy to vaccine constituents tolerate vaccines containing them. Most patients who have immediate reactions after receiving COVID-19 vaccines go on to receive a subsequent dose uneventfully. Conclusion: The risk of reactions to vaccination should be weighed against the risk of having a vaccine-preventable disease if the vaccine is withheld. There is no need to ask about egg allergy before the administration of influenza vaccines, including on screening forms. In most cases, an allergy to a vaccine constituent is not a contraindication to the vaccine containing it. Patients who have had possible anaphylactic reactions to vaccines should be evaluated by an allergist rather than simply being labeled allergic, because most can go on to receive subsequent doses. Most immediate reactions to COVID-19 vaccines are not allergic, and care should be taken to not label such reactions as anaphylactic. The role, if any, of polyethylene glycol in these reactions has yet to be revealed. |
Annals of Allergy, Asthma & Immunology. 2022 Jan 31. | medical products; vaccines; vaccination; gelatin; graded dosing; vaccination protocol |
| KEMOKLIDZE T, MATSABERIDZE A, BREGVADZE L, CHKHEIDZE A, KAKABADZE A, KHARITONISHVILI N. | 2024 | ALPHA-GAL SYNDROME-AGS. |
Experimental and Clinical Medicine Georgia. 2024 Dec 2(6):29-33. | Europe; Georgia |
| Kennedy JL, Stallings AP, Platts-Mills TA, Oliveira WM, Workman L, James HR, Tripathi A, Lane CJ, Matos L, Heymann PW, Commins SP. | 2013 | Galactose-alpha-1,3-galactose and Delayed Anaphylaxis, Angioedema, and Urticaria in Children. BACKGROUND AND OBJECTIVE: Despite a thorough history and comprehensive testing, many children who present with recurrent symptoms consistent with allergic reactions elude diagnosis. Recent research has identified a novel cause for "idiopathic" allergic reactions; immunoglobulin E (IgE) antibody specific for the carbohydrate galactose-alpha-1,3-galactose (alpha-Gal) has been associated with delayed urticaria and anaphylaxis that occurs 3 to 6 hours after eating beef, pork, or lamb. We sought to determine whether IgE antibody to alpha-Gal was present in sera of pediatric patients who reported idiopathic anaphylaxis or urticaria. METHODS: Patients aged 4 to 17 were enrolled in an institutional review board-approved protocol at the University of Virginia and private practice allergy offices in Lynchburg, VA. Sera was obtained and analyzed by ImmunoCAP for total IgE and specific IgE to alpha-Gal, beef, pork, cat epithelium and dander, Fel d 1, dog dander, and milk. RESULTS: Forty-five pediatric patients were identified who had both clinical histories supporting delayed anaphylaxis or urticaria to mammalian meat and IgE antibody specific for alpha-Gal. In addition, most of these cases had a history of tick bites within the past year, which itched and persisted. . CONCLUSIONS: A novel form of anaphylaxis and urticaria that occurs 3 to 6 hours after eating mammalian meat is not uncommon among children in our area. Identification of these cases may not be straightforward and diagnosis is best confirmed by specific testing, which should certainly be considered for children living in the area where the Lone Star tick is common. |
Pediatrics. 2013 May 1;131(5):e1545-52. | pediatrics |
| Kersh GJ, Salzer J, Jones ES, Binder AM, Armstrong PA, Choudhary SK, Commins GK, Amelio CL, Kato CY, Singleton J, Biggerstaff BJ | 2022 | Tick bite as a risk factor for alpha-gal specific IgE antibodies and development of alpha-gal syndrome. Background: The disaccharide galactose-α-1,3-galactose (alpha-gal) is expressed in mammals other than humans, apes, and old-world monkeys. In humans, elevated immunoglobulin-E (IgE) antibodies specific for alpha-gal can result in allergic hypersensitivity known as alpha-gal syndrome (AGS). Case reports and series suggest that tick bites can induce alpha-gal specific IgE antibodies. Objective: Evaluate tick exposure as a risk factor for AGS and elevated alpha-gal specific IgE (sIgE). Methods: We conducted a case-control study comparing AGS patients from a North Carolina allergy clinic with controls who were patients at a nearby internal medicine clinic. Cases and controls were administered a questionnaire to obtain information about demographics, home environment, outdoor activities, and recollection of tick bite. Serum samples taken at the time of enrollment were tested for total IgE, alpha-gal sIgE, and antibodies to other tickborne pathogens. Results: AGS patients were more likely to recall finding a tick on themselves (OR=11.20, 95% CI 4.97-25.15), live near wooded forest (OR=2.27, 95% CI 0.92-5.55), and spend 17 or more hours per week outdoors in wooded areas (OR=5.58, 95% CI 2.56-12.19). AGS patients were also more likely to report 4 or more tick bites (OR=33.05, 95% CI 9.92-155.12) and reactions at the site of tick bites (OR=7.93, 95% CI 3.74-16.80). Elevated alpha-gal sIgE was also observed in 33% of controls and was also associated with tick exposure in the controls (OR=4.25, 95% CI 2.21-8.18). Conclusion: The results define tick bite as a risk factor for AGS and elevated alpha-gal sIgE. |
Annals of Allergy, Asthma & Immunology. 2022 Nov 26. | Ticks; risk factors; etiology |
| Khoury JK, Khoury NC, Schaefer D, Chitnis A, Hassen GW. | 2018 | A tick-acquired red meat allergy. Allergic reaction is a common clinical picture in the Emergency Department (ED). Most allergic reactions are from food or drugs. A detailed history is an integral aspect of determining the causative agent of an allergy. Galactose-alpha-1,3-galactose (alpha-gal) allergy is a tick-acquired red meat allergy that causes delayed-onset allergic reaction or anaphylaxis due to molecular mimicry. Alpha-gal allergy may not be widely known as a cause of allergic reactions. Lack of universal awareness of this phenomenon in the ED and Urgent Care setting could lead to misdiagnosis, or delayed diagnosis. Subsequently, lack of proper instruction to avoid red meat could put patients at risk for future attacks with morbidity or mortality. We report three cases of allergic reaction presumed from red meat consumption secondary to alpha-gal allergy. |
The American Journal of Emergency Medicine. 2018 Feb 1;36(2):341-e1. | Emergency medicine; first responders; ER; urgent care |
| Kieber‐Emmons A, Monzavi‐Karbassi B, Kieber‐Emmons T. | 2020 | Antigens: Carbohydrates II. eLS.:1-29. Glycosylation is critical for a wide range of biological processes across both normal and disease states. Carbohydrate antigens, for example, are polymeric chains of diverse monomeric sugar molecules that play a fundamental role in the pathogenicity and virulence of many organisms. Moreover, these pathogen‐associated glycan structures can also be found in association with other types of cells, including tumours. These types of glycan commonalities have helped generate critical discoveries in terms of glycan structure, allowing for the development of working hypotheses for their functions, in addition to the development of agents that target or mediate their expression levels. Therefore, through discussion of glycans as antigens, new insights of key molecular and cellular interactions between them and immune cells can be discerned, and the implication of these interactions in health and disease is enhanced. Numerous reviews and even this ELS series have described the structure of carbohydrates and glycans in general. |
Antigens: Carbohydrates II. 2020; eLS 1-29 | glycan antigen; carbohydrate; glycomics |
| Kiewiet MB, Apostolovic D, Grundstrom J, Starkhammar M, Hamsten C, van Hage M. | 2019 | Clinical and serological characterization of a large cohort of red meat allergic patients from Sweden. Background: Red meat allergy is a novel form of food allergy recognized worldwide. The patients experience severe allergic reactions several hours after meat consumption and have IgE antibodies directed against the carbohydrate galactose‐α1,3‐galactose (α‐Gal), which is present in mammalian meat. The onset of the disease is associated with tick bites. Here, we characterize a cohort of red meat allergic patients from Sweden on a clinical and serological level. Method: A total of 137 patients were enrolled in the study by a physician experienced in allergic disease, after they were diagnosed with red meat allergy. All had answered to a detailed questionnaire regarding symptoms related to meat intake and tick exposure. The patient sera were analysed for IgE reactivity against protein extract from the European tick Ixodes ricinus (streptavidin ImmunoCAP) and birch and timothy pollen using the ImmunoCAP System (Thermofisher Scientific, Uppsala, Sweden). The limit of detection was set at 0.1 kUA/L. . Results: All patients were IgE positive to α‐Gal and the median α‐Gal IgE level of the cohort was 17.4 kUA/L (range 0.26‐144 kUA/L). Sensitization to pork and beef was observed in 98% and 98.5% of the patients, respectively. They all suffered from the “classical” α‐Gal‐syndrome with delayed severe symptoms after mammalian meat consumption. Nearly half (47%) reported anaphylaxis. The majority reported urticaria (91%) and gastrointestinal symptoms (75%) and more than half (60%) experienced angioedema. Neither the anti‐α‐Gal IgE/total IgE ratio nor the anti‐α‐Gal levels were associated with symptom severity. The median age of the patients at time of inclusion was 49 years and men and women were in equal numbers. All but three belonged to the B‐negative blood groups (A/O). All patients but one reported that they had been tick bitten and 77% were IgE positive to Ixodes ricinus. Also, 44% of the patients were clinically diagnosed with airborne allergies, and sensitization to birch and timothy was observed in 72% and 63% of these subjects respectively. . Conclusion: The awareness of the α‐Gal syndrome is increasing in Sweden. In this large cohort of patients almost half experienced anaphylactic shock pointing to the severity of the disease. All but one patient had been tick bitten underlining the strong relationship with tick bites. Pollen sensitization and the traditional atopic phenotype with airborne allergy was found to be common among these patients. |
Allergy 2019 Aug 1; 74:877-877. | Europe; Sweden; |
| Kiewiet MB, Apostolovic D, Starkhammar M, Grundström J, Hamsten C, van Hage M. | 2020 | Clinical and serological characterization of the α-Gal syndrome-importance of atopy for symptom severity in a European cohort. Background: The galactose-α1,3-galactose (α-Gal) syndrome (AGS) is a novel form of food allergy. Patients experience delayed severe allergic reactions after mammalian meat consumption due to IgE antibodies directed against the carbohydrate α-Gal present in mammalian meat. The onset of the disease is associated with tick bites. Objective: To characterize a cohort of patients with AGS from Sweden on a clinical and serological level, and identify risk factors for disease severity. . Methods: A total of 128 patients with symptoms after mammalian meat intake and IgE to α-Gal were included. Medical examination and diagnosis were made by an allergologist and questionnaires were filled in regarding onset of symptoms, tick exposure, and airborne allergies. Serum IgE reactivity against multiple food and airborne allergens, as well as protein extract from the tick Ixodes ricinus, was measured using ImmunoCAP. . Results: The majority of patients were middle aged, with equal gender distribution. Nearly all reported symptoms more than 2 hours after meat consumption. Urticaria (90%) and gastrointestinal symptoms (74%) were most common. Almost half of the patients suffered from anaphylaxis, and α-Gal IgE levels were significantly higher among these patients compared with those without anaphylaxis. Nearly all patients had been tick bitten and 75% had IgE against I. ricinus. More than half of the patients with AGS were atopic, and atopy increased the risk of anaphylaxis with pulmonary manifestations. Only 2 patients belonged to blood group B/AB. . Conclusion: AGS is an upcoming food allergy where patients report severe symptoms and tick bites. Atopy was found to affect the manifestation of the disease in Swedish patients. . |
J Allergy Clin Immunol Pract. 2020 Mar 3;8(6):2027-34.e2. | Europe; Sweden; atopy gastrointestinal symptoms; GI; Ixodes ricinus; blood type; airborne allergy; gastroenterology |
| Kiewiet MB, Grundström J, Apostolovic D, Andersson M, Borres MP, Hamsten C, Starkhammar M, van Hage M. | 2020 | Elucidating the α‐Gal syndrome at the molecular allergen level. |
Allergy. 2020 Nov 18. | Molecular; lactoferrin; pet dander; anaphylaxis; diagnosis; Europe; Sweden; |
| Kiewiet MB, Perusko M, Grundström J, Hamsten C, Starkhammar M, Apostolovic D, van Hage M. | 2022 | Cross-reactivity between tick and wasp venom can contribute to frequent wasp sensitization in patients with the α-Gal syndrome Background: α-Gal syndrome (AGS) is a food allergy with severe delayed allergic reactions, mediated by IgE-reactivity to galactose-α1,3-galactose (α-Gal). AGS is strongly associated with tick bites. An increased incidence of venom sensitization has been found in AGS patients. Here, we evaluated the frequency of wasp sensitization in Swedish AGS patients and the possible cross-reactivity between wasp venom and tick proteins. Methods: Sera from 136 Swedish AGS patients and 29 wasp-positive non-AGS control sera were analyzed for IgE-reactivity against wasp venom (Vespula spp.), the European tick Ixodes ricinus (Streptavidin ImmunoCAP), α-Gal and total IgE by ImmunoCAP. The presence of α-Gal on wasp venom proteins (Vespula vulgaris) was investigated by western blot (WB), and possible cross-reactivity between wasp venom and tick proteins by enzyme-linked immunosorbent assay and WB. Involvement of cross-reactive carbohydrate domains (CCDs) was also assessed. Results: Wasp sensitization was present in 54% of AGS patients, although the IgE levels were low. Wasp sensitized patients had higher IgE levels to α-Gal and total IgE levels compared to non-wasp sensitized AGS patients. α-Gal was not detected in wasp venom, but cross-reactivity between wasp and tick proteins was demonstrated which was not dependent on CCDs. The same cross-reactivity was also observed in the control sera. Furthermore, 17 putative cross-reactive peptides were identified using an in silico approach. Conclusions: For the first time, cross-reactivity between wasp venom and tick proteins has been described. This may be a reason why the majority of Swedish AGS patients, who have all been tick bitten, are also sensitized against wasp. |
Clinical and Translational Allergy. 2022 Jan;12(1):e12113. | vector; hymenoptera; wasp; cross-reactivity; Europe; Sweden; |
| Kile MR, Lucas MD, Ganguli MP, Dimov V. | 2023 | The Feline and the Swine: A Peculiar Case in an Allergy Clinic. |
Cureus. 2023 Sep 30;15(9). | pork-cat syndrome |
| Kilmarx SE, Balsam LB. | 2021 | Commentary: Alpha-gal syndrome and cardiac implant durability. |
The Journal of Thoracic and Cardiovascular Surgery. 2022 Dec 1;164(6):e426-7. | medical products; heart valves; bioprosthetic heart valves; cardiology; cardiac; cardiovascular surgery |
| Kim HO, Cho SI, Kim JH, Chung BY, Cho HJ, Park CW, Lee CH. | 2013 | Food hypersensitivity in patients with childhood atopic dermatitis in Korea. Background: It is well known that atopic dermatitis (AD) is related to food hypersensitivity, although its prevalence varies among several studies according to age group, severity, country, survey time, and test method. Objective: To examine the prevalence and status of food hypersensitivity among childhood AD patients in Korea. Methods: A total of 95 patients were enrolled in the study. The history of food hypersensitivity was collected by interviews. The severity of AD was evaluated by eczema area and severity index (EASI). We took blood samples to measure serum total and food-specific immunoglobulin E (IgE) levels. Based on the histories and serum IgE levels, open oral food challenge (OFC) testing was performed to confirm food hypersensitivity. Results: Forty-two (44.2%) of the 95 AD patients had histories of food hypersensitivity. They reported that the most common suspicious foods were egg (n=13, 13.7%), pork (n=9, 9.5%) and cow milk (n=8, 8.4%). The mean EASI score was 16.05±9.76. Thirty-nine (41.1%) of the 95 patients showed elevated serum food-specific IgE levels. The specific IgE levels were elevated for egg (n=17, 17.9%), milk (n=12, 12.6%), peanut (n=10, 10.5%) and wheat (n=8, 8.4%). Fifty-one (53.8%) of 95 patients underwent open OFC, and only 7 (13.7%) of these patients showed positive reactions. Conclusion: The overall prevalence of food hypersensitivity in patients with childhood AD in Korea was 8.3% (7/84). The most common foods causing food hypersensitivity were egg and milk. Among the foods causing hypersensitivity, AD patients in Korea often underestimated peanut, while they overestimated pork. |
Annals of dermatology. 2013 May 1;25(2):196-202. | Asia; Korea; prevalence; pork allergy; atopic dermatitis; dermatology |
| Kim J, Kwon J, Noh G, Lee SS. | 2013 | The effects of elimination diet on nutritional status in subjects with atopic dermatitis. A food allergy is an adverse health effect arising from a specific immune response that occurs reproducibly upon exposure to a given food. In those with food allergies that are thought to cause aggravation of eczema, food avoidance is important. The objective of this study was to research the nutritional status of patients with food allergies. A total of 225 subjects diagnosed with atopic dermatitis underwent a skin prick test as well as measurement of serum immunoglobulin E. Food challenge tests were conducted using seven food items: milk, eggs, wheat, soybeans, beef, pork, and chicken. At post-food challenge visits to the test clinic, participants completed a three-day dietary record, which included two week days and one weekend day, in order to evaluate energy intake and diet quality during the challenge. We analyzed nutrient intake based on differential food allergens. Subjects with a food allergy to milk showed lower intake of Ca, Zn, and vitamin B2, and subjects with a food allergy to egg showed lower intake of vitamin A, B1, B2, niacin, and cholesterol. Subjects with a food allergy to wheat and soybean showed lower intake of Ca, P, Fe, K, Zn, vitamin B2, vitamin B6, and niacin; and subjects with a food allergy to beef, pork, and chicken showed lower intake of Fe and higher intake of K, vitamin A, B2. Subjects with atopic dermatitis were lacking in several nutrients, including vitamin A and vitamin C. A greater number of food allergies showed an association with a greater number of nutrient intake deficiencies. Allergen avoidance is the basic treatment for atopic dermatitis. However, when the allergen is food, excessive restriction can lead to nutrition deficiency. Findings of this study suggest the necessity for enhanced nutritional education in order to provide substitute foods for patients with food allergies who practice food restriction. |
Nutrition Research and Practice. 2013 Dec 1;7(6):488-94. | |
| Kim JH, An S, Kim JE, Choi GS, Ye YM, Park HS. | 2010 | Beef-induced anaphylaxis confirmed by the basophil activation test. Beef allergies are relatively rare, especially in adults. However, clinical manifestations can vary from urticaria, angioedema, anaphylaxis to gastrointestinal symptoms. Currently available tests, such as skin testing or in vitro determination of beef-specific immunoglobulin E (IgE), do not provide an accurate diagnosis of beef allergy. The recent development of the basophil activation test (BAT) presents a new opportunity for the diagnosis of food allergies. Here, we report a 37-year-old woman with a history of recurrent generalised urticaria, nausea, vomiting and hypotension after ingestion of beef, suggesting a beef allergy. Although the skin prick test and serum specific IgE to beef, pork and milk allergens showed negative results using commercial kits, the BAT showed significant upregulation of CD203c in a dose-dependent manner compared to both non-atopic and atopic controls. To our knowledge, this is the first case study of beef allergy consisting of a non-IgE-mediated reaction. The detection of food allergies using direct basophil activation is suggested to complement conventional diagnostic tests. |
Allergy, asthma & immunology research. 2010 Jul 1;2(3):206-8. | Asia; Korea; beef allergy; basophil activation test; CD203c |
| Kim MS, Straesser MD, Keshavarz B, Workman L, McGowan EC, Platts-Mills TA, Wilson JM. | 2019 | * IgE to galactose-alpha-1,3-galactose wanes over time in patients who avoid tick bites. Galactose-a-1,3-galactose (a-Gal) is an oligosaccharide of nonprimate mammals and the target of IgE antibodies in the syndrome of delayed anaphylaxis to mammalian meat. The connection between IgE sensitization to a-Gal and tick bites is now well established, and in North America, the a-Gal syndrome has consistently been associated with Amblyomma americanum. Case reports and clinical experience suggest that levels of IgE to a-Gal can decrease over time in some patients, particularly those who avoid additional tick exposures, but the natural history of IgE to a-Gal has not been systematically examined. Here we report results of a retrospective investigation into the trend and rate of changes in a-Gal specific IgE (sIgE) and total IgE in relation to tick exposure in subjects with established a-Gal syndrome. Clinical Implications • IgE specific to galactose-α-1,3-galactose (α-Gal) and total IgE decrease over time in patients with α-Gal syndrome who avoid further tick bites. These findings provide further support for the connection between tick bites and the pathogenesis of the syndrome. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 Jan 1;8(1):364-7. | |
| Kim TK, Tirloni L, Pinto AF, Diedrich JK, Moresco JJ, Yates III JR, da Silva Vaz Jr I, Mulenga A. | 2020 | Time-resolved proteomic profile of Amblyomma americanum tick saliva during feeding. PLoS neglected tropical diseases. Amblyomma americanum ticks transmit more than a third of human tick-borne disease (TBD) agents in the United States. Tick saliva proteins are critical to success of ticks as vectors of TBD agents, and thus might serve as targets in tick antigen-based vaccines to prevent TBD infections. We describe a systems biology approach to identify, by LC-MS/MS, saliva proteins (tick = 1182, rabbit = 335) that A. americanum ticks likely inject into the host every 24 h during the first 8 days of feeding, and towards the end of feeding. Searching against entries in GenBank grouped tick and rabbit proteins into 27 and 25 functional categories. Aside from housekeeping-like proteins, majority of tick saliva proteins belong to the tick-specific (no homology to non-tick organisms: 32%), protease inhibitors (13%), proteases (8%), glycine-rich proteins (6%) and lipocalins (4%) categories. Global secretion dynamics analysis suggests that majority (74%) of proteins in this study are associated with regulating initial tick feeding functions and transmission of pathogens as they are secreted within 24–48 h of tick attachment. Comparative analysis of the A. americanum tick saliva proteome to five other tick saliva proteomes identified 284 conserved tick saliva proteins: we speculate that these regulate critical tick feeding functions and might serve as tick vaccine antigens. We discuss our findings in the context of understanding A. americanum tick feeding physiology as a means through which we can find effective targets for a vaccine against tick feeding. |
PLoS neglected tropical diseases. 2020 Feb 12;14(2):e0007758. | |
| Kim YG, Gil GC, Harvey DJ, Kim BG. | 2008 | Structural analysis of α‐Gal and new non‐Gal carbohydrate epitopes from specific pathogen‐free miniature pig kidney. The major barrier in transplantation of pig organs into humans is the presence of surface carbohydrate antigens (e.g., the Galα1‐3Galβ1‐4GlcNAc‐R (α‐Gal) epitope) expressed on pig endothelial cells. In this study, total N‐glycans from membrane glycoproteins derived from specific pathogen‐free miniature pig kidney are identified by MALDI‐TOF, negative ion ESI MS/MS and normal‐phase HPLC (NP‐HPLC) combined with exoglycosidase digestion. Over 100 N‐glycans, including sialylated and neutral types, were identified. As well as the known α‐Gal antigens, some of these glycans contained novel non‐Gal carbohydrate antigens such as (Neu5Gc‐Gal‐GlcNAc) and Galα1‐3Lewisx (Gal‐Gal‐(Fuc)GlcNAc) which have not been reported before in N‐glycans from pig organs. The ability of MALDI, ESI, and HPLC to measure the relative proportions of the glycans was evaluated. The HPLC resolution was insufficient for accurate work and some minor differences were noted in the ionization efficiencies of different glycan groups when measured by the two mass spectrometric techniques. However, the results indicated that the relative quantity of α‐Gal epitope was in the region of 50% of the complex glycans. High‐mannose type glycans were also abundant (35–43%) but appeared to be ionized more efficiently than the complex glycans by ESI than by MALDI. |
Proteomics. 2008 Jul;8(13):2596-610. | |
| Kimpel D, Wilson J, Lewis J. | 2019 | *SERO-REACTIVITY TO GALACTOSE-ALPHA-1,3-GALACTOSE AND CLINICAL PRESENTATIONS OF PATIENTS SEEN IN A RHEUMATOLOGY OUTPATIENT PRACTICE. Background: Analphylactic reactions to cetuximab, a monoclonal antibody used in cancer therapy, were recognized in 2007 as a regional complication related to recognition of a protein epitope by IgE. This protein epitope was defined as galactose-alpha-1,3-galactose (alpha-gal), which is found in non-primate mammalian tissue. Reactivity to this epitope was also found to occur after meat consumption with manifestations including anaphylaxis, urticaria, or angioedema. Further study showed that reactivity was induced by tick bites from the Lone Star tick. Similar cases of reaction to red meat have been described in Australia in 2006, and more recently in Japan and various European countries. In our Rheumatology practices where patients often raise concerns about possible tick-borne illnesses, we have observed patients presenting with symptoms related to consumption of mammalian meat, but generally less severe, and with IgE reactivity to alpha-gal. Objectives: We have characterized the range of presenting symptoms in our alpha-gal positive patients, and their response to dietary modification. . Methods: Patients referred to this Rheumatology practice who had known exposure or risk factors for tick exposure were tested for IgE antibodies against galactose-alpha-1,3-galactose (alpha-gal) using a standardized test administered by Viacor-IBT, and also tested for typical Rheumatologic markers, as indicated by their symptoms. Alph-gal IgE levels varied from 0.38 to >100 kU/L (normal <0.35 kU/L). . Results: 147 patients were identified as positive for alpha-gal, and were recommended to avoid mammalian meat. Followup testing and evaluation was achieved in 38 patients, along with documentation of symptoms for improvement or persistence. Clinical manifestations, laboratory findings, and reasons for referral in symptomatic alpha-gal positive patients were diverse. Dermatologic manifestations occurred in 9 including urticarial vasculitis, serpiginous urticarial rash, purpuric rash, psoriasiform rash, nummular eczema, and subcutaneous nodules. Arthritic manifestations varied and included monoarthritis (one patient, with negative Lyme PCR of fluid), oligoarthritis in 2 patients, inflammatory polyarthritis in 10 who did not meet criteria for a diagnosis of RA, and polyarthralgia in 22. 15 patients were diagnosed with Rheumatoid Arthritis, and 13 with Spondyloarthritis. 28 patients were referred with positive ANA tests. 25 were felt to be false positive ANAs who did not meet criteria for any connective tissue disease. Anticardiolipin antibodies were present in 4 patients. Surprisingly only 11 patients had a history of severe reaction to mammalian meat, and only one had been previously diagnosed with mammalian meat allergy Of the 38 patients seen in followup, 10 reported symptom improvement with mammalian meat restriction. . Conclusion: Alpha-gal reactivity from tick bites is more common than Lyme disease or other tick-borne disease in our catchment area. The patients rarely recall distinct exposure to a Lone Start tick. Manifestations are protean, and do not correlate with alpha-gal IgE level. Some patients are shown to improve with restriction of dietary mammalian meat. Somewhat surprisingly, other patients prefer to tolerate intermittent mild symptoms to maintain current dietary patterns. In areas where Lone Star ticks are present, and in patients with risk factors for tick exposure, alpha gal IgE reactivity should be considered and tested for as part of a “tick panel” in patients who present with symptoms of potential rheumatologic diseases. |
Annals of the Rheumatic Diseases 78(Suppl. 2): 1317-1318. | atypical symptom; rheumatology; arthritis |
| Kinjo R, Kojima T, Miyamoto T, Sakaguchi T, Suzuki R. | 2024 | A Case of Anaphylactic Shock Suspected to Be Caused by Bovine Serum Albumin Tissue Adhesive (BioGlue) During Thoracoabdominal Aortic Replacement. |
Cureus. 2024 Jun 19;16(6). | medical products; BioGlue; BSA; perioperative |
| Kinoshita M, Newton S. | 2019 | Alpha-gal Allergy in a 6-Year-Old Male: A Case Report. Alpha-gal allergy is a reaction where the immunoglobulin E antibody elicits a response to galactosealpha-1,3-galactose (alpha-gal) which is a mammalian oligosaccharide epitope found in nonprimate mammalian. After being exposed to a tick bite, particularly the Lone Star tick (Amblyomma americanum), an individual has been known to develop an alpha-gal allergy. Our patient presented with symptoms of delayed-onset allergy 3-8 hours after consuming mammalian meat products including beef and pork. These symptoms can include, but not limited to, the following: urticaria, angioedema, anaphylaxis, nausea, diarrhea, indigestion. Since symptoms do not present immediately, a delay in diagnosis can occur. Our patient highlights one of the few reported childhood cases with an alpha-gal allergy. We recommend a careful history, in particular, asking if the patient has a past history of tick bites and the appearance of allergy symptoms following beef or pork consumption. |
JNMA; Journal of the Nepal Medical Association. 2019 Sep 1;57(219):379-81. | Asia; Nepal; pediatric |
| Kitajima K, Inoue S, Inoue Y. | 1989 | Isolation and characterization of a novel type of sialoglycoproteins (hyosophorin) from the eggs of medaka, Oryzias latipes: Nonapeptide with a large N-linked glycan chain as a tandem repeat unit We found a novel type of sialoglycoprotein (SGP) with apparent molecular mass ranging from 15,000 to 100,000 Da in the unfertilized eggs of the medaka fish, Oryzias latipes. From fertilized eggs we isolated the corresponding sialoglycopeptides of apparent molecular weight 7000. The amino acid and carbohydrate compositions of these glycoproteins and glycopeptides are very similar, if not identical, and they contain 90%, by weight, of carbohydrate, the predominant sugars being Gal, GlcNAc, and NeuAc. The chemical and physical data indicate that 15- to 100-kDa SGPs are made up of tandem repeat structures whose repeating unit is 7-kDa sialoglycopeptide, and, upon fertilization, higher molecular weight SGPs undergo proteolytic depolymerization to the least structural unit, 7-kDa sialoglycopeptide. As is the case with polysialoglycoproteins (PSGP) found in salmonid fish eggs, a novel family of sialoglycoproteins has been proven to be a major component of cortical alveoli of medaka eggs, namely, hyosophorin. However, we found that they differ markedly from PSGPs (salmonid fish egg hyosophorins) in terms of the carbohydrate composition. The chemical composition and the results of Smith degradation indicate that SGP contains one large N-linked glycan chain per repeat unit. We have determined the amino acid sequence of 7-kDa sialoglycopeptide: Asp-Ala-Ala-Ser-Asn∗-Gln-Thr-Val-Ser, where ∗ indicates the asparagine residue to which a large glycan chain consisting of Fuc2Man3Gal15GlcNAc9NeuAc6 is attached. The direct experimental evidence for the presence of a polyprotein structure suggests that the covalent nature of the higher molecular weight SGPs should be expressed as [Asp-Ala-Ala-Ser-Asn∗-Gln-Thr-Val-Ser]N, where N = 2 to 14 but for the major fraction N = 12. |
Developmental biology. 1989 Apr 1;132(2):544-53. | Fish; fish roe; hyosophorin |
| Kleiman AM, Littlewood KE, Groves DS. | 2017 | †Delayed Anaphylaxis to Mammalian Meat Following Tick Exposure and Its Impact on Anesthetic Management for Cardiac Surgery: A Case Report. Hypersensitivity reactions to mammalian meat following tick exposure are increasing in prevalence and provide a unique challenge to anesthesiologists. The reactions, including anaphylaxis, are delayed and therefore may not be easily recognized and treated. The risk is especially high in cardiac surgery, where several potential triggers, including biological valves as well as heparin, are used frequently. In the presence of such hypersensitivity, prophylactic measures including preoperative testing and pharmacologic prophylaxis may be useful in modulating the immune response such that triggering agents may be used relatively safely. We present 3 patients with previous sensitization to meat protein following a tick bite with known allergic reactions to mammalian meat who presented for cardiac surgery involving exposure to potential allergens and discuss the perioperative management including possible prevention. |
Case Reports 8(7): 175-177. | perioperative care; anesthesiology; anesthesia; cardiac surgery; heparin; pharmaceutical; pharmacy; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; pharmacy; pharmaceutical |
| Knight ME, Wyatt K, James HC. | 2015 | Exercise-induced anaphylaxis after consumption of red meat in a patient with IgE antibodies specific for galactose-alpha-1,3-galactose. Letter to the editor Clinical implications: Testing for alpha-gal antibodies in patients with exercise-induced anaphylaxis should be considered even if the patient has not exhibited symptoms at times not associated with exercise. |
J Allergy Clin Immunol Pract 3(5): 801-802. | cofactors; co-factors; augmentation factors; exercise; anaphylaxis |
| Knoedler A, Gupta M, Eschenbacher W, Keshavarz B, Platts-Mills T, Wilson J. | 2020 | The UVA experience with α-Gal testing: a retrospective investigation of 2456 subjects tested for α-Gal. Rationale: In 2009 our group reported that IgE to galactose-α-1,3-galactose (α-Gal) was associated with episodes of delayed anaphylaxis to mammalian meat. Since that time there has been increased recognition of “the α-Gal syndrome”, however, most studies to date have involved case series or small cohorts. Methods: In 2010 a test for serum IgE to α-Gal was introduced at the University of Virginia (UVA) clinical lab. Here we conducted a retrospective analysis of patients who had α-Gal specific IgE testing between January 1st, 2010-July 1st, 2017. We reviewed baseline characteristics, ICD codes to accompanying allergic diseases, total IgE, eosinophil counts and tryptase. . Results: There were 2456 patients with α-Gal-specific IgE testing. Using a cut-off of 0.35 IU/mL, 971 were positive (39.5%) and of these: 459 were male (47.0%), 858 were Caucasian (88.4%), the age range was 2-86 (median 52 years) and the median level of α-Gal specific-IgE was 5.7 IU/mL (IQR 1.4-18.3). Compared to the α-Gal negative group these patients were more commonly male (p <0.001), Caucasian (p<0.001) and older (p<0.001). Anaphylaxis was coded in 43.2% of the α-Gal sensitized compared to 26.9% of the non-sensitized (p<0.001). Tryptase and eosinophil counts were similar, however total IgE was greater in the α-Gal positive group (157 vs 69 IU/mL, p<0.001). . Conclusions: Between 2010 and 2017 there were almost 1000 subjects identified with positive α-Gal specific-IgE titers. Consistent with prior reports and likely related to the fact that sensitization occurs via tick bites, positive subjects were more often of older age, male and had higher total IgE levels. . |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB145. | |
| Koike C, Uddin M, Wildman DE, Gray EA, Trucco M, Starzl TE, Goodman M. | 2007 | Functionally important glycosyltransferase gain and loss during catarrhine primate emergence. A glycosyltransferase, α1,3galactosyltransferase, catalyzes the terminal step in biosynthesis of Galα1,3Galβ1–4GlcNAc-R (αGal), an oligosaccharide cell surface epitope. This epitope or antigenically similar epitopes are widely distributed among the different forms of life. Although abundant in most mammals, αGal is not normally found in catarrhine primates (Old World monkeys and apes, including humans), all of which produce anti-αGal antibodies from infancy onward. Natural selection favoring enhanced resistance to αGal-positive pathogens has been the primary reason offered to account for the loss of αGal in catarrhines. Here, we question the primacy of this immune defense hypothesis with results that elucidate the evolutionary history of GGTA1 gene and pseudogene loci. One such locus, GGTA1P, a processed (intronless) pseudogene (PPG), is present in platyrrhines, i.e., New World monkeys, and catarrhines but not in prosimians. PPG arose in an early ancestor of anthropoids (catarrhines and platyrrhines), and GGTA1 itself became an unprocessed pseudogene in the late catarrhine stem lineage. Strong purifying selection, denoted by low nonsynonymous substitutions per nonsynonymous site/synonymous substitutions per synonymous site values, preserved GGTA1 in noncatarrhine mammals, indicating that the functional gene product is subjected to considerable physiological constraint. Thus, we propose that a pattern of alternative and/or more beneficial glycosyltransferase activity had to first evolve in the stem catarrhines before GGTA1 inactivation could occur. Enhanced defense against αGal-positive pathogens could then have accelerated the replacement of αGal-positive catarrhines by αGal-negative catarrhines. However, we emphasize that positively selected regulatory changes in sugar chain metabolism might well have contributed in a major way to catarrhine origins. |
Proceedings of the National Academy of Sciences. 2007 Jan 9;104(2):559-64. | primate evolution; galactosyltransferase; glycosyltransferase |
| Kollmann D, Nagl B, Ebner C, Emminger W, Wöhrl S, Kitzmüller C, Vrtala S, Mangold A, Ankersmit HJ, Bohle B. | 2017 | The quantity and quality of alpha-gal-specific antibodies differ in individuals with and without delayed red meat allergy. Background: IgG to galactose-alpha-1,3-galactose (alpha-gal) are highly abundant natural antibodies (Ab) in humans. alpha-Gal-specific IgE Ab cause a special form of meat allergy characterized by severe systemic reactions 3-7 h after consumption of red meat. We investigated 20 patients who experienced such reactions and characterized their alpha-gal-specific IgE and IgG responses in more detail. . Methods: alpha-Gal-specific IgE was determined by ImmunoCAP. IgE reactivity to meat extract and bovine gamma globulin (BGG) was assessed by immunoblotting and ELISA, respectively. In some experiments, sera were pre-incubated with alpha-gal or protein G to deplete IgG Ab. alpha-Gal-specific IgG(1-4) Ab in individuals with and without meat allergy were assessed by ELISA. . Results: In immunoblots, BGG was the most frequently recognized meat protein. Binding of IgE and IgG to BGG was confirmed by ELISA and completely abolished after pre-incubation with alpha-gal. Neither the depletion of autologous alpha-gal-specific IgG Ab nor the addition of alpha-gal-specific IgG Ab from nonallergic individuals changed the IgE recognition of BGG of meat-allergic patients. Meat-allergic patients showed significantly higher alpha-gal-specific IgG1 and IgG3 Ab than nonallergic individuals, whereas the latter showed significantly higher levels of alpha-gal-specific IgG4 Ab. . Conclusion: Patients with delayed meat allergy display IgE and IgG Ab that selectively recognize the alpha-gal epitope on BGG. Their enhanced alpha-gal-specific IgE levels are accompanied by high levels of alpha-gal-specific IgG1 devoid of IgE-blocking activity. This subclass distribution is atypical for food allergies and distinct from natural alpha-gal IgG responses in nonallergic individuals. |
Allergy. 2017 Feb;72(2):266-73. | immunoglobulin g; IgG |
| Konakci KZ, Bohle B, Blumer R, Hoetzenecker W, Roth G, Moser B, Boltz‐Nitulescu G, Gorlitzer M, Klepetko W, Wolner E, Ankersmit HJ. | 2005 | Alpha‐Gal on bioprostheses: xenograft immune response in cardiac surgery. Background: The α-Gal (Galα1,3-Galβ1–4GlcNAc-R) epitope is the major xenoantigen causing hyperacute rejection of pig organs transplanted into primates. Porcine bioprostheses are utilized in cardiac surgery. However, premature degeneration of bioprostheses has limited utilization in younger patients and the immune response remains elusive. We sought to investigate whether a specific α-Gal immune response may play a role in this clinical scenario. Materials and methods: We investigated the presence of α-Gal-epitope on native and fixed porcine valves by means of confocal laser scanning microscope (CLSM). ELISA was utilized to evidence whether implantation of bioprostheses elicits augmentation of pre-existing cytotoxic anti α-Gal IgM antibodies within 10 days of surgery. Patients who underwent coronary artery bypass grafting (CABG) or mechanical valve replacement served as controls (each group, n = 12). To corroborate the clinical relevance of the α-Gal immune response in vivo, we studied serum obtained before and after implantation of bioprostheses and its potency to lyse porcine α-Gal-bearing PK15 cells. Results: We found the immunogenic α-Gal-epitope on fibrocytes interspersed in the connective tissue of porcine valves as determined by vimentin/IB4 lectin binding. Moreover, patients who were provided with a bioprostheses had developed a significant increase of naturally occurring cytotoxic IgM antibodies directed towards α-Gal after surgical intervention as compared with control patients (P < 0·0001, respectively). Sera obtained from the patients after the implantation of bioprostheses demonstrated an increased cytotoxicity against α-Gal-bearing PK-15 cells as compared with preoperative sera (P < 0·001). The specificity of the cytotoxic effects was proven as soluble Galα1–3Galβ1–4GlcNAc markedly inhibited cell death of α-Gal-bearing PK15 cells (P < 0·001). Conclusion: Our data suggest that implantation of bioprostheses in cardiac surgery induces a xenograft-specific immune response. Procedures diminishing the presence of α-Gal on bioprostheses, such as utilization of genetically manipulated α-Gal-deficient xenograft or pretreatment with α-Galactosidase, might diminuate the immune response against bioprostheses and extend durability. |
European journal of clinical investigation. 2005 Jan;35(1):17-23. | Cardiac surgery; cardiology; medical products; bioprosthetic heart valve; |
| Kondo M, Matsushima Y, Iida S, Umaoka A, Nakanishi T, Habe K, Yamanaka K. | 2021 | A Case of α-Gal-Unrelated Red Meat-Induced Urticaria Treated by Omalizumab. A 70-year-old healthy woman was referred to our hospital for chronic urticaria. She did not have a history of allergy, asthma, and rhinitis. She was initially diagnosed with α-gal-related urticaria based on an episode of delayed-type urticaria after eating red meat. The results of the intracutaneous allergen test for beef and pork were negative. Fluorenzyme immunoassays specific for IgE against α-gal, beef, and pork were also negative. She was diagnosed with an α-gal-unrelated red meat allergy following the reproduction of urticaria by a food challenge test. The patient was unresponsive to several drugs, including antihistamines or immunosuppressants. However, omalizumab administration suppressed her symptoms. Key Clinical Message: The diagnosis of red meat allergy may require a repeatability test by consuming red meat even though serum α-gal IgE antibody might be negative. The α-gal-unrelated red meat urticaria may be responsive to omalizumab. |
Case Reports in Dermatology. 2021;13:437-40. | Asia; Japan; management; treatment; omalizumab |
| Kondo M, Nakagawa T, Yamanaka K, Mizutani H. | 2017 | Case with acute urticaria by red meat after Haemaphysalis longicornis bite. Letter to the editor. No abstract available. |
The Journal of Dermatology. 2017 Jul;44(7):e168-9. | Haemaphysalis longicornis; Asian longhorned tick; tick species; Japan |
| Kondo M, Yamanaka K, Mizutani H, Isoda K, Nakamura T, Yoshida K, Mizutani H, Sekiya A, Kono M, Tsujiuchi H, Akiyama M. | 2017 | 575 Rapid changes in the red meat and alpha-Gal specific IgE-RAST level profile in the clinical course of a case with red meat allergy and Haemaphysalis longicornis bite. A case with stroke was referred to our hospital with two ticks attached on her right arm. Five days after admission, she started slurry food including red meat, and developed generalized urticarial rash. Then, she was diagnosed having urticarial allergic reaction to red meat, and red meat was eliminated from her hospital diet. The eruption disappeared within 3 days without systemic corticosteroid therapy. Her rash didn’t recur during 4 months hospitalization. High prevalence of urticarial type red meat allergy was reported in the endemic area of Japanese spotted fever, which is mediated by Haemaphysalis longicornis (H. longicornis). Then, we investigated immunological background of the present case. We performed PCR analysis of the removed tick, and confirmed it asH. longicornis after sequence analysis of the PCR product. By skin prick test with beef antigen, positive reaction was observed at the beef tested skin after 30 minutes. Then, we investigated changes in the serum red meat specific IgE levels and serum anti-galactose-alpha-1.3-galactose (α-Gal) antibody, because α-Gal is a shared epitope in red meat and saliva of H. longicornis. Her red meat specific IgE level was 11.30 Ua/ml at admission. Two days after allergic episode, it increased to 15.5 Ua/ml. At 4 days after elimination of the red meat food, it decreased to 9.23Ua/ml. The simultaneously serially measured α-Gal specific IgE-RAST levels were more than the highest detection limit through the clinical course. The present results indicate she was already sensitized to α-Gal by repeated H. longicornis bite before hospitalization. α-Gal is a shared epitope between the red meat and H. longicornis salivary antigen, and rapid changes in red meat specific IgE levels but not α-Gal specific IgE levels indicated clinical effect of elimination of red meat food in red meat allergy due to shortness of its serum half-life of IgE. |
Journal of Investigative Dermatology. 2017 May 1;137(5):S99. | Haemaphysalis longicornis; Asian longhorned tick; tick species; Japan |
| Koo G, Plager J, Fahrenholz JM, Phillips E, Stone CA. | 2022 | Reactivity to Heparin in Alpha-Gal Allergic Patients: A Potential Role for Skin Testing?. Galactose-alpha-1,3-galactose (alpha-gal) syndrome is an immunoglobulin (Ig)E-mediated allergy syndrome to an oligosaccharide found in nonprimate mammalian meat and mammalian-derived products.1 Oral consumption reactions are characteristically delayed, but are immediate with parenteral administration.1 Since the discovery of alpha-gal IgE antibodies while investigating hypersensitivity reactions to cetuximab, much attention has been paid to both theoretical risks and reported cases of hypersensitivity reactions to various medications and medical devices derived from nonprimate mammals.1,2 The true extent of this risk is still largely unknown.3 One medication of interest is heparin; both unfractionated heparin and low-molecular weight heparin, enoxaparin, are derived from porcine intestinal tissue. In a case of immediate hypersensitivity to heparin in a patient with a high concentration of alpha-gal–specific IgE (sIgE), we would like to draw attention to positive skin testing result to heparin products. |
Annals of Allergy, Asthma & Immunology. 2022 Jul 21. | medical products; drugs; surgery; pharmacology; blood thinner; diagnosis; testing; heparin |
| Kopač P, Koren A, Bidovec-Stojkovič U, Košnik M, Dejanović L, Mesti T, Strojan P, Korošec P, Ocvirk J. | 2024 | Basophil Activation Test Predicts Cetuximab Anaphylaxis Severity in Alpha-Gal IgE-Positive Patients. |
Diagnostics. 2024 Jul 1;14(13):1403. | diagnosis; basophil activation; biologics; monoclonal antibody; cetuximab |
| Kopsco HL, Duhaime RJ, Mather TN. | 2021 | Crowdsourced Tick Image-Informed Updates to US County Records of Three Medically Important Tick Species. Burgeoning cases of tick-borne disease present a significant public health problem in the United States. Passive tick surveillance gained traction as an effective way to collect epidemiologic data, and in particular, photograph-based tick surveillance can complement in-hand tick specimen identification to amass distribution data and related encounter demographics. We compared the Federal Information Processing Standards (FIPS) code of tick photos submitted to a free public identification service (TickSpotters) from 2014 to 2019 to published nationwide county reports for three tick species of medical concern: Ixodes scapularis Say (Ixodida: Ixodidae), Ixodes pacificus Cooley and Kohls (Ixodida: Ixodidae), and Amblyomma americanum Linneaus (Ixodida: Ixodidae). We tallied the number of TickSpotters submissions for each tick species according to “Reported” or “Established” criteria per county, and found that TickSpotters submissions represented more than half of the reported counties of documented occurrence, and potentially identified hundreds of new counties with the occurrence of these species. We detected the largest number of new county reports of I. scapularis presence in Michigan, North Carolina, and Texas. Tick image submissions revealed potentially nine new counties of occurrence for I. pacificus, and we documented the largest increase in new county reports of A. americanum in Kentucky, Illinois, Indiana, and Ohio. These findings demonstrate the utility of crowdsourced photograph-based tick surveillance as a complement to other tick surveillance strategies in documenting tick distributions on a nationwide scale, its potential for identifying new foci, and its ability to highlight at-risk localities that might benefit from tick-bite prevention education. |
Journal of Medical Entomology. 2021 May 11. | North America; United States; vector; tick; lone star tick; geography; distribution |
| Kopsco HL, Vaske JJ, Mateus-Pinilla N, Miller CA. | 2024 | Hunter risk sensitivity to ticks and tick-borne disease in Illinois. |
Human Dimensions of Wildlife. 2024 Mar 31:1-1. | hunting; hunters |
| Kram Y, Kosmach S, Lanser B, Rabinovitch N. | 2023 | PRIMARY BEEF ALLERGY AND SENSITIZATION TO CATTLE EPITHELIA. Introduction: Primary beef allergy is a relatively uncommon allergy. We present two children with beef allergy and discuss the unique characteristics. br> Case Description: Case 1 is a 20 months old male with history of multiple food allergies including cow's milk, several episodes of anaphylaxis, eosinophilic esophagitis, and eczema. The patient developed anaphylaxis several hours after the ingestion of beef in the form of well-cooked steak when he was 15 months old, although he was able to tolerate beef previously. His alpha-gal IgE level was 0.12 kUA/L, bovine serum albumin IgE was 4.01 kUA/L, and his cow dander IgE was 8.95 kUA/L. Case 2 is a 4 year old female who initially presented at 14 months of age with history of food allergy to cow's milk and eczema. She passed an oral food challenge to beef and introduced beef into her diet regularly, but subsequently developed recurrent abdominal pain 4-6 hours after ingestion of beef and developed anaphylaxis immediately after ingesting beef hot-dog. Her alpha-gal IgE level was 0.92 kUA/L, bovine serum albumin IgE was 66.9 kUA/L, and her cow dander IgE was 31.3 kUA/L. In both cases, there was no known exposure to ticks but direct exposure to cow dander was reported and the skin prick testing revealed sensitization to cattle epithelia. br> Discussion: Beef allergy in children may present with unusual characteristics including initial tolerance, delayed reaction hours after ingestion, and sensitization to cow's milk and dander. |
Annals of Allergy, Asthma & Immunology. 2023 Nov 1;131(5):S176-7. | primary beef allergy; delayed reaction |
| Krishna N, Krishna S, Krishna R. | 2017 | P112 Correlation between clinical findings and laboratory tests for alpha gal sensitivity. Rationale: Galactose-alpha-1,3-galactose (alpha-gal) is a carbohydrate moiety present on cells of non-primate mammalian species. After sensitization to alpha-gal, most often due to tick bites, patients reported delayed anaphylactic symptoms to red meats. Methods: The charts of 40 patients with positive symptoms and high clinical suspicion for red meat sensitivity were analyzed (18 pediatric, 22 adult). Of these, 25 tested positive to red meats by skin prick test or serum IgE assay (ImmunoCAP). Of the forty, 10 underwent alpha-gal testing at a commercial lab. The remaining 30 were untested for alpha-gal due to various reasons such as young age, or voluntarily forgoing testing. . Results: For all the 12 patients whose serums were tested, the alpha-gal lab test results were negative. We have been unable to confirm our positive clinical features with current alpha-gal lab tests, and we found 100% negative correlation between suspected alpha-gal sensitivity and the lab result. . Conclusion: Clinicians must be aware of poor cross-correlation between clinical history, skin test results and laboratory data in patients with red meat sensitivity. Clinicians should remain vigilant in cases with delayed allergic reactions following meat ingestion, relying more on their clinical acumen for further management, rather than the laboratory test for alpha-gal. Until the FDA approves an alpha-gal test with better sensitivity and specificity, it would be prudent to be skeptical of negative alpha-gal results. Reproducibility is crucial to any lab test, and the current state of alpha-gal testing needs improvement. |
Annals of Allergy, Asthma & Immunology. 2017 Nov 1;119(5):S37. | diagnostic testing; diagnosis |
| Krstić Ristivojević M. | 2020 | Monitoring of in vitro Bioavailability and Uptake of Glycosylated Food Allergens Using Cell-Based Models. |
(Doctoral dissertation, Univerzitet u Beogradu-Hemijski fakultet). | delayed reaction; glycoproteins |
| Krstić-Ristivojević M, Apostolović D, Grundström J, Tran TT, Ćirković-Veličković T, Hamsten C, van Hage M. | 2016 | alpha-Gal epitope on protein surface decreases transcytosis through Caco-2 monolayer. Background: Transepithelial transport of proteins is the first step in the cascade of events during an immune response to food allergens. Red meat allergy is characterized by an IgE response against the carbohydrate galactose-a-1,3-galactose (a-Gal) and severe allergic reactions several hours after red meat consumption. The aim of this study was to reveal if the presence of aGal epitopes on the protein surface influenced transcytosis through a Caco-2 monolayer (an in-vitro cell-based system that faithfully mimics gut transportation offood allergens). Method: Human serum albumin (HSA) and HSA conjugated a-Gal (HSA-a-Gal) were labeled with fluorescein isothiocyanate(FITC). Caco-2 cells were seeded at 6 9 104 cells/cm2 on polycarbonate membrane inserts and cultured for 21 days. Cell monolayers with a transepithelial electrical resistance (TEER) above 400 O were used andthe transport of 80 lg or 40 lg of FITClabeled proteins in the cMEM culture medium was evaluated. Fluorescence of passed protein was measured at various time points (0.5, 1, 2, 4, 6 h) and calculated from standard curves of the corresponding protein using a spectrofluorimeter. Results: A constant increase of transported protein over time was noted. The amount of transported HSA-a-Gal when 80 lg was applied on monolayer was in the range from 17.7 0.2 ng after 0.5 h of transcytosis up to 89 9 ng of protein after 6 h of transcytosis. When HSA was administrated in the same amount, levels were in the range of 55 2 ng up to 382 36 ng for 0.5 and 6 h of transcytosis, respectively. This was an approximately 3 times higher amount in comparison with transcytosis for HSA-a-Gal. No statistically significant difference in the rate of transcytosis between 80 lg and 40 lg of appliedproteins was found. After 6 h of transcytosis no change in TEER values were noted, which suggests that monolayers stayed intact. Conclusion: We showed that transcytosis of proteins was a well-defined process dependent on the bioavailability of the protein and not on the applied concentration. The prolonged transepithelial transport of HSA-a-Gal may contribute to the delayed symptoms after red meat consumption in patients allergic to red meat. |
Allergy. 2016;71:402. | Europe; Sweden; |
| Kuehn BM. | 2018 | Tick bite linked to red meat allergy. Rare cases of recurrent life-threatening allergic reactions to red meat have been linked to tick bites, according to researchers from the National Institute of Allergy and Infectious Diseases (NIAID). Lone Star ticks range from the Southeast through the Eastern United States and bites from the arachnids are known to cause a rare allergy to galactose-α-1,3-galactose (α-gal), a type of sugar found in beef, pork, lamb, and other red meats. Now, researchers from NIAID have found antibodies to α-gal in the blood of 6 of 70 individuals treated for recurrent, unexplained anaphylaxis. All 6 individuals had a history of tick bites and lived in states where Lone Star ticks are common. Adopting red meat-free diets allowed them to avoid further anaphylaxis for the duration of follow-up, which ranged from 18 months to 3 years. |
Journal of Allergy and Clinical Immunology. 2014 Nov 1;134(5):1016-25. | idiopathic anaphylaxis |
| Kugler C, Biedermann T. | 2016 | Delayed anaphylaxis to mammalian meat (Alpha-Gal) - oral challenge. / Orale Provokationstestung bei verzögerter Soforttypallergie auf Sägetierfleisch (Alpha-Gal). No abstract available |
Rev Fr Allergol. 2016; 497-501. | diagnosis |
| Kuhlen JL, Virkud YV. | 2015 | Pathogenesis, newly recognized etiologies, and management of idiopathic anaphylaxis. Idiopathic anaphylaxis (IA) is a life-threatening allergic disease and the most common diagnosis given to patients following an anaphylactic event. The inability of the healthcare provider and the patient to identify the trigger for anaphylaxis makes standard allergen avoidance measures ineffectual. IA is diagnosed after other causes of anaphylaxis have been excluded. Mast cell activation syndromes (MCAS), mastocytosis, IgE to galactose-alpha-1,3-galactose (alpha-gal), and certain medications have recently been recognized as causes of anaphylaxis that were previously labeled idiopathic. This review will describe the epidemiology and proposed theories of pathogenesis for IA, its diagnostic approach, its clinical management, and examine newly recognized disorders that were previously labeled as idiopathic anaphylaxis. |
Discovery medicine. 2015 Feb;19(103):137. | idiopathic anaphylaxis |
| Kular H, Dean J, Cook V. | 2018 | A CASE OF CARRAGEENAN ALLERGY IN A PEDIATRIC PATIENT Carrageenan is a common food additive obtained from Eucheuma, Chrondrus, and Gigartina species of seaweed. It is used in dairy, processed meat, sauces, pharmaceuticals and other food products as a thickener and stabilizer. It's soluble fiber properties are used to alter the consistency, appearance, and nutritional properties of food. Although it has been reported to cause adverse gastrointestinal effects, reports of IgE-mediated allergy appear limited to a case of anaphylaxis to carrageenan-containing barium enema. We present a unique case of carrageenan allergy in a pediatric patient. |
Annals of Allergy, Asthma & Immunology. 2018 Nov 1;121(5):S119. | carrageenan; dairy; non-dairy substitutes |
| Kumar D, Sharma SR, Adegoke A, Kennedy A, Tuten HC, Li AY, Karim S. | 2022 | Recently evolved Francisella-like endosymbiont outcompetes an ancient and evolutionarily associated Coxiella-like endosymbiont in the lone star tick (Amblyomma americanum) linked to the Alpha-Gal Syndrome Background: Ticks are hematophagous arthropods that transmit various bacterial, viral, and protozoan pathogens of public health significance. The lone star tick (Amblyomma americanum) is an aggressive human-biting tick that transmits bacterial and viral pathogens, and its bites are suspected of eliciting the alpha-gal syndrome, a newly emerged delayed hypersensitivity following consumption of red meat in the United States. While ongoing studies have attempted to investigate the contribution of different tick-inherent factors to the induction of alpha-gal syndrome, an otherwise understudied aspect is the contribution of the tick microbiome and specifically obligate endosymbionts to the establishment of the alpha-gal syndrome in humans. Materials and Methods: Here we utilized a high-throughput metagenomic sequencing approach to cataloging the entire microbial communities residing within different developmental stages and tissues of unfed and blood-fed ticks from laboratory-maintained ticks and three new geographical locations in the United States. The Quantitative Insights Into Microbial Ecology (QIIME2) pipeline was used to perform data analysis and taxonomic classification. Moreover, using a SparCC (Sparse Correlations for Compositional data) network construction model, we investigated potential interactions between members of the microbial communities from laboratory-maintained and field-collected ticks. Results: Overall, Francisellaceae was the most dominant bacteria identified in the microbiome of both laboratory-raised and field-collected Am. americanum across all tissues and developmental stages. Likewise, microbial diversity was seen to be significantly higher in field-collected ticks compared with laboratory-maintained ticks as seen with a higher number of both Operational Taxonomic Units and measures of species richness. Several potential positive and negative correlations were identified from our network analysis. We observed a strong positive correlation between Francisellaceae, Rickettsiaceae, and Midichloriaceae in both developmental stages and tissues from laboratory-maintained ticks, whereas ovarian tissues had a strong positive correlation of bacteria in the family Xanthobacteraceae and Rhizobiaceae. A negative interaction was observed between Coxiellaceae and Francisellaceae in Illinois, and all the bacteria detected from ticks from Delaware were negatively correlated. Conclusion: This study is the first to catalog the microbiome of Am. americanum throughout its developmental stages and different tissue niches and report the potential replacement of Coxiellaceae by Francisellaceae across developmental stages and tissues tested except in ovarian tissues. These unique and significant findings advance our knowledge and open a new avenue of research to further understand the role of tick microbiome in tick-borne diseases and develop a holistic strategy to control alpha-gal syndrome. |
Frontiers in Cellular and Infection Microbiology. 2022 Apr 12;12 | tick; microbiome; etiology |
| Kumara KG, Suganthan S, Kumanan T. | 2013 | An incidental finding of congenital methaemoglobinaemia in a patient with an allergy. No abstract available |
Ceylon Medical Journal. 2013 Jun 22;58(2). | India |
| Kuravi K, Sorrells L, Rahman F, WALTERS A, Commins S, Bianchi J. | 2023 | Alpha Gal allergy and its connection to mammalian derived medical products. Rationale: Allergists have identified populations with high titers of anti-alpha-gal (galactose-alpha1,3-galactose) IgE due to a tick bite that adversely react after exposure to alpha-gal (e.g., alpha-gal syndrome (AGS)). The alpha-gal IgE sensitized individual has been well documented to experience adverse events after administration of mammalian-derived therapeutic products including anaphylactic shock and death. The aim of this study was to demonstrate presence of alpha gal in various medical products. Methods: Quantitation of the alpha gal epitope was determined via an indirect ELISA assay. In addition, IHC further confirmed the presence of alpha-α-gal in potential source material using AGS patient’s serum. The various products evaluated included bone powder, immunoglobulin isolates, thyroid derived therapeutic drugs, and heparin. Porcine a-gal knockout (devoid of a-gal) derived tissue or demineralized bone powder served as negative controls. Results: ELISA and IHC data indicates presence of alpha-gal in all bovine/porcine derived products irrespective of their source/ preparation/form. The relative amount of alpha gal present in these products exceeded 10,000,000 epitopes per mg. Conclusions: Alpha-gal persist at very high concentrations in all commercially available therapeutic products that were evaluated that may cause adverse reactions after exposure. More studies must be done to elucidate potential harm posed by the alpha-gal present in these products to the AGS patient population. Porcine alpha-gal knockout (devoid of alpha-gal, aka. GalSafe) products or tissue material could be less immunogenic and serve as an alternative to products derived from standard pigs. |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB91. | Medical products; drugs; bone powder, immunoglobulin isolates, thyroid derived therapeutic drugs, heparin. Perioperative |
| KURAVI K, Sorrels L, Dandro A, Bianchi J, Choudhary S, Commins S | 2022 | Alpha gal allergy and its connection to cardiovascular bioprostheses. Alpha Gal Syndrome (AGS) is an allergy to mammalian food and medical products indicated by elevated anti-galactose α1,3 galactose (alpha-gal) IgE (>0.1kU/L) due to a tick bite. alpha-gal is a sugar molecule expressed in all mammals except humans and old-world primates. We previously showed that anti-alpha-gal IgE in AGS patient sera reacts with alpha-gal present in bovine/porcine derived medical products. The aim of this study is to quantitate alpha-gal present in cardiovascular bioprostheses and to determine the threshold of serum anti-alpha-gal IgE levels needed to react. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB94. | medical products; porcine products; bioprosthetic heart valves; bioprostheses |
| Kuravi KV, Sorrells LT, Nellis JR, Rahman F, Walters AH, Matheny RG, Choudhary SK, Ayares DL, Commins SP, Bianchi JR, Turek JW. | 2021 | Allergic response to medical products in patients with alpha-gal syndrome Background: Galactose-α-1,3-galactose (alpha-gal) is a carbohydrate that is ubiquitously expressed in all mammals except for primates and humans. Patients can become sensitized to this antigen and develop alpha-gal syndrome (AGS), or a red meat allergy. Symptoms range from generalized gastroenteritis and malaise to anaphylaxis, and in endemic areas, the prevalence can be as high as 20%. Although AGS patients commonly avoid alpha-gal by avoiding meat, patients have also developed symptoms due to animal-derived medical products and devices. With the rise in transcatheter aortic valve replacement, we investigate the immunogenicity of common cardiac materials and valves. Objective: To assess the in vitro immunoglobulin E response toward common medical products, including cardiac patch materials and bioprosthetic valves in patients with AGS. . Methods: Immunoblot and immunohistochemistry techniques were applied to assess immunoglobulin E reactivity to various mammalian derived tissues and medical products for patients with AGS. . Results: AGS serum showed strong reactivity to all of the commercially available, nonhuman products tested, including various decellularized cardiac patch materials and bioprosthetic aortic valves. AGS serum did not react to tissues prepared using alpha-gal knockout pigs. . Conclusions: Despite commercial decellularization processes, alpha-gal continues to be present in animal-derived medical products, including bioprosthetic valves. Serum from patients with AGS demonstrates a strong affinity for these products in vitro. This may have serious potential implications for sensitized patients undergoing cardiac surgery, including early valve failure and accelerated coronary artery disease. NOTE: drugs, supplements, and medical products found to contain alpha-gal:• Armour Thyroid (Allergan)-- a porcine thyroxine and triiodothyronine thyroid medication • Zenpep (Allergan)-- a porcine-derived pancreatic insufficiency medication composed of proteases, lipases, and amylase • EnteraGam (Entera Health, Cary, NC), a bovine immunoglobulin and immunoprotein isolate intended for the management of irritable bowel syndrome and inflammatory bowel disease • Pancreatin (Now Foods, Bloomingdale, Ill)-- an over-the-counter dietary aid • CorMatrix Cor™ PATCH-- an epicardial patch for cardiac tissue repair (a heart patch) • Cardiocel acellular collagen scaffold (LeMaitre Vascular, Burlington, Mass)-- used in heart and vascular repair • Photofix (decellularized bovine pericardium (Cryolife, Kennesaw, Ga)-- used in heart and vascular repair • ProCol bovine mesenteric vein (LeMaitre Vascular) • Epic Supra porcine bioprosthetic aortic valve (Abbott, Abbott Park, Ill) • Perimount Magna Ease (bovine bioprosthetic aortic valve (Edwards Lifesciences, Irvine, Calif) • CryoValve SG pulmonary valve decellularized human pulmonary valve conduit (Cryolife). |
The Journal of thoracic and cardiovascular surgery. 2021 Apr 9. | Pharmacy; pharmaceutical; medical products; drug; bioprosthetic heart valve; cardiac; cardiology; biological scaffolding; porcine; bovine; heart patch; surgery; perioperative |
| Kusuma A, Knulst AC. | 2009 | A rare case of meat allergy. A 48-year-old man developed three hours after eating pigs kidney an anaphylactic reaction consisting of general itching, malaise, urticaria, angioedema and hypotension. Later he also developed similar symptoms after eating organ as well as non-organ meat. Skin prick tests and specific IgE values were positive, as well as oral provocation tests. Remarkably the reaction occurred after one to four hours. Very recently such an allergy has been reported in American patients, in which IgE antibodies against galactose-α-1,3-galactose, a carbohydrate group in animal proteins appeared to be the explanation. This is the first case of such an allergy in Europe. |
Nederlands Tijdschrift voor Dermatologie en Venereologie 19(5):233-234. | Netherlands; Europe; kidney |
| Kutlu A, Unal D. | 2020 | Mammalian Meat Allergy Accompanied by Venom Allergy: A Review of 12 Cases Cross-reactivities Between Venom and Red Meat allergy? There has recently been an increase in mammalian meat allergy (MMA) in the Black Sea Region of Turkey. It has been associated with the expansion of tick populations.Tick bites appear to result in sensitization to the carbohydrate allergen galactose-alpha–1, 3-galactose, which is present in many types of mammalian meats. In this study, we have emphasized that Ixodes ricinus named tick type which is implicated in meat allergy, is found in domestic animals of Black Sea Region of Turkey. A new concept has been recently raized; suggesting that having an alpha-gal allergy is associated with an increased risk of sensitization to multiple venom spesific immunoglobulin (Ig) E. Our aim is to evaluate the clinical characteristics of adult patients with MMA and its relationship with insect sting reactions in Turkey. Patients referring to the allergy outpatient clinic with possible MMA were interviewed regarding reactions to a stinging insect. Demographic features and detailed histories of the patients were recorded. Skin prick test (SPT) with commercial beef extract and venom allergens, as well as prick to prick tests with raw beef and cooked beef were performed. Serum total IgE and beef meat specific IgE were measured. Of 50 interviewed patients, 12 patients (4 male [33,3%] and 8 female [66,6%]) had a history of venom hypersensitivity reaction. The mean age was 36.50±13.35 years (range:18–61). History of other allergic diseases was present in 8 (66.6%) patients. Both venom and meat allergy were confirmed with SPT or prick to prick tests in these 12 patients. Among these patients sensitization to honey bee venom was more frequent (83%). MMA and venom allergy are influenced by the same environmental exposures. We believe that there may be shared immunologic factors and similar antigens; making venom allergic patients more susceptible to MMA. |
Iranian Journal of Allergy, Asthma and Immunology. 2018:1-5. | Asia; Europe; Turkey; cross-reactivity; vector of sensitization; bee; insect |
| Kutluğ Ş, Hancıoğlu G, Kökçü Şİ, Sancak R, Öztürk F. | 2021 | Evaluation of red meat allergy patients and review of the literature. ackground. It was reported that prevalence of red meat allergy in children was higher in our country than in western populations. However, the diagnosis of these patients is often delayed. The aim of the study was to present the clinical and laboratory characteristics of our red meat allergy patients. Methods. The data were collected retrospectively from the files of children with red meat allergy. Also, 6 adults with red meat allergies were recorded in the families of the children. Patients with symptoms associated with red meat allergy and sensitive to beef or mutton in prick-to-prick tests were recorded. . Results. The median age of the 43 patients was 12 years (2-37), and 51% were male. Most of the patients were children (n=37, 86%). The median age was 10 years in children (2-17), and 54% were male. All of the children had dermatologic manifestations, 51% had respiratory symptoms, and 64% had anaphylaxis upon exposure to red meat. The anaphylaxis history was not associated with demographic, clinical and laboratory data. A total of 63% children had additional allergic diseases, and 75% of them were sensitive to both mutton and beef in prickto-prick tests. The median total IgE level of the children was 327 (20-3550) IU/mL, median eosinophil count was 210/mm3 (40-990) and mean vitamin D was 13.1 ± 1.2 mcg/L (n=27). Anaphylaxis occurred in 3 of 9 patients who received the open oral food challenge (OFC) test. After OFC, 3 patients continued to eat red meat without issues, and 1 patient was recommended to eat alternatives to red meat. . Conclusions. Clinical and laboratory findings were heterogeneous in children with red meat allergy. Anaphylaxis risk seems to be higher than other food allergies. OFC test is more helpful in both diagnosis and alternative red meat selection compared to laboratory findings. |
The Turkish Journal of Pediatrics. 2021 Sep;63(5):832-45. | Turkey |
| Kwak M, Somerville C, van Nunen S. | 2018 | A novel Australian tick Ixodes (Endopalpiger) australiensis inducing mammalian meat allergy after tick bite. Tick-induced mammalian meat allergy has become an emergent allergy world-wide after van Nunen et al. first described the association between tick bites and the development of mammalian meat allergy in 2007. Cases of mammalian meat allergy have now been reported on all 6 continents where humans are bitten by ticks, in 17 countries - Australia, United States of America (USA), Europe (France, Spain, Germany, Belgium, Switzerland, Sweden, United Kingdom, Italy, and Norway), Asia (Korea and Japan), Central America (Panama), South America (Brazil), and Africa (South Africa and Ivory Coast). To date, in each of these countries, bites from only a single tick species have been linked to the development of mammalian meat allergy: Ixodes holocyclus (Australia), Amblyomma americanum (USA), Ixodes ricinus (Europe), and Ixodes cajennense (Panama) are confirmed as culprits, and Ixodes nipponensis (Japan and Korea), Amblyomma sculptum (Brazil), Amblyomma variegatum (Ivory Coast), and Haemaphysalis longicornis (Japan) suspected of provoking mammalian meat allergy after tick bite. Other tick species remain to be formally identified (South Africa). Identification of tick species associated with development of mammalian meat allergy is crucial to the uptake of public health measures to prevent tick bites from culprit tick species, for both individuals living in these tick-endemic areas and those who choose to visit these regions. We report a tick associated with the enhancement of mammalian meat anaphylaxis after tick bite which is novel for both Australia and the world and establishes Ixodes (Endopalpiger) australiensis as a second tick species associated with mammalian meat allergy in Australia. |
Asia Pacific Allergy. 2018 Jul 23;8(3). | Australia; tick species; Ixodes australiensis; endopaliger; geographic distribution; geography |
| Lacy BE, Patel H, Guerin A, Dea K, Scopel JL, Alaghband R, Wu EQ, Mody R. | 2016 | Variation in care for patients with irritable bowel syndrome in the United States. |
PLoS One. 2016 Apr 26;11(4):e0154258. | epidemiology; geographic distribution; GI; gastroenterology; IBS; included because the maps suggest a potentially significant geographic overlap between AGS and GI issues |
| Lacy K, Gillen-Zinsmeister J, Shah S, Dang A. | 2021 | M236 ALPHA GAL SYNDROME: AN EVOLVING RED MEAT ALLERGY. |
Annals of Allergy, Asthma & Immunology. 2021 Nov 1;127(5):S115. | GI; gastroenterology; GI variant; GI phenotype |
| Lado P, Smith ML, Carstens BC, Klompen H. | 2020 | Population genetic structure and demographic history of the lone star tick, Amblyomma americanum (Ixodida: Ixodidae): new evidence supporting old records Range expansions are a potential outcome of changes in habitat suitability, which commonly result as a consequence of climate change. Hypotheses on such changes in the geographic distribution of a certain species can be evaluated using population genetic structure and demography. In this study we explore the population genetic structure, genetic variability, demographic history of, and habitat suitability for Amblyomma americanum , a North American tick species that is a known vector of several pathogenic microorganisms. We used a double digestion restriction site‐associated DNA sequencing technique (dd‐RAD seq) and discovered 8,181 independent single nucleotide polymorphisms (SNPs) in 189 ticks from across the geographic range of the species. Genetic diversity was low, particularly when considering the broad geographic range of this species. The edge populations were less diverse than populations belonging to the historic range, possibly indicative of a range expansion, but this hypothesis was not statistically supported by a test based on genetic data. Nonetheless, moderate levels of population structure and substructure were detected between geographic regions. For New England, demographic and species distribution models support a scenario where A. americanum was present in more northern locations in the past, underwent a bottleneck, and subsequently recovered. These results are consistent with a hypothesis that this species is re‐establishing in this area, rather than one focused on range expansion from the south. This hypothesis is consistent with old records describing the presence of A. americanum in the northeastern US in the early colonial period. |
Molecular Ecology. 2006 May;15(6):1643-56. | |
| Landwehr L, Smith L, Stricker W. | 2021 | P118 THE CLINICAL SPECTRUM OF ALPHA-GAL ALLERGY IN A MISSOURI PRACTICE. Introduction: Galactose-alpha-1,3 (alpha-gal) is a oligosaccharide found in non-primate mammalian cell membranes. Humans have recently been recognized as having severe delayed hypersensitivity reactions consequent to ingestion of alpha-gal-containing foods in the form of mammalian meat products (i.e. beef and pork). Primary sensitization is thought to occur via tick bites. The Lone Star tick, Amblyomma americanum, is considered a vector and is commonly found in Missouri. Methods: A retrospective chart review was conducted from an Allergy practice in Missouri of patients diagnosed with alpha-gal syndrome from 2013-2019. Results: There were a total of 68 patients diagnosed with alpha-gal syndrome over the period (2013-2019.) Patient demographics included mean age: 50.4 years (range 15-75), 44% were male (30/68) and 56% were female (38/68), mean alpha-gal IgE 17.6 kU/L (range 1.02-99). 42 patients were tested for serum IgE to beef and pork as well as skin prick test (SPT) to beef and pork. Of the 42 patients tested for sIgE to beef, 31 measured positive (positive= IgE >0.1 kU/L). Of the 42 patients tested for sIgE to pork, 30 tested positive. Of the 42 patients who underwent a SPT for beef, 8/42 were positive. Of the 42 patients who underwent a SPT for pork, 8/42 were positive. We found 44 subjects with histories and/or objective findings consistent with anaphylaxis using a 2 system definition. These 44 subjects had skin involvement and another system with 30 reporting respiratory symptoms, 13 reporting cardiovascular symptoms and 23 reporting gastrointestinal symptoms. 35 subjects reported emergency room care. 3 were hospitalized. The second group was defined as “skin only symptoms” which included pruritus, urticaria, and/or angioedema without evidence of systemic symptoms. 26 subjects were in this category. The mean IgE alpha gal was 18.9 in the anaphylaxis group and 13.6 in the skin only group. Symptom onset was 3-6 hours after ingestion in all subjects. Other triggers included venison (4), lamb (2), gelatin-containing medication (4) and milk (8). 1 subject had a porcine heart valve and did well if she avoided ingesting mammalian meat. 4 subjects reported resolution and 2 underwent negative office challenges to meat. Conclusion: Alpha-gal hypersensitivity is a serious medical concern as demonstrated but these 68 patients diagnosed in this mostly rural practice in Central Missouri over a 6 year period. Patients may experience a spectrum of symptoms ranging from skin-limited findings to severe-life threatening anaphylaxis. Our report emphasizes the importance of considering alpha gal sensitivity in patients presenting with varying allergic symptoms in absence of immediate allergen association. |
Annals of Allergy, Asthma & Immunology. 2021 Nov 1;127(5):S45. | Missouri |
| Lang J, Zhan J, Xu L, Yan Z. | 2006 | Identification of peptide mimetics of xenoreactive α-Gal antigenic epitope by phage display. The prevention of hyperacute rejection (HAR) triggered by interaction between the human natural antibody and xenoreactive antigenic epitope (Gal-α1, 3Gal) present on pig cells is the key to success in pig-to-human xenotransplantation. The phage display technology offers an effective strategy for screening peptides which can interact with the anti-Gal antibody to block α-Gal antigen binding site. Two peptide libraries, linear 7 peptide library and C7C library, were panned on the anti-B monoclonal antibody which has the characteristic of binding to the α-Gal antigenic epitope. After four rounds of panning, 22 positive phage clones were selected. Highly homologous sequence PT and STL existed among these selected peptides. Stachyose competitive ELISAs revealed that these peptides specifically bound to α-Gal antigen binding site. Eight peptide mimics of α-Gal antigenic epitope could inhibit the agglutination of pig red blood cells mediated by human sera in a dose-dependent manner. These results demonstrated that the selected peptides can mimic the conformational structure of α-Gal antigenic epitope and have the therapeutic potential in xenotransplantation. |
Biochemical and biophysical research communications. 2006 May 26;344(1):214-20. | peptide mimetics; cross-reactivity |
| Lang M, Corriger J, Haumonte Q, Thomas H, Nguyen-Grosjean VM, Pontier JP, Vaillant A, Beaudouin E. | 2018 | Allergie à α-galactose: un vêlage à fleur de peau. IntroductionLe galactose-α-1,3-galactose (α-Gal) est présent dans la glycosylation de nombreuses cellules, glycoprotéines et glycolipides chez les mammifères non primates. On le retrouve ainsi dans leurs abats, viandes et laits, mais aussi dans les gélatines alimentaires ou médicamenteuses, immunoglobulines, biomédicaments et tissus de xénogreffe (ex. bioprothèses porcines).MéthodesNous présentons le cas d’un agriculteur de 36 ans, aux antécédents de morsure de tique, sujet depuis plusieurs années à une urticaire aiguë récidivante. Le premier épisode, généralisé, est survenu après ingestion d’un aspic (gélatine de viande), les suivants 30 à 40 min après vêlage et consistant en des urticaires localisées au niveau des zones de contact avec le placenta et le liquide amniotique bovin et secondairement généralisées. D’autres épisodes sont rapportés, avec pour seul dénominateur commun l’ingestion de viande de porc plusieurs heures avant. Il n’est jamais retrouvé de cofacteur associé.RésultatsLes pricks aux aéroallergènes et trophallergènes courants étaient négatifs ; les pricks aux viandes ont mis en évidence un veau cru positif et un érythème sans papule pour le rognon de porc. L’enquête étiologique a été complétée par des prick-to-pricks au placenta et liquide amniotique bovins, pricks et IDR vis-à-vis du cétuximab et dosage d’IgE spécifiques à l’α-Gal, permettant de conforter le diagnostic d’hypersensibilité à l’α-Gal.DiscussionLa présence d’α-Gal a été récemment objectivée dans de nombreuses glycoprotéines du placenta et liquide amniotique bovins. Une série espagnole rapporte 3 cas d’urticaire de contact liés au vêlage, dont l’un associé à une atteinte respiratoire probablement consécutive à l’inhalation de glycoprotéines du liquide amniotique. La chronologie des réactions ne plaide pas pour une sensibilisation liée au vêlage.ConclusionCette nouvelle source d’exposition professionnelle pourrait avoir des conséquences médico-légales et justifier de mesures spécifiques pour les sujets allergiques à l’α-Gal travaillant en milieu vétérinaire ou agricole. |
Revue Française d'Allergologie. 2018 Apr 1;58(3):253. | occupational medicine; bovine amniotic fluid; placenta; farming; cattle |
| Langerak A, River G, Mitchell E, Cheema P, Shing M. | 2009 | Panitumumab Monotherapy in Patients with Metastatic Colorectal Cancer and Cetuximab Infusion Reactions: A Series of Four Case Reports. Purpose: Monoclonal antibodies against the epidermal growth factor receptor approved for treating metastatic colorectal cancer (mCRC) include cetuximab (a chimeric antibody) and panitumumab (a fully human antibody). Because these antibodies have differences in protein sequence, patients intolerant to one antibody might still tolerate the other. Four cases are presented from a US panitumumab compassionate-use program in which patients with mCRC who were intolerant to cetuximab received panitumumab. Patients and Methods: Eligible patients had failed previous fluoropyrimidine therapy with oxaliplatin- and irinotecan-containing chemotherapy, had cetuximab intolerance (ie, experienced an infusion reaction), and were unable to participate in a panitumumab clinical trial. For each patient, individual Federal Drug Administration-approved single-patient treatment use Investigational New Drug– and Institutional Review Board–approved protocols were used, informed consent was obtained, and data were collected independently by the investigator. Results: All 4 patients (2 men, 2 women) had received previous bevacizumab and premedications before cetuximab administration. In response to cetuximab, all 4 patients experienced Common Terminology Criteria for Adverse Events grade 3 or grade 4 infusion-reaction symptoms, which required acute therapy. Time from cetuximab discontinuation to panitumumab administration ranged from 8 days to 5 months. Panitumumab monotherapy was administered at approximately 6 mg/kg every 2 weeks. Two patients received premedications before panitumumab use. No physician reported any infusion reaction to panitumumab. One patient had stable disease, and 3 patients had disease progression. Conclusion: Though this small case series provides evidence that patients with mCRC intolerant to cetuximab can receive subsequent panitumumab monotherapy without experiencing infusion reactions, additional clinical testing is needed to definitively examine this finding. |
Clinical colorectal cancer. 2009 Jan 1;8(1):49-54. | Pharmacy; pharmaceutical; biologics; biological agents; monoclonal antibodies; mAb |
| Langley DB, Schofield P, Nevoltris D, Jackson J, Jackson KJ, Peters TJ, Burk M, Matthews JM, Basten A, Goodnow CC, van Nunen S. | 2022 | Genetic and structural basis of the human anti-α-galactosyl antibody response. Humans lack the capacity to produce the Galα1–3Galβ1–4GlcNAc (α-gal) glycan, and produce anti-α-gal antibodies upon exposure to the carbohydrate on a diverse set of immunogens, including commensal gut bacteria, malaria parasites, cetuximab, and tick proteins. Here we use X-ray crystallographic analysis of antibodies from α-gal knockout mice and humans in complex with the glycan to reveal a common binding motif, centered on a germline-encoded tryptophan residue at Kabat position 33 (W33) of the complementarity-determining region of the variable heavy chain (CDRH1). Immunoglobulin sequencing of anti-α-gal B cells in healthy humans and tick-induced mammalian meat anaphylaxis patients revealed preferential use of heavy chain germline IGHV3-7, encoding W33, among an otherwise highly polyclonal antibody response. Antigen binding was critically dependent on the presence of the germline-encoded W33 residue for all of the analyzed antibodies; moreover, introduction of the W33 motif into naive IGHV3-23 antibody phage libraries enabled the rapid selection of α-gal binders. Our results outline structural and genetic factors that shape the human anti-α-galactosyl antibody response, and provide a framework for future therapeutics development. |
Proceedings of the National Academy of Sciences. 2022 Jul 12;119(28):e2123212119. | genetics; structural factors; cellular mechanism; biochemical mechanism |
| Lauer S, Burk M, Broadfoot A, Baumgart K, van Nunen S. | 2019 | ACUTE ADULT FCIES (FOOD CARBOHYDRATE-INDUCED ENTEROCOLITIS SYNDROME) TO MAMMALIAN MEAT AFTER TICK BITE: A NOVEL MECHANISM IN MAMMALIAN MEAT REACTIVITY. |
In INTERNAL MEDICINE JOURNAL 2019 Sep 1 (Vol. 49, pp. 23-24). 111 RIVER ST, HOBOKEN 07030-5774, NJ USA: WILEY. | gastroenterology; enterocolitis; FPIES; food-induced enterocolitis; FCIES |
| Laurent J, Rostoker RR, Bruneau GL. | 1987 | Is Adult Idiopathic Nephrotic Syndrome Food Allergy?. To evaluate the prevalence of food hypersensitivity in idiopathic nephrotic syndrome (INS), an oligoantigenic diet was given for 10 days to 13 patients with INS who had not steadily responded to corticosteroids; 5 of these patients were corticodependent, 3 were corticoresistant and 5 had multiple relapses. A history of allergy was present in 8 cases and an increase in total serum IgE levels in 6. Sensitivity to food antigens was documented by skin tests in 5, by the radioallergosarbent test (RAST) in 5 and by the human basophil degranulation test (HBDT) in 11. At the end of the oligoantigenic diet, proteinuria was significantly reduced in the 13 patients as compared to the initial level. It decreased by more than 50% in 9 patients and disappeared completely in 5. It seems that an oligoantigenic diet is helpful in cases of INS that do not respond to corticosteroids. This argues for a role of food hypersensitivity in this disease and suggests that avoidance of specific foods on the longer term may be of benefit. This diet must be tried in INS before the initiation of immunosuppressive therapy. |
Nephron. 1987;47(1):7-11. | Nephrology; nephrotic syndrome; kidney |
| Lazarević VV, Božan M, Lokner I, Ranogajec A. | 2024 | Sensitization to a-gal and omega-5-gliadin in patients with chronic urticaria: clinical implications and need for targeted testing. |
Advances in Dermatology and Allergology/Postępy Dermatologii i Alergologii. 2024 Oct 23;41(5):500-4. | dermatology; chronic urticaria; Europe; Croatia |
| Le Mauff A, Norris EJ, Li AY, Swale DR. | 2024 | Repellent activity of essential oils to the Lone Star tick, Amblyomma americanum. |
Parasites & Vectors. 2024 May 6;17(1):202. | tick bite prevention; repellent; 1R-trans-chrysanthemic acid (TCA) |
| Le TT, Tran TT, Ho HT, Vu AT, Lopata AL. | 2018 | Prevalence of food allergy in Vietnam: comparison of web-based with traditional paper-based survey. | World Allergy Organization Journal. 2018 Dec;11(1):16. | Asia; Vietnam; prevalence |
| Le TT, Tran TT, Ho HT, Vu AT, McBryde E, Lopata AL. | 2020 | The predominance of seafood allergy in Vietnamese adults: Results from the first population-based questionnaire survey. Background: Food allergy (FA) is a serious, costly and growing health problem worldwide. FA occurs in both children and adults; however, there is a paucity of information on FA prevalence and its clinical features in the adult population, especially in Asia. We sought to assess the prevalence of FAs in Vietnamese adults and the distribution of offending food items among different regions throughout Vietnam. . Methods: A nationwide, cross-sectional, population-based survey was conducted among University students aged 16–50 years. We used a structured, anonymous questionnaire, which was modified from recently published FA epidemiologic studies and based on European Academy of Allergy and Clinical Immunology (EAACI) guidelines, to collect data on FA prevalence, clinical presentations, and implicated food groups. Statistical analysis was performed to generate the prevalence of self-reported and doctor-diagnosed FA and to examine the association of key environmental factors and FA incidence in this population. . Results: Of the 14,500 surveys distributed, a total of 9,039 responses were returned, resulting in a response rate of 62.4%. Among participants who reported food-induced adverse reactions, 48.0% have repeated reactions. 18.0% of the participants perceived FA symptoms, but less than half of them sought medical services for confirmation (37.9%). Stratifying for true FA symptoms, the prevalence of self-reported FA was 11.8% and of doctor-diagnosed FA, 4.6%. The most common doctor-diagnosed FA was to crustacean (3.0%; 95% CI, 2.6–3.3), followed by fish (1.6%; 95% CI, 1.3–1.8), mollusk (1.3%; 95% CI, 1.0–1.5) and beef (1.0%; 95% CI, 0.8–1.2). The prevalence of doctor-diagnosed FA differed among participants living in urban (6.5%) and rural regions (4.9%) (P < 0.001). Atopic family history was the strongest predictor for FA (odds ratio 8.0; 95% CI, 6.2–10.4). . Conclusions: Seafood allergy among adults is predominant in Vietnam, followed by beef, milk, and egg, while peanut, soy, and tree nut allergy are much less common. Populations in rural regions have considerably less FA; however, the protective environmental factors have yet to be identified. |
World Allergy Organization Journal. 2020 Mar 1;13(3):100102. | Asia; Vietnam; prevalence |
| Le V, Browning R, Jerath M. | 2022 | Alpha-Gal Allergy: Characteristics of a Midwest Cohort. Rationale: Allergy to galactose-alpha-1,3-galactose is a novel food allergy, affecting a widespread area of the southeastern United States. Few studies have reported on common characteristics and conditions within regional cohorts. This study aims to characterize a cohort of alpha-gal patients within our practice in Saint Louis, Missouri. Methods: A total of 65 patients with alpha-gal allergy diagnosis were identified. Medical chart review was conducted to analyze demographic (age at presentation, gender), clinical (symptomatology, sensitivity), diagnostic (lab data), comorbid and atopic, and environmental (tick exposure, pets) characteristics. Results: The cohort had a female predominance (57%) with a median age at first presentation of 48 years. Mean alpha-gal and total IgE levels at time of presentation, if available, were 3.88 and 90.2, respectively. Most patients had inconsistent reactions (52%) with urticarial and/or gastrointestinal symptoms (52%), while 37% presented with anaphylaxis. Sensitivity to milk and/or gelatin was present in 46%. Most reported a history of atopic disease (77%). Additional comorbidities included GERD (46%), psychiatric disease (35%), hypertension (23%), hyperlipidemia (22%), diabetes (8%), and vascular disease (CAD or CVD, 6%). Finally, a very large majority reported a history of tick bites (86%), and more interestingly, most had pets (85%). Conclusions: In addition to atopic diseases, there is an increased prevalence of concurrent metabolic and psychiatric diseases. Furthermore, sensitivity to all mammal-derived products and proportion of pet owners are higher in our cohort than previously reported. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB209. | Midwest |
| Leder J, Diederich A, Patel B, Bowie M, Renwick CM, Mangunta V. | 2024 | Perioperative Considerations in Alpha-Gal Syndrome: A Review. Galactose-⍺-1, 3-galactose (alpha-gal) is an oligosaccharide found in mammalian tissues that causes allergic reactions in patients with alpha-gal syndrome (AGS). AGS is a hypersensitivity reaction notable for both immediate and delayed allergic and anaphylactic symptoms. As a tick-based disease, AGS has gained increasing prevalence across the United States and can have a significant influence on which medications are safe for patients. Many medications used within the operating room and intensive care units have inactive ingredients that can be mammalian-derived and therefore should be vetted before administering to patients with AGS. Management of patients with AGS involves diligent action in the preoperative and perioperative settings to reduce patient exposure to potentially harmful medications. In conducting a comprehensive risk stratification assessment, the anesthesia team should identify any at-risk patients and determine which medications they have safely tolerated in the past. Despite obtaining a complete history, not all patients with AGS will be identified preoperatively. The perioperative team should understand which common medications pose a risk of containing alpha-gal moieties (e.g., heparins, gelatin capsules, vaccines, lidocaine patches, surgifoam, etc.). For this reason, this paper includes a compendium of common anesthetic medications that have been cross-referenced for ingredients that have the potential to cause an AGS reaction. Any potentially unsafe medications have been identified such that medical providers can cross-reference with the ingredients listed at their respective institutions. |
Cureus. 2024 Jan 30;16(1). | drugs; medical products; emergency; perioperative; surgery; anesthesia; hospital |
| Lee CJ, McGill SK. | 2023 | Food Allergies and Alpha-gal Syndrome for the Gastroenterologist. Purpose of Review: Food allergies are typically not considered as a cause of gastrointestinal (GI) distress without additional allergic symptoms, apart from celiac disease and eosinophilic esophagitis. However, recent reports of patients with alpha-gal syndrome who presented with GI-only symptoms like abdominal pain, vomiting, and diarrhea challenge this paradigm. Alpha-gal syndrome is an IgE-mediated allergy characterized by delayed reactions after eating mammalian meat or mammalian-derived products that contain galactose-alpha-1,3-galactose (alpha-gal). The purpose of this review is to discuss our current understanding of food allergies, GI illness, and the GI manifestations of alpha-gal syndrome. Recent Findings: Among Southeastern U.S. GI clinic patients who screened positive for serum alpha-gal IgE, a majority of patients reported significant symptom improvement on an alpha-gal-avoidant diet, suggesting that the allergy had played a role in their GI symptoms. Diagnosis of alpha-gal syndrome is typically made with concerning allergic symptoms, elevated alpha-gal specific IgE in the serum, and symptom improvement on an alpha-gal avoidant diet. Summary: Alpha-gal syndrome can cause a delayed allergic response that is increasingly recognized worldwide, including among patients with predominant GI symptoms. |
Current Gastroenterology Reports. 2023 Jan 27:1-0. | gastroenterology; GI-only phenotype |
| Lee CJ, McGill SK. | 2022 | S2459 Bad News Gummy Bears: A Case of Gastrointestinal-Isolated Alpha-Gal Allergy. Introduction: Galactose-α-1,3-galactose (alpha-gal) allergy is an IgE-mediated reaction to mammalian meat and dairy, with symptoms typically developing 3 to 6 hours after ingestion. Alpha-gal allergy with isolated gastrointestinal (GI) symptoms (abdominal pain, diarrhea, vomiting) without urticaria or anaphylaxis has been described. Case Description/Methods: A 49-year-old male presented to GI clinic with years of episodic cramping abdominal pain and 4-6 diarrheal stools daily. Colonoscopy, EGD, CT abdomen, and hydrogen breath testing were unrevealing. We diagnosed irritable bowel syndrome. Rifaximin briefly relieved symptoms. He did not tolerate tricyclic antidepressants. Serum alpha-gal IgE level was found to be elevated at 0.27 kU/L (reference range, < 0.1 kU/L) after the patient reported past tick bites. The patient stopped eating mammalian meat and symptoms improved but continued. He further excluded gelatin in the form of gummy bears, dairy, and carrageenan, which led to near resolution of symptoms. At a visit 2 years following allergy diagnosis, he reported one formed stool daily and no chronic abdominal pain. Self-challenging with foods that have small amounts of alpha gal, like a handful of gummy bears, had resulted in severe abdominal cramping. Discussion: The diagnosis of GI alpha-gal syndrome can be challenging because of delayed onset of symptoms after eating mammalian products, nonspecific GI complaints on presentation, and overlap with preexisting GI diseases. While sensitization is believed to be caused by a bite from the Lone Star tick, not all patients report a history of tick bites. Further studies are needed to better characterize GI alpha gal, but 2 cohort studies found that ∼75% of patients improved on a diet free of mammalian products. These diets are somewhat ill-defined in how strict they are, particularly whether they are just free of mammalian meat or all products containing alpha-gal. A stepwise approach is recommended, starting with mammalian meat, then dairy, and then gelatin, gelatin capsules, and mammalian food additives if symptoms persist. Our patient experienced improvement in symptoms with elimination of mammalian meat from his diet, but no resolution until he eliminated all alpha-gal, particularly gelatin and carrageenan. This case highlights the importance of a thorough history, increased awareness of foods containing alpha-gal, and the need for future prospective studies for improving early recognition and treatment of GI alpha gal. |
Official journal of the American College of Gastroenterology| ACG. 2022 Oct 1;117(10S):e1642. | gastroenterology; GI-only phenotype; gelatin; dairy; carrageenan; gummy bears; gummi bears |
| Lee EJ, Lee H, Park EM, Kang HJ, Kim SJ, Park CG. | 2021 | Immunoglobulin M and Immunoglobulin G Subclass Distribution of Anti-galactose-Alpha-1, 3-Galactose and Anti-N-Glycolylneuraminic Acid Antibodies in Healthy Korean Adults. Background: Human preformed antibodies (Abs), anti-galactose-alpha-1,3-galactose (Gal) and anti-N-glycolylneuraminic acid (Neu5Gc), can react with porcine antigens of wild-type pigs. To provide basic population data of the Abs for potential application in clinical xenotransplantation, we developed enzyme-linked immunosorbent assay methods and investigated the serum titers of anti-Gal and anti-Neu5Gc Abs, including immunoglobulin (Ig) M and IgG along with its subclasses, in humans. Methods: Anti-Gal and anti-Neu5Gc Abs serum titers were measured in 380 healthy Korean adults using the in-house enzyme-linked immunosorbent assays. The frequency and median values of anti-Gal and anti-Neu5Gc were measured, and their class and subclass distribution were evaluated. Results: The detection frequencies of anti-Gal were 99.2%, 95.0%, 23.2%, 94.5%, 12.4%, and 3.4% for IgM, IgG, IgG1, IgG2, IgG3, and IgG4, respectively. The detection frequencies of anti-Neu5Gc Abs were 87.4%, 96.6%, 1.6%, 46.3%, 0.0%, and 0.0% for IgM, IgG, IgG1, IgG2, IgG3, and IgG4, respectively. The median values of anti-Gal IgM (1001.6 ng/mL) and IgG (1198.3 ng/mL) were significantly higher than those of anti-Neu5Gc Abs (IgM, 328.4 ng/mL; IgG, 194.7 ng/mL; P < .001). IgG2 titers of both anti-Gal and anti-Neu5Gc Abs correlated better with the IgG class than the titers of other IgG subclasses. Conclusions: The titers of anti-Gal Abs were higher than those of anti-Neu5Gc Abs. IgG2 was the main IgG subclass in both anti-Gal and anti-Neu5Gc Abs. Variation in the titers of anti-Gal or anti-Neu5Gc Abs may partly explain the biological and immunologic changes that occur in recipients of xenotransplants. |
InTransplantation Proceedings 2021 Jun 1 (Vol. 53, No. 5, pp. 1762-1770). Elsevier. | xenotransplantation; IgG; IgM |
| Lee JH, Kim JH, Kim TH, Kim SC. | 2013 | Delayed mammalian meat-induced anaphylaxis confirmed by skin test to cetuximab. No abstract available |
The Journal of dermatology. 2013 Jul;40(7):577-8. | |
| Lee LY, Zhong Y, Leow SY, Lim SC, Wen H, Soh JY, Chiang WC, Delsing DJ, Lee BW, Huang CH. | 2020 | Allergy to prebiotic galacto-oligosaccharides: House dust mites—the putative primary sensitizer. Letter to the editor Galacto-oligosaccharides (GOS) have been increasingly used globally to supplement commercially available milk formulations and dairy products for their health benefits.1 Intriguingly, when GOS were introduced into Southeast Asian countries as an ingredient in milk formula, a few acute allergic reactions and anaphylactic responses to GOS were promptly observed.2-4 Anaphylaxis to GOS occurred on first consumption in all our patients with allergic reactions, which was an indication of the presence of pre-existing GOS sensitization. GOS allergy is unique because the allergen is a pure carbohydrate. Vivinal GOS (vGOS) (FrieslandCampina, Amershfoort, The Netherlands) is produced with a b-galactosidase enzyme derived from Bacillus circulans. The composition of GOS has been shown to contain mostly b-1,4 linkages between glucose and galactose or between galactoses.5 However, b-1,6 and b-1,3 linkages are also found in vGOS, although to a lesser extent. GOS does not contain any fucose or sialic acid moieties. In view of the geographic restriction of GOS allergy to Southeast Asian countries when GOS is used to supplement milk formulas globally, we postulated that GOS allergy might be a result of sensitization to an agent that is likely geographically confined to Southeast Asia. We sought to identify the primary sensitizer for GOS allergy. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):707-10. | carbohydrate allergy; vector of sensitization; mite |
| Lee SC, Kim SR, Park KH, Lee JH, Park JW. | 2019 | Clinical Features and Culprit Food Allergens of Korean Adult Food Allergy Patients: A Cross-Sectional Single-Institute Study. Purpose: To investigate the causative allergens and clinical characteristics of Korean adult patients with food allergy (FA). Methods: This retrospective, cross-sectional single-institutional study enrolled Korean adult patients (n = 812) suspected of having FA. For diagnosis, causality assessment history taking, ImmunoCAP specific immunoglobulin E measurement and/or skin prick test were performed. Results: Among 812 patients, 415 were diagnosed as having FA. The most common causative allergen was fruit, with a diagnosis of pollen food allergy syndrome (PFAS: 155, 37.3%), followed by crustaceans (111, 26.7%), wheat (63, 15.1%), fruits in patients without PFAS(43, 10.3%), buckwheat (31, 7.4%), peanut (31, 7.4%), walnut (25, 6.0%), red meat due to reaction to galactose-alpha-1,3-galactose (alpha-Gal) (8, 1.9%), and silkworm pupa (13, 3.1%). Allergy to egg, milk, fish, or shellfish was rare in Korean adults. One-third of patients with FA exhibited multiple FAs (238/415, 57.3%); the average number of causative allergens was 2.39. About 129 patients (31.0%) were diagnosed as having anaphylaxis; in these patients, wheat was the most frequent causative food. Twenty patients were further diagnosed with food-dependent exercise-induced anaphylaxis (FDEIA); all were due to wheat. In particular, crustaceans, wheat, PFAS, buckwheat, and red meat (alpha-Gal) were also frequent causes of anaphylaxis. Conclusions: Wheat, fruits with or without PFAS, and crustaceans are important and frequent causative allergens in Korean adult FA; these allergens differ from those found in childhood FA. It is notable that non-classic allergies, such as PFAS, FDEIA, and a-Gal allergy, are the important causes of anaphylaxis in Korean adult FA. |
Allergy, Asthma & Immunology Research. 2019 Sep;11(5):723-35. | |
| Lee W, Ben-Othman R, Skut P, Lee AH, Barbosa AD, Beaman M, Currie A, Harvey NT, Kumarasinghe P, Hall RA, Potter J. | 2024 | Molecular analysis of human tick-bitten skin yields signatures associated with distinct spatial and temporal trajectories-A proof-of-concept study. |
Heliyon. 2024 Jul 15;10(13). | Tick bite; immunological response to tick bite |
| Leong S, Lee J. | 2023 | DELAYED DIFFUSE HIVES AFTER VACCINES IN ADOLESCENT WITH POSITIVE ALPHA-GAL IGE AND GELATIN SKIN TEST. Introduction: Since alpha-gal can be found in gelatin, there is concern for possible reaction to gelatin-containing vaccines, though reported cases appear to be rare. Case Description: A 16-year-old male with red meat allergy presented following two separate reactions to vaccines. Three years prior, he moved from India to the U.S. and required vaccinations. At one visit, he received hepatitis B, MCV, Tdap, and varicella vaccines. Though initially asymptomatic, 3-4 hours later, he developed diffuse pruritic hives and felt restless. Diphenhydramine was administered, and hives resolved by the next day. Six months later, he received the MMR vaccine and reacted similarly. He previously tolerated many vaccines—BCG, IPV, DTaP, typhoid, measles, MMR in India and flu in the U.S. He was avoiding red meat, which caused dyspnea, swelling, and pruritus a few hours after ingestion, necessitating epinephrine after beef two years prior. Skin-prick-testing (SPT) was negative to beef, lamb, pork; equivocal to gelatin. Serum IgE (kU/L) showed: beef 0.95, pork 0.85, lamb 0.56, alpha-gal 2.12. Two months later, SPT was positive to gelatin; borderline to MMR and varicella vaccines. SPT and intradermal testing were negative to Tdap, MCV, and hepatitis B vaccines. Discussion: Our patient had evidence of IgE-mediated sensitization to both alpha-gal and gelatin. We suspected reactions to MMR and varicella vaccines, which contain gelatin. As alpha-gal can be found in gelatin, he may have reacted to alpha-gal within these gelatin-containing vaccines. Alpha-gal allergy should be considered in patients who react to gelatin-containing vaccines who have also reacted to mammalian meat. |
Annals of Allergy, Asthma & Immunology. 2023 Nov 1;131(5):S110-1. | vaccine; gelatin; MMR; |
| Lesmana E, Rao S, Keehn A, Edwinson AL, Makol A, Grover M. | 2024 | Clinical Presentation and Outcomes of Alpha-Gal Syndrome. |
Clinical Gastroenterology and Hepatology. 2024 Jul 26. | |
| Leth-Møller KB, van Hage M, Apostolovic D, Sørensen JA, Vestergaard C, Madsen F, Kjær LJ, Hansen T, Jonsson A, Thomsen SF, Linneberg A. | 2024 | Increasing prevalence of galactose-α-1, 3-galactose sensitization in the Danish general adult population. |
Allergy. 2024 Oct 23. | Europe; Denmark; risk factors |
| Leth-Møller KB, van Hage M, Linneberg A, Kårhus LL. | 2024 | A case of alpha-gal syndrome: Recall urticaria and 10 years of measurements of IgE to galactose-α-1, 3-galactose. Alpha-gal IgE level can change rapidly. Reassessment of a patient’s alpha-gal IgE level may be helpful in the patient’s clinical follow-up. Pruritus related to the site of a previous tick bite strengthens the diagnosis of alpha-gal syndrome. |
Journal of Allergy and Clinical Immunology: Global. 2024 Aug 1;3(3):100280. | Europe; Denmark; Sweden; pruritus; recal urticaria; index bite |
| Levin M, Apostolovic D, Biedermann T, Commins SP, Iweala OI, Platts-Mills TA, Savi E, van Hage M, Wilson JM. | 2019 | § Galactose alpha-1,3-galactose phenotypes: Lessons from various patient populations. OBJECTIVE: To review published studies on galactose alpha-1,3-galactose (alpha-gal), a carbohydrate epitope found on proteins and lipids in nonprimate mammals and present in foods (particularly organ or fat-rich red meat) and medications, where it causes delayed-onset and immediate-onset anaphylaxis. DATA SOURCES: A literature search for the terms galactose alpha-1,3-galactose and alpha-gal using PubMed and Embase was performed. STUDY SELECTIONS: Studies on alpha-gal were included in this review. RESULTS: Several species of ticks contain alpha-gal epitopes and possibly salivary adjuvants that promote high titer sensitization and clinical reactivity. Risk factors for alpha-gal syndrome include exposure to ticks of particular species. Age and sex differences seen in various cohorts possibly reflect the prevalence of these exposures that vary according to setting. CONCLUSION: The reason and mechanisms for delayed onset of food-related anaphylaxis and the preponderance of abdominal reactions are not clear but may involve the kinetics of allergen digestion and processing or immunologic presentation via a different mechanism from usual immediate-type food allergy. |
Annals of Allergy, Asthma & Immunology. 2019 Jun 1;122(6):598-602. | review article; non-tick vector; parasite; endoparasite; ectoparasite; gastrointestinal symptoms; |
| Levin M. | 2020 | Advances in alpha gal allergy. |
World Allergy Organization Journal. 2020 Aug 1;13(8):100423. | diagnosis; testing; blood test; alpha-gal IgE; ratio of alpha-gal IgE to total IgE |
| Levin ME, Basera W, Botha M, Facey-Thomas H, Mabelane T. | 2021 | IgE testing for meat, cat and ascaris in patients with and without alpha-gal allergy. Background: Severe meat allergy with anaphylaxis may be caused by sensitisation to alpha-gal. Although a wide range of variation in alpha-gal-specific IgE is found in both subjects with and without alpha-gal-induced meat anaphylaxis, the level of alpha-gal sensitisation correlates with the likelihood of meat allergy. Other laboratory tests have been implicated to be affected by alpha-gal sensitisation. Correlations between alpha-gal sensitisation and sensitisation to certain animals or parasites may provide further clues about potential sensitisers, apart from ticks, in alpha-gal allergy. Methods: In this study we assessed 131 participants who reported adverse reactions to meat, and 26 control subjects, by means of questionnaires, IgE sensitisation to alpha-gal and oral food challenge to beef sausage. Specific IgE to alphagal, beef, pork, lamb, cat, cat serum albumin and ascaris in those participants with challenge-proven meat allergy were compared with control subjects from the same environment. . Results: 84 participants were diagnosed with alpha-gal allergy. Alpha-gal IgE ranged between 0.7 and 344.5 kU/L. Beef, pork and lamb IgE were strongly correlated with alpha-gal IgE in both cases and controls. Cat IgE was significantly associated with alpha-gal sIgE, with a strong correlation in cases but a moderate correlation in controls. There was no association between cat serum albumin and alpha-gal IgE. Ascaris sIgE was significantly associated with alpha-gal sIgE. . Conclusion: Cross-sensitisation between alpha-gal and beef, pork, lamb and cat can be explained by the presence of alpha-gal-containing epitopes on the ImmunoCAP reagents. The absence of cross-sensitisation to cat serum albumin is due to the pure nature of the reagent used. Cross-sensitisation between alpha-gal and ascaris could be explained by the presence of significant amounts of alpha-gal-containing epitopes within the helminth. However, the absence of binding to ascaris IgE in some patients with significant levels of alpha-gal IgE argues against this being the sole or main factor, thus the possibility of a causative role in helminths causing sensitisation to alpha-gal. |
Current Allergy & Clinical Immunology. 2021 Jun 1;34(2):71-3. | Africa; South Africa; cats; endoparasite; helminths; gastroenterology |
| Leyva-Castillo JM, Strakosha M, Smith SE, Vega-Mendoza D, Elkins M, Chou J, Vogel P, Boulanger N. | 2024 | Ixodes ricinus bites promote allergic skin inflammation and intestinal tuft and mast cell expansion in mice. |
bioRxiv. 2024:2024-07. | ticks; Ixodes ricinus; Europe; mast cell activation; chronic illness |
| Li J, Fulton RB, O'Connell R, Jang HS, Fernando SL. | 2018 | ‡ Specific-IgE to galactose-alpha-1,3-galactose (alpha-gal) has limited utility in diagnosing meat allergy in a tick-endemic population. Sensitization to galactose-α-1,3-galactose (alpha-gal) is considered a prerequisite to mammalian meat allergy (MMA) and can occur through tick bites, which is due to the paralysis tick, Ixodes holocyclus, in Australia. The onset of symptoms is typically 3 to 6 hours after ingestion of mammalian meat, but immediate reactions have been described. |
Annals of Allergy, Asthma & Immunology. 2018 Oct 1;121(4):509-11. | Australia; diagnosis; testing; specific IgE |
| Li J, Fulton RB, Yun J, Fernando SL. | 2017 | ‡ P44: Specific IgE to Galactose-Alpha-1,3-Galactose (Alpha-Gal) Does Not Add to the Diagnosis of Mammalian Meat Allergy In a Tick-Endemic Population. Background: The clinical manifestations of mammalian meat allergy (MMA) are varied, encompassing urticaria, angioedema, gastrointestinal symptoms and anaphylaxis. Diagnosis is difficult based on clinical history alone as there are many differential diagnoses to exclude. Specific IgE (sIgE) to alpha-gal is considered a useful diagnostic test. Sensitisation to alpha-gal is considered a prerequisite to MMA. In Australia, one major mechanism is through tick bites from Ixodes holocyclus. Methods: We performed a retrospective analysis of results of sIgE to alpha-gal obtained between January 2014 and December 2016 inclusive in a tick-endemic population in Sydney, Australia. 118 results were included in the study. Results: We used a cut-off for positivity of 0.35 kUA/L. Fifty-nine results (49.6%) were positive, however, only 26 (21.8%) had MMA. Fifty-one subjects reported a history of tick bite from Ixodes holocyclus, and 31 (60.8%) had a positive test despite no clinical features of MMA. The odds ratio (OR) of a diagnosis of MMA where sIgE to alpha-gal is positive is only 2.5 (95% CI 0.7–8.6, P = 0.16). The OR of the presence of atopy is 1.3 (95% CI 0.5–3.3, P = 0.64). However, the OR for a history of tick bite is 15.4 (95% CI 5.3–45.3, P < 0.001). Conclusions: sIgE to alpha-gal does not add any further information to clinical history in the diagnosis of MMA. It only confirms that the patient has had a tick bite (in our population by Ixodes holocyclus). In our experience, this can be ascertained by the individual or at a clinical review. A reduction in the number of assays to sIgE to alpha-gal performed would reduce costs to these tick-endemic communities. |
Internal Medicine Journal. 2017 Sep;47:18-. | Australia; diagnosis; testing; specific IgE |
| Li J, Yan H, Chen H, Ji Q, Huang S, Yang P, Liu Z, Yang B. | 2016 | The pathogenesis of rheumatoid arthritis is associated with milk or egg allergy. Background: Rheumatoid arthritis (RA) is a very complicated autoimmune disease with apparent synovial hyperplasia and cartilage and bone destruction. Aims: In the present study, we aimed to determine whether the pathogenesis of RA correlates with food allergy and which allergen(s) are relevant. . Materials and Methods: We used type-II collagen (CII) to induce arthritis (collagen-induced arthritis, CIA) model in Wistar rats, and the development of arthritis was evaluated accordingly by scoring system. Proinflammatory cytokine levels in plasma were measured by enzyme-linked immunosorbent assay (ELISA), and concentrations of circulating immune complexes (CICs) were analyzed by C1q solid phase method. Furthermore, food-specific immunoglobulin G (IgG) and immunoglobulin E (IgE) levels were determined in the CIA model. . Results: In the CIA model, we found that levels of tumor necrosis factor-alpha (TNF-a), interleukin (IL)-1, IL-6, and IL-17, as well as CICs, were elevated significantly. Moreover, concentrations of milk- or egg-specific IgG and IgE were enhanced strikingly in CIA rats. . Conclusion: The results suggest that pathogenesis of RA correlates closely to increased egg- or milk-specific antibodies. |
North American Journal of Medical Sciences. 2016 Jan;8(1):40. | autoimmune disease; arthritis and allergy; proinflammatory cytokines |
| Li JC, LaHood NA, O’Donnell PV, Banerji A. | 2022 | A 67-Year-Old Man with Pruritus and Dyspnea. Morning Report is a time-honored tradition where physicians-in-training present cases to their colleagues and clinical experts to collaboratively examine an interesting patient presentation. The Morning Report section seeks to carry on this tradition by presenting a patient’s chief concern and story, inviting the reader to develop a differential diagnosis and discover the diagnosis alongside the authors of the case. This report tells the story of a 67-year-old man presenting with itching on his back and shortness of breath. Recently diagnosed with metastatic tonsillar squamous cell carcinoma, he came to the oncology clinic to receive a chemotherapy infusion. Using questions, physical examination, and testing, an illness script for the presentation emerges; the differential is refined until a final diagnosis is made. |
NEJM Evidence. 2022 Oct 25;1(11):EVIDmr2200210. | Medical products; biologics; monoclonal antibodies; cetuximab; cancer |
| Li RC, Schuyler AJ, Workman L, Erwin EA, Platts-Mills TA, Wilson JM | 2019 | Investigation into specific IgE and IgG4 to the oligosaccharide galactose-alpha-1,3-galactose (alpha-Gal) in children with eosinophilic esophagitis. RATIONALE: Serum specific IgE (sIgE) to food allergens are common in children with eosinophilic esophagitis (EoE), albeit usually at low titers, and we have recently reported that high-titer specific IgG4 (sIgG4) to milk proteins are also a feature of the disease. Foods, including dairy, are recognized as important triggers of EoE. The oligosaccharide galactose-a1,3-galactose (a-Gal) is present in mammalian meat and dairy, is recognized in man as a foreign epitope and is the causal epitope in a syndrome of IgE-mediated delayed anaphylaxis. It is possible that a-Gal could be a relevant allergen that contributes to EoE pathogenesis. We sought to determine the prevalence and levels of IgE and IgG4 to a-Gal in children with EoE. METHODS: 15 children with EoE were enrolled from Nationwide children’s (Columbus, OH) and 15 were enrolled from UVA Children’s Hospital (Charlottesville, VA). Specific IgE and IgG4 to a-Gal were measured with ImmunoCAP as previously reported. RESULTS: sIgE to a-Gal was detected in 5 of 15 subjects from Central VA (33%) but no subjects from central OH, a finding that is consistent with the established distribution of the lone star tick. IgG4 titers to a-Gal were detectable in 29 of 30 subjects and ranged from 0.1-7.0 mg/mL. There was no association between a-Gal sIgE status and titers of a-Gal sIgG4. Interestingly, titers of sIgG4 to a-Gal trended higher in the children from Ohio. CONCLUSIONS: Here we show that IgG4 to a-Gal were common at low to moderate titer in children with EoE, but were not associated with IgE to a-Gal. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB139. | IgG4; eosinophilic esophagitis |
| Li S, Zhang Y, Zha J, Chen W. | 2024 | Successful administration of cetuximab using dose escalation method: a case report. |
Journal of Medical Case Reports. 2024 Oct 17;18(1):479. | Pharmacueticals; drugs, biologics; monoclonal antibodies; cetuximab; dose escalation; Asia; China |
| Li Z, Ma A, Miller I, Starnes R, Talkington A, Stone CA, Phillips EJ, Choudhary SK, Commins SP, Lai SK. | 2024 | Development of anti-PEG IgG/IgM/IgE ELISA assays for profiling anti-PEG immunoglobulin response in PEG-sensitized individuals and patients with alpha-gal allergy. |
Journal of Controlled Release. 2024 Feb 1;366:342-8. | PEG; polyethylene glycol |
| Licari E, Barnes B, Minnicozzi S. | 2024 | DIAGNOSIS OF ALPHA GAL ALLERGY IN A 2-YEAR-OLD BOY WITH CHRONIC DIARRHEA. |
Annals of Allergy, Asthma & Immunology. 2024 Nov 1;133(6):S188-9. | pediatric; GI variant; GI phenotype; gastroenterology |
| Liccardi G, Calzetta L, Milanese M, Scaglione M, Rogliani P. | 2018 | Occupational exposure to furry animals and asthma: The complex interconnection between work and everyday life. CorrespondenceWe read with interest the excellent review by Dao and Bernstein1 on the association between exposure to occupational agents and asthma. We would like to add some considerations, especially from a preventive point of view, on the section concerning the exposure to furry animals in certain classic settings, such as laboratories and farms. We believe that, in many cases, the border between occupational and daily exposure to epithelial products of furry animals may be very subtle. In the field of animal care, besides the veterinarians, several emerging professional activities have become common in recent years (ie, groomers, pet sitters, pet trainers)... |
Annals of Allergy, Asthma & Immunology. 2018 Oct 1;121(4):512-3. | Occupational medicine; asthma |
| Lieberman PL. | 2014 | Idiopathic anaphylaxis. Idiopathic anaphylaxis is not uncommon and can be found in as many as 60% of patients referred to an allergist for anaphylactic events. It is an extremely frustrating condition for patients because they have no means of avoiding a known allergen and events occur spontaneously and unprovoked. The objective of this study was to synthesize and review the medical literature on idiopathic anaphylaxis and present a strategy for diagnosis, prevention, and treatment of episodes. A literature review was performed after a search of PubMed using the key words of idiopathic anaphylaxis. Idiopathic anaphylaxis is more common in adults than in children and in women than in men. The symptoms and signs are identical to those found in other causes of anaphylaxis. Perhaps the most common entities to be considered in the differential diagnosis are somatoform reactions. The two most recent advances in our ability to detect the cause are the discovery that episodes can be caused by mast cell-activating syndromes, systemic mastocytosis, and IgE to galactose-alpha-1,3-galactose. Patients experiencing idiopathic anaphylactic episodes should, if possible, avoid taking drugs that may complicate therapy or worsen a reaction. Fortunately, the vast majority of cases follow a benign course. Although many recurrent episodes of anaphylaxis remain idiopathic, recent advances in our knowledge, especially the description of mast cell-activating disorders and the discovery of anaphylactic reactions to galactose-alpha-1,3-galactose have allowed us to find causes in events that previously would have been classified as idiopathic. In addition, the majority of such patients exhibit a diminishing frequency of reactions over time and can be managed in a way that prevents mortality and a severe effect on their quality of life. |
Allergy & Asthma Proceedings. 2014 Jan 1; 35(1). | Review article; idiopathic anaphylaxis |
| Lied GA. | 2017 | Red meat allergy induced by tick bites: A Norwegian case report. Food allergies, especially delayed hypersensitivity reactions, are often challenging for both patients and clinicians. Here, we report the case of a 64-year-old man who had allergic reactions six hours after eating a meal containing red meat. He reported that he had several tick bites in months before the reaction. High serum specific IgE levels of alpha-gal confirmed the diagnosis of alpha-gal allergic reaction with delayed onset after red meat ingestion caused by tick bite. |
European annals of allergy and clinical immunology. 2017 Jul;49(4):186. | Europe; Norway |
| Lied GA. | 2019 | † Intraoperative anaphylaxis to gelatin-based hemostatic agents: a case report. Surgiflo Haemostatic Matrix is an absorbable gelatin matrix hemostatic material that has been widely used in various surgical operations to assist hemostasis. Nonetheless, as biologically active agents (contains porcine gelatin), there is potential for allergic reactions to these products. Here, we report the case of a 71-year-old man who had intraoperative anaphylaxis with cardiovascular events to gelatin associated with the use of a topical hemostatic agent (Surgiflo). The patient reported a history of red meat allergy and tick bites during his allergological examination after anaphylaxis. He also had high levels of specific IgE antibodies towards alpha-gal. Special consideration should be given before administering bovine- or porcine-derived gelatin products during surgery to patients with animal-related allergies, such as alpha-gal or gelatin allergy and an atopic background. |
Journal of asthma and allergy. 2019;12:163. | perioperative; surgery; pharmacy; pharmaceutical; hemostatic agent; gelatin; gelatine |
| Lima-Barbero JF, Sánchez MS, Cabezas-Cruz A, Mateos-Hernández L, Contreras M, de Mera IGF, Villar M, de la Fuente J. | 2019 | Clinical gamasoidosis and antibody response in two patients infested with Ornithonyssus bursa (Acari: Gamasida: Macronyssidae). Blood-feeding ectoparasites constitute a growing burden for human and animal health, and animal production worldwide. In particular, mites (Acari: Gamasida) of the genera Dermanyssus (Dermanyssidae) and Ornithonyssus (Macronyssidae) infest birds and cause gamasoidosis in humans. The tropical fowl mite, Ornithonyssus bursa, is commonly found in tropical and subtropical countries but rarely reported in Europe. In this research we characterized the first two cases in Spain of clinical gamasoidosis diagnosed in patients infested with O. bursa, and investigated the IgE, IgM and IgG antibody response to mite proteins and the carbohydrate Gal alpha 1-3Gal beta 1-(3)4GlcNAc-R (alpha-Gal) involved in the tick-bite associated alpha-Gal syndrome (AGS). The results suggested that O. bursa is establishing across Mediterranean countries, and may increase the risk for gamasoidosis. The immune antibody response to mite proteins was higher for IgM and similar for IgE and IgG antibodies between patients and non-allergic control individuals exposed to mite or tick bites. The anti-alpha-Gal antibody levels were similar between patients and controls, a result supported by the absence of this carbohydrate in mites. These results suggested that mite bites do not correlate with antibody response to acarine proteins or alpha-Gal, and are not associated with the AGS. |
Experimental and Applied Acarology. 2019 Aug 1;78(4):555-64. | |
| Lindsay J, Soliman Y, Sageer M. | 2020 | S2305 Got Beef, with Beef: Ulcerative Colitis Remission Coinciding With an Alpha-Gal Compliant Diet. INTRODUCTION: The underlying pathophysiology of “alpha-gal” allergy syndrome (AG) is related to the production of IgE antibodies to a carbohydrate epitope. The pathophysiology of inflammatory bowel diseases (IBD) is multifactorial, and includes interactions among commensal microbiota, various immune pathways, and responses in intestinal epithelial cells. The interaction between AG and IBD is unclear. We report a case of ulcerative colitis (UC) in remission coinciding with an AG compliant diet. |
Official journal of the American College of Gastroenterology| ACG. 2020 Oct 1;115:S1220. | Gastroenterology; GI variant; inflammatory bowel disease; ulcerative colitis; IBD; acute kidney injury; hematochezia; normocytic anemia; elevated ESR; elevated CRP; pseudopolyposis; pancolitis; differential; misdiagnosis |
| Linske MA, Williams SC, Stafford KC, Lubelczyk CB, Henderson EF, Welch M, Teel PD. | 2020 | Determining Effects of Winter Weather Conditions on Adult Amblyomma americanum (Acari: Ixodidae) Survival in Connecticut and Maine, USA. The lone star tick (Amblyomma americanum L.) is native to the United States, with its primary range encompassing the Southeast and portions of the Midwest. It is an aggressive ectoparasite that actively seeks out hosts through detection of carbon dioxide and vibrations and can transfer ehrlichiosis-causing bacteria as well as a carbohydrate that causes alpha-gal syndrome (red meat allergy) in humans. It has become of increasing concern as its range has recently expanded into coastal regions of the Northeast. Historically, harsh northeastern winter weather conditions made these areas inhospitable for A. americanum survival, but a warming climate coupled with increased host availability seem to have facilitated their range expansion. We developed a study to observe the effects of weather conditions on adult A. americanum overwintering survival. The study was conducted over three years in Connecticut and Maine. Ground-level conditions were manipulated to determine the effects of differing combinations of natural insulative barriers (leaf litter and snow accumulation) on adult A. americanum survival. We determined that there was a significant difference in survival between the two states, between years in Maine, and between sexes within Connecticut. However, presence or absence of snow and/or leaf litter had no impact on survival. Overall, we found a positive correlation between mean hourly temperature and adult survival in Maine, where temperatures were consistently below freezing. The results of this study can be included in an adaptive, predictive analytic model to accommodate the expected fluctuations and range expansion of A. americanum that will most likely accompany an increase in temperatures throughout the Northeast |
Insects. 2020 Jan;11(1):13. | |
| Lis K, Ukleja-Sokołowska N, Karwowska K, Wernik J, Pawłowska M, Bartuzi Z. | 2023 | Clinical Use of the ImmunoCAP Inhibition Test in the Diagnosis of Meat Allergy Caused by a Tick Bite in an Adult Male with No Previous Atopic History. |
Life. 2023 Mar 5;13(3):699. | Europe; Poland |
| Lis K, Ukleja-Sokołowska N, Karwowska K, Wernik J, Pawłowska M, Bartuzi Z. | 2023 | The Two-Sided Experimental Model of ImmunoCAP Inhibition Test as a Useful Tool for the Examination of Allergens Cross-Reactivity on the Example of α-Gal and Mammalian Meat Sensitization—A Preliminary Study |
Current Issues in Molecular Biology. 2023 Feb 1;45(2):1168-82. | Europe; Poland |
| Lisha L, Liping W, Jia Y, Junxiong Z, Jianqing G, Hong L, et al. | 2018 | Clinical characteristics of patients with mammalian meat allergy (in Chinese). |
Chin J Allergy Clin Immunol 2018;12:522-526. | Asia; China |
| Lisha L, Liping W, Kai G. | 2018 | Allergy to gelatin-containing vaccines and review of the literatures (in Chinese). |
| Chin J Allergy Clin Immunol2018;12:409-416. doi: 10.3969/j.issn.1673-8705.2018.04.007. | Asia; China; vaccines; gelatin |
| Liu K, Wofford RN, Newcomb DC, Stone CA, Moncayo A. | 2023 | Active Surveillance on the Prevalence of alpha-gal (galactose-alpha-1, 3-galactose) syndrome in Middle Tennessee. |
Annals of Allergy, Asthma & Immunology. 2023 Apr 18. | Prevalence; Tennessee |
| Liu S, Kandeva T, Tchervenkov J. | 2009 | CD1d-Mediated Interaction Between Activated T Cells and B Cells Is Essential to B-Cell Proliferation and Anti-α-Gal Antibody Production Antibody-mediated rejection is central to ABO-incompatible transplantation as well as to xenotransplantation. The carbohydrate structure of xenoantigen α-Gal is highly analogous to the human blood group antigens. Both require memory B-cell activation for antibody production. We hypothesized that B cells, reactive to the α-Gal xenoantigen, required the presence of fully activated T cells to survive and proliferate in vitro. This hypothesis was contrary to the traditional theory that the response of B cells to carbohydrate antigens is T cell independent (Wong and Arsequell: Immunobiology of Carbohydrates. New York: Kluwer; 2003). When we compared the capacity of B cells to proliferate, we observed that activated T cells were necessary for B-cell proliferation. However, this proliferation was independent of the presence of antigen. A relevant question was also to investigate the role of the specific class of T cells: the CD1d-restricted iNKT (iNKT) cells in the activation of α-Gal-reactive B cells. The iNKT cells are reactive to glycolipids and capable of producing both Th1 and Th2 cytokine responses. We therefore wanted to determine the role of the iNKT cells as mediators of a Th2-type response when B cells were exposed to a glycolipid antigen extracted from pig red blood cells, which express blockade of the α-Gal epitope. We observed that the interaction between B cells and iNKT cells prevents B-cell proliferation and anti-α-Gal antibody production. |
Transplantation proceedings 2009 Jan 1 (Vol. 41, No. 1, pp. 398-402). Elsevier. | xenotransplantation; alpha-gal immune response; B cells; T cells |
| Lopes JB, Labrador-Horrilo M, Bartolomé B, Cunha L. | 2022 | The Role of Molecular Allergens in the Diagnosis of Cat-Pork Syndrome: An Unusual Case Report. |
Acta Médica Portuguesa. 2022 May 2;35(5):388-91. | Portugal; pork-cat syndrome |
| Loyens M, Thuny F, Grisoli D, Fournier PE, Casalta JP, Vitte J, Habib G, Raoult D. | 2013 | Link between endocarditis on porcine bioprosthetic valves and allergy to pork. Infective endocarditis (IE) remains a challenging disease to manage, and some cases remain without any explanatory factor [ 1 ]. We recently reported a case of a patient with 4 successive Blood Culture Negative Endocarditis (BCNE) episodes on mitral porcine bioprostheses, with several valve replacements, during a period of 10 months [ 2 ]. We considered allergy to pork as the cause. Here we sought to retrospectively identify putative allergic endocarditis. |
International journal of cardiology. 2013 Jul 31;167(2):600-2. | cardiology; cardiac surgery; bioprosthetic heart valve |
| Luetscher RN, McKitrick TR, Gao C, Mehta AY, McQuillan AM, Kardish R, Boligan KF, Song X, Lu L, Heimburg-Molinaro J, von Gunten S. | 2020 | Unique repertoire of anti-carbohydrate antibodies in individual human serum Humoral immunity to pathogens and other environmental challenges is paramount to maintain normal health, and individuals lacking or unable to make antibodies are at risk. Recent studies indicate that many human protective antibodies are against carbohydrate antigens; however, little is known about repertoires and individual variation of anti-carbohydrate antibodies in healthy individuals. Here we analyzed anti-carbohydrate antibody repertoires (ACARs) of 105 healthy individual adult donors, aged 20–60+ from different ethnic backgrounds to explore variations in antibodies, as defined by binding to glycan microarrays and by affinity purification. Using microarrays that contained > 1,000 glycans, including antigens from animal cells and microbes, we profiled the IgG and IgM ACARs from all donors. Each donor expressed many ACAs, but had a relatively unique ACAR, which included unanticipated antibodies to carbohydrate antigens not well studied, such as chitin oligosaccharides, Forssman-related antigens, globo-type antigens, and bacterial glycans. We also saw some expected antibodies to ABO(H) blood group and α-Gal-type antigens, although these also varied among individuals. Analysis suggests differences in ACARs are associated with ethnicity and age. Thus, each individual ACAR is relatively unique, suggesting that individualized information could be useful in precision medicine for predicting and monitoring immune health and resistance to disease. |
Scientific reports. 2020 Sep 22;10(1):1-5. | glycan; carbohydrate; anti-carbohydate antibodies |
| Luker AJ, Lownik JC, Conrad DH, Martin RK. | 2019 | * A new look at IgE beyond allergies. Immunoglobulin E (IgE), though constitutively present at low levels, is most commonly studied in atopic disease where it plays a vital role in mast cell degranulation and in initiating a T helper 2 (Th2) response. With the advent of better detection assays, however, researchers are discovering the importance of IgE in actively contributing to many disease states and pathologies. This review will discuss the latest findings in IgE beyond its role in allergies and recently discovered roles for IgE in its cell-bound form on FcepsilonRI-expressing effector cells like monocytes and dendritic cells. In terms of parasites, we will discuss helminth-induced IgE that appears to protect the worms from immune recognition and a tick-borne illness that elicits an IgE response against red meat. Next, we describe recent findings of how auto-reactive IgE can contribute to the progression of lupus and induce organ damage. Finally, we summarize the emerging roles of IgE in tumor surveillance and antibody-dependent cytotoxicity. We additionally discuss recent or ongoing clinical trials that either target harmful IgE or use the unique characteristics of the isotype. |
F1000Research. 2019;8. | review article; IgE; autoimmune disease; lupus; parasite; endoparasites; ectoparasites |
| Lunet N, Falcao H, Sousa M, Bay N, Barros H. | 2005 | Self‐reported food and drug allergy in Maputo, Mozambique. No abstract available Note: "The life prevalence of self-reported food allergy was 19.1%, and seafood (54.8%), meat (13.0%) and fruit/vegetables (13.0%) were the most frequentlyreported items." |
Public Health-London-Society of Public Health then Royal Institute of Public Health. 2005. | Africa; Mozambique; meat allergy; prevalence |
| Lungulescu CV, Ungureanu BS, Turcu-Stiolica A, Ghimpau V, Artene SA, Cazacu IM, Grecu AF, Dinescu VC, Croitoru A, Volovat SR. | 2020 | The role of IgE specific for galactose-α-1, 3-galactose in predicting cetuximab induced hypersensitivity reaction: a systematic review and a diagnostic meta-analysis. |
Scientific Reports. 2020 Dec 7;10(1):1-9. | pharmaceutical; biologic; monoclonal antibody; mAb; cetuximab |
| Luo S, Zhang B. | 2024 | A tailored lectin microarray for rapid glycan profiling of therapeutic monoclonal antibodies. |
InMabs 2024 Dec 31 (Vol. 16, No. 1, p. 2304268). Taylor & Francis. | |
| Ma D, Lun X, Li C, Zhou R, Zhao Z, Wang J, Zhang Q, Liu Q. | 2021 | Predicting the Potential Global Distribution of Amblyomma americanum (Acari: Ixodidae) under Near Current and Future Climatic Conditions, Using the Maximum Entropy Model. Amblyomma americanum (the lone star tick) is a pathogen vector, mainly from eastern North America, that bites humans. With global integration and climate change, some ticks that are currently confined to a certain place may begin to spread out; some reports have shown that they are undergoing rapid range expansion. The difference in the potential geographic distribution of A. americanum under current and future climatic conditions is dependent on environment variables such as temperature and precipitation, which can affect their survival. In this study, we used a maximum entropy (MaxEnt) model to predict the potential geographic distribution of A. americanum. The MaxEnt model was calibrated at the native range of A. americanum using occurrence data and the current climatic conditions. Seven WorldClim climatic variables were selected by the jackknife method and tested in MaxEnt using different combinations of model feature class functions and regularization multiplier values. The best model was chosen based on the omission rate and the lowest Akaike information criterion. The resulting model was then projected onto the global scale using the current and future climate conditions modeled under four greenhouse gas emission scenarios. |
J Investig Allergol Clin Immunol. 2022;32(4). | lone star tick; Amblyomma americanum; tick geography distribution |
| Ma Y, Flaherty MG | 2021 | Using Symptoms and Healthcare Encounters to Capture a Rare Disease: A Study of Clinical Notes of the Alpha‐Gal Meat Allergy. This paper examines clinical notes to identify reported symptoms and investigate patient-provider communication processes in alpha-gal syndrome (AGS). Clinical notes appear to be a credible and stable source of research where the researcher can find information regarding both symptoms and environmental factors of AGS. Compilation of notes could be used for a checklist to aid in diagnosis. This study analyzed clinicians' notes in patient records retrieved from the Electronic Medical Record Search Engine (EMERSE). The most reported symptoms fell into four general categories: skin (42%), inflammation (17%), gastrointestinal (20%), and anaphylaxis (21%). Environmental triggers were also commonly reported. This in-depth analysis of clinical notes of AGS can serve as a basis for future automation of rare disease analysis; moreover, it provides a basic understanding of the granularity of information that an electronic health record (EHR) may provide for rare disease identification. |
Proceedings of the Association for Information Science and Technology. 2021 Oct;58(1):273-81. | |
| Mabelane T, Basera W, Botha M, Thomas HF, Ramjith J, Levin ME. | 2018 | *Predictive values of alpha-gal IgE levels and alpha-gal IgE: Total IgE ratio and oral food challenge-proven meat allergy in a population with a high prevalence of reported red meat allergy. BACKGROUND: Severe meat allergy with anaphylaxis may be caused by sensitization to alpha-gal. Levels of alpha-gal sensitization that correlate with high risk of meat allergy are currently unknown. We have identified an area with a high prevalence of reported red meat allergy which offered the opportunity to evaluate the diagnostic value of IgE antibody tests. METHODS: To determine levels of alpha-gal IgE and alpha-gal:total IgE ratio in a large cohort of subjects with challenge-proven meat allergy compared with control subjects from the same environment, we conducted fieldwork assessing 131 participants who reported adverse reactions to meat, and 26 control subjects, by questionnaires, IgE sensitization to alpha-gal and oral food challenge to beef sausage. RESULTS: Eighty-four participants were diagnosed with alpha-gal allergy. Alpha-gal IgE ranged between 0.7 and 344.5 kU/L. Alpha-gal:total IgE ratio ranged from 0.1% to 67.6%. Logistic regression analysis showed both alpha-gal IgE and alpha-gal:total IgE ratio strongly correlated with meat allergy, with AUC of 0.95. The values giving the best correct classification were IgE of 2.00 kU/L and ratio of 0.75%. The value above which there is a 95% probability of meat allergy is IgE>5.5 kU/L and ratio of 2.12%. CONCLUSION: Alpha-gal allergy in a population with a high prevalence of reported red meat allergy showed a more rapid onset of symptoms than previously described and a high prevalence of isolated subjective gastrointestinal manifestations. Cutoff values are described for levels of sensitization to alpha-gal IgE and alpha-gal:total IgE ratio that are highly likely to result in clinically significant meat allergy. |
Pediatric Allergy and Immunology. 2018 Dec;29(8):841-9. | Africa; South Africa; prevalence; gastrointestinal symptoms; GI; diagnosis; testing; IgE levels; gastroenterology |
| Mabelane T, Botha M, Thomas HF, Levin M. | 2018 | Alpha Gal Allergy in rural black African subjects associated with a high prevalence of abdominal manifestations and a more rapid onset of symptoms. RATIONALE: Reports were received of high prevalence of meat allergy in black African subjects in the rural Eastern Cape Province of South Africa. METHODS: 85 subjects were diagnosed with alpha-gal allergy during fieldwork conducted in the 1 month period of June 2017. Questionnaires assessed symptoms to meat ingestion. Sensitisation was confirmed with ImmunoCAP to alpha-gal. 83 were diagnosed by a positive Oral Food Challenge (OFC) to beef sausage and 2 by a very high alpha-gal IgE and alpha-gal:total-IgE ratio with recent severe symptoms. . RESULTS: 67% were female; median age was 12 years (IQR 8-25). 90.6% reported multiple reactions and 7.1% a dose response. Median delay from 1st symptoms to diagnosis was 6 years (IQR 3-8). The most recent reaction prior to diagnosis was experienced at a median of 1 year (IQR 0-5) prior to diagnosis. 10.6% recalled tick bites (no people noted reactivation of tick bite site on meat ingestion), 48.2% scabies, 24.7% worms and 9.4% bilharzia. Alpha-gal IgE ranged between 0.7 and 663 kU/L (median 11.9, IQR 4.1-32.8). Alpha-gal:Total IgE ratio ranged from 0.1 to 67.9% (median 4.3; IQR 1.8-11.0). OFC using predetermined major and minor objective criteria resulted in abdominal symptoms (abdominal pain, vomiting, diarrhoea) in 77.1%, skin reactions (scratching, hives, erythema or angioedema) in 51.8% and severe reactions (respiratory symptoms or hypoperfusion) in 6%, from 45 to 375 minutes (median 105; IQR 85-135) after ingestion. CONCLUSIONS: Alpha-gal allergy in 85 rural black African subjects showed rapid onset of symptoms and a high prevalence of gastrointestinal manifestations. |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB200. | Africa; South Africa; gastrointestinal symptoms; GI; vectors; parasites; endoparasites; ectoparasites; mites; scabies; gastroenterology |
| Mabelane T, Ogunbanjo GA. | 2019 | Ingestion of mammalian meat and alpha-gal allergy: Clinical relevance in primary care. BACKGROUND: An allergic reaction to mammalian meat has recently been reported in rural parts of South Africa and throughout other parts of the world. The cause of this allergic reaction is because of an oligosaccharide antigen known as galactose-alpha-1, 3-galactose (alpha-gal) found in mammalian meat. Hard ticks in various parts of the world have been identified as a cause of sensitisation to the alpha-gal antigen. However, mechanisms of sensitisation in Africa are poorly understood. AIM: The aim of this article is to review current literature on the alpha-gal allergy and mammalian meat ingestion and the family physician's role in diagnosing and managing this condition. . METHOD: Indexes were searched using the keywords in the following electronic databases: Elsevier Science Direct, Google Scholar, Medline and PubMed. . RESULTS: Clinical presentation of the alpha-gal allergy occurs typically as a delayed anaphylaxis occurring within 3-6 hours after the ingestion of mammalian meat. A subset of patients described in South Africa presented with a rapid onset of symptoms occurring within 45 minutes. Furthermore, some of these patients present with abdominal symptoms only, which may be mistaken as food poisoning. Diagnosis is based on a history of reaction to mammalian meats (especially to fatty portions or organs) and serum specific alpha-gal antibodies. The main management of the alpha-gal allergy is avoidance of red meat and in mild reactions treatment with oral H1 receptor antihistamines. CONCLUSION: Sensitisation to the alpha-gal allergy results in adverse reactions to red meat, with tolerance to turkey, chicken and fish. A family physician can safely manage this condition. |
African Journal of Primary Health Care & Family Medicine. 2019;11(1):1-5. | Africa; South Africa; review article; primary care; management; gastrointestinal symptom; GI; gastroenterology |
| Macdougall JD, Thomas KO, Iweala OI. | 2022 | The Meat of the Matter: Understanding and Managing Alpha-Gal Syndrome. |
ImmunoTargets and Therapy. 2022 Sep 15;11:37-54. | Review article |
| Macharadze DS, Adaeva-Janaeva HA, Muslimova ZA, Sepiashvili RI. | 2014 | Allergy to red mammalian meat in adult patients. First case reports in Russian. No abstract available |
International Journal on Immunorehabilitation. 2014;16(2):72-6. | Europe; Asia; Russia |
| Macher BA, Galili U. | 2008 | The Galα1,3Galβ1,4GlcNAc-R (α-Gal) epitope: A carbohydrate of unique evolution and clinical relevance. In 1985, we reported that a naturally occurring human antibody (anti-Gal), produced as the most abundant antibody (1% of immunoglobulins) throughout the life of all individuals, recognizes a carbohydrate epitope Galα1–3Galβ1–4GlcNAc-R (the α-gal epitope). Since that time, an extensive literature has developed on discoveries related to the α-gal epitope and the anti-Gal antibody, including the barrier they form in xenotransplantation and their reciprocity in mammalian evolution. This review covers these topics and new avenues of clinical importance related to this unique antigen/antibody system (α-gal epitope/anti-Gal) in improving the efficacy of viral vaccines and in immunotherapy against cancer. |
Biochimica et Biophysica Acta (BBA)-General Subjects. 2008 Feb 1;1780(2):75-88. | xenotransplantation; evolution; cancer |
| Mackenzie KJ. | 2015 | Implications of xenoglycan sensitivity for increased cancer risk. Letter to the editor: The excellent study by Samraj et al. (1) shows that dietary intake of the nonhuman sialic acid N-glycolylneuraminic acid (Neu5Gc) promotes the production of anti-Neu5Gc antibodies. The resulting “xenosialitis” and associated chronic inflammation was shown to contribute to carcinogenesis. This article (1) reminded me of another cancer-associated nonhuman glycan stimulating an inflammatory response in the digestive tract of patients. Commins et al. (2) had reported high circulating levels of antigalactose-α-1,3-galactose (α-gal) antibodies in patients that had been exposed to Amblyomma americanum (Lone Star tick) in the states of Tennessee, North Carolina, Arkansas, Virginia, and the southern half of Missouri, which induced allergic reactions in these patients to red meat (beef, pork, and lamb) after exposure. The authors described levels of circulating anti–α-gal IgE, which increased with number of exposures (tick bites). This allergic reaction was also described in patients receiving chemotherapy using Cetuximab (3). Cetuximab is a chimeric mouse–human IgG1 monoclonal antibody against the epidermal growth factor receptor, approved for use in metastatic colorectal cancer and squamous-cell carcinoma of the head and neck. Being produced in mice, Cetuximab was glycosylated with α-gal and was therefore not tolerated by the patients already sensitized to α-gal from their previous tick exposure. According to the manufacturer, severe hypersensitivity reactions to Cetuximab occur in 3% of patients. However, higher rates and clusters of cases have been reported in the same states where A. americanum exposure is common, with reports of 22% of patients who were treated with Cetuximab in Tennessee and North Carolina having severe hypersensitivity reactions (3). ). With the evidence that Samraj et al. (1) have put forward for chronic inflammation from anti-Neu5Gc antibodies leading to an increased risk of gastrointestinal cancers in mice, it would seem reasonable to assume that high levels of anti–α-gal antibodies may have a similar effect. It may not be entirely unconnected that these patients presensitized to Cetuximab are in the clinic receiving chemotherapy. ). It would therefore seem prudent to use the evidence put forward by Samraj et al. (1) as the basis for further study of the effects of A. americanum bites and cancer risk. In the interim period, the states of Tennessee, North Carolina, Arkansas, Virginia, and Missouri should be adopting a more rigorous screening program for digestive tract cancers in patients known to have high circulating levels of anti–α-gal antibodies caused by tick bites. ). |
Proceedings of the National Academy of Sciences. 2015 Mar 24;112(12):E1404-. | oncology; cancer; gastrointestinal; gastroenterology; glycan antigen; glycan antibody; sialic acid; Neu5Gc |
| Madison-Antenucci S, Kramer LD, Gebhardt LL, Kauffman E. | 2020 | Emerging Tick-Borne Diseases. Increases in tick-borne disease prevalence and transmission are important public health issues. Efforts to control these emerging diseases are frustrated by the struggle to control tick populations and to detect and treat infections caused by the pathogens that they transmit. This review covers tick-borne infectious diseases of nonrickettsial bacterial, parasitic, and viral origins. While tick surveillance and tracking inform our understanding of the importance of the spread and ecology of ticks and help identify areas of risk for disease transmission, the vectors are not the focus of this document. Here, we emphasize the most significant pathogens that infect humans as well as the epidemiology, clinical features, diagnosis, and treatment of diseases that they cause. Although detection via molecular or immunological methods has improved, tick-borne diseases continue to remain underdiagnosed, making the scope of the problem difficult to assess. Our current understanding of the incidence of tick-borne diseases is discussed in this review. An awareness of the diseases that can be transmitted by ticks in specific locations is key to detection and selection of appropriate treatment. As tick-transmitted pathogens are discovered and emerge in new geographic regions, our ability to detect, describe, and understand the growing public health threat must also grow to meet the challenge. |
Clinical Microbiology Reviews. 2020 Mar 18;33(2). | |
| Mahmoud M, Mahmoud MA, Eweje P. | 2023 | S2894 Unusual Cause of Postprandial Epigastric Pain in Patient With Presumed IBS. |
Official journal of the American College of Gastroenterology| ACG. 2023 Oct 1;118(10S):S1960-1. | GI phenotype; GI variant; gastroenterology; IBS; differential diagnosis |
| Majewska NI, Tejada ML, Betenbaugh MJ, Agarwal N. | 2020 | N-Glycosylation of IgG and IgG-Like Recombinant Therapeutic Proteins: Why Is It Important and How Can We Control It?. Regulatory bodies worldwide consider N-glycosylation to be a critical quality attribute for immunoglobulin G (IgG) and IgG-like therapeutics. This consideration is due to the importance of posttranslational modifications in determining the efficacy, safety, and pharmacokinetic properties of biologics. Given its critical role in protein therapeutic production, we review N-glycosylation beginning with an overview of the myriad interactions of N-glycans with other biological factors. We examine the mechanism and drivers for N-glycosylation during biotherapeutic production and the several competing factors that impact glycan formation, including the abundance of precursor nucleotide sugars, transporters, glycosidases, glycosyltransferases, and process conditions. We explore the role of these factors with a focus on the analytical approaches used to characterize glycosylation and associated processes, followed by the current state of advanced glycosylation modeling techniques. This combination of disciplines allows for a deeper understanding of N-glycosylation and will lead to more rational glycan control. |
Annual Review of Chemical and Biomolecular Engineering. 2020 Mar 16;11. | biologic; monoclonal antibody; mAb; pharmaceutical |
| Maki CK, Saunders EF, Taylor ML, Commins SP, Waller LA, Salzer JS. | 2025 | Time From Onset to Diagnosis of Alpha-Gal Syndrome. In this cohort, the time between first symptom onset and confirmed AGS diagnosis has shortened 70-fold over time. Higher educational attainment was the only measured demographic factor associated with improved diagnosis time. The delay in diagnosis for those with lower levels of education highlights a clear gap in access to care, even among this unique cohort with eventual access to a medical specialist and AGS expert. |
JAMA Network Open. 2025 Mar 3;8(3):e2461729-. | diagnosis; time to diagnosis; epidemiology |
| Mäkinen-Kiljunen S, Kiistala R, Varjonen E. | 2003 | Severe reactions from roe without concomitant fish allergy. Objective: To describe 2 cases of IgE-mediated allergy to 2 roe species. Methods: Two patients, one with local symptoms and the other with anaphylaxis following ingestion of roe, underwent skin prick testing (SPT) with 2 roe species, whitefish roe (WFR) and rainbow trout roe (RTR). Serum samples were taken for IgE measurement and immunoblotting to identify roe allergens. Inhibition studies were performed to scrutinize the cross-reactivity between the roes and to fish. Results: The results of the SPTs with the roes were clearly positive in both patients but negative in control persons. The results of SPTs to all other foods were negative. Roe-specific IgE levels were elevated in the serum samples of both patients. Immunoblotting revealed different IgE-binding patterns of the extracts and different inhibition profiles with the serum samples. In WFR blotting, both serum samples detected a heavy IgE-binding band at approximately 20 kDa, which was not inhibited with fish. Cross-reactivity between the roes was demonstrated in the patient with local symptoms from RTR but not in the patient with anaphylaxis from WFR. The first serum sample also detected several IgE-binding bands in the RTR blot, the most intensive at 21 to 23 kDa and 30 kDa, which were partially inhibited by WFR and more completely with fish. The anaphylaxis patient did not detect allergens in the RTR blot. After the investigation, the patients have remained symptom free and able to consume all kinds of fish without problems. Conclusions: IgE-mediated allergy to roe is possible without concomitant fish allergy. Roe allergy should be explored in patients who test negative to fish but are suspected of having seafood-related allergy. |
Annals of Allergy, Asthma & Immunology. 2003 Oct 1;91(4):413-6. | Fish roe; whitefish; concomitant dog allergy |
| Malandain H. | 2005 | IgE-reactive carbohydrate epitopes--classification, cross-reactivity, and clinical impact. A glycan-related IgE-reactivity has been demonstrated in most allergen sources, especially in plant kingdom. Recent progress in glycobiology has allowed a clearer classification of these glyco-epitopes. Unlike classical peptide chain-based epitopes, glyco-epitopes can share significant structural homologies beyond the limits of protein families. These glycoepitopes are thus prone to extensive cross-reactivity. They have been called Cross-reactive Carbohydrate Determinants or CCD. Many of these glyco-epitopes behave as "panepitopes", leading to cross-reactivity between products as distant as pollens and hymenoptera venoms. But CCD are not universally cross-reactive and they rather cluster into subgroups such as plant CCD or fungal CCD. Because a monovalent IgE-binding is sufficient in serum-based assays, glyco-epitopes and CCD are classically considered as a potential source of positive in vitro results without clinical significance. But some authors recently demonstrated that glyco-epitopes could induce a response at the cell level and suggested that they might play a role in vivo. As long as in vitro assays include glycan- and CCD-related IgE responses, laboratory results should be carefully interpreted in the light of existing knowledge about the glycomes of natural products. IgE-reactivity of the patient's serum can also be tested towards a glycoprotein model such as bromelain. |
European annals of allergy and clinical immunology. 2005 Apr;37(4):122-8. | |
| Maldonado-Ruiz LP, Montenegro-Cadena L, Blattner B, Menghwar S, Zurek L, Londono-Renteria BL. | 2019 | Differential Tick Salivary Protein Profiles and Human Immune Responses to Lone Star Ticks (Amblyomma americanum) From the Wild vs. a Laboratory Colony. Ticks are a growing concern to human and animal health worldwide and they are leading vectors of arthropod-borne pathogens in the United States. Ticks are pool blood feeders that can attach to the host skin for days to weeks using their saliva to counteract the host defenses. Tick saliva, as in other hematophagous arthropods, contains pharmacological and immunological active compounds, which modulate local and systemic immune responses and induce antibody production. In the present study, we explore differences in the salivary gland extract (SGE) protein content of Amblyomma americanum ticks raised in a laboratory colony (CT) vs. those collected in the field (FT). First, we measured the IgG antibody levels against SGE in healthy volunteers residing in Kansas. ELISA test showed higher IgG antibody levels when using the SGE from CT as antigen. Interestingly, antibody levels against both, CT-SGE and FT-SGE, were high in the warm months (May-June) and decreased in the cold months (September-November). Immunoblot testing revealed a set of different immunogenic bands for each group of ticks and mass spectrometry data revealed differences in at 19 proteins specifically identified in the CT-SGE group and 20 from the FT-SGE group. Our results suggest that differences in the salivary proteins between CT-SGE and FT-SGE may explain the differential immune responses observed in this study. |
Frontiers in Immunology. 2019;10:1996. | |
| Maldonado-Ruiz LP, Reif KE, Ghosh A, Foré S, Johnson RL, Park Y. | 2024 | High levels of alpha-gal with large variation in the salivary glands of lone star ticks fed on human blood. |
Scientific Reports. 2023 Dec 4;13(1):21409. | Vector; tick; lone star tick; pathogenesis; genetics; population variability |
| Malisiewicz B, Kaufmann R, Valesky E. | 2017 | Delayed anaphylaxis after the ingestions of kidney skewer - a link between alpha-Gal and mastocytosis. IgE-mediated delayed-type anaphylactic reactions after the ingestion of red meat represent a young entity. Specific IgE antibodies against the carbohydrate alpha-Gal are responsible for the clinical occurrence of anaphylactic reactions after consumption of red meat. Known trigger factors are physical activity, alcohol, infections, or taking nonsteroidal anti-inflammatory drugs. We report a 46-year-old patient who experienced an intensive care-dependent anaphylactic reaction grade III a few hours after the consumption of a kidney skewer. A type-I sensitization against pork, beef, and alpha-Gal could be proven. Further serological analysis detected an elevated basal tryptase. A subsequent hema-to-oncological evaluation revealed, alongside a known cutaneous mastocytosis, an indolent systemic mastocytosis. This case is highlighting the relevance of this specific allergy type. In unclear anaphylaxis, this entity should be taken into account as a differential diagnosis. Furthermore an indolent systemic mastocytosis should be evaluated alongside the known trigger factors. |
ALLERGOLOGIE. 2017 Dec 1;40(12):517-21. | mast cell disorder; mastocytosis |
| Mamikoglu B. | 2005 | Beef, pork, and milk allergy (cross reactivity with each other and pet allergies). Objective: The purposes of this study were to examine milk allergic patients to determine concomitant reactivity between milk, beef, pork and cat and dog dander and other common inhalant allergens. Methods: 19 patients were selected according to their Immuno-CAP results, which had increased Ig-E levels against milk, pork or beef. Patients were also tested against Johnson grass, short ragweed, cat/dog dander and d. farina. . Results: Pearson’s test revealed strong correlation between beef and pork, beef and milk, pork and milk Ig-E counts (consecutively r2 = 0.89, r2 = 0.81, r2 = 0.60 and p < 0.01. All cat allergic patients also appeared to be allergic to either beef/pork meat or milk. The correlation between pork and dog dander Ig-E counts was also significant (r2 = 0.38, p < 0.01). No correlation detected between milk-meat-pet and grass-weed-dust allergies. . Discussion and conclusion: Patients who are known to have pet allergies may need to be screened for meat and milk allergy. Milk allergic patients may also need to avoid cows and pork meat. |
Otolaryngology-Head and Neck Surgery. 2005 Oct 1;133(4):534-7. | Meat allergy; cross-reactivity; screening; pets; milk |
| Mangla A, Agarwal N. | 2019 | Relevance of Anti–Galactose-α-1, 3-Galactose Antibodies in the Era of Monoclonal Antibodies. Letter to the editor |
Journal of Oncology Practice. 2019 Dec;15(12):679-80.. | pharmacy; pharmaceutical; biologic; biological agent; monclonal antibody; cetuximab; olaratumab; canakinumab; golimumab; ustekinumab; daclizumab; tralokinumab; Sp2/0 mouse myeloma cell line; NS0 murine myeloma cell line; Chinese hamster ovary; CHO |
| Mangold A, Hercher D, Hlavin G, Liepert J, Zimmermann M, Kollmann D, Feichtinger G, Lichtenauer M, Mitterbauer A, Ankersmit HJ. | 2012 | Anti-alpha-Gal antibody titres remain unaffected by the consumption of fermented milk containing Lactobacillus casei in healthy adults. Alpha-Gal is a glycoconjugate present on cell membranes of non-primate mammals and bacteria, but not in humans, who display anti-Gal antibodies (ABs) in high titres. Probiotics contain bacterial strains which colonize the intestinal tract. In the present study, we investigated whether intake of fermented milk containing Lactobacillus casei (FML) affects anti-Gal AB titres. Serum was drawn from healthy probands (n = 19) for 6 weeks. After the second week, the probands consumed 125 ml of FML per day. Anti-Gal ABs of all isotypes and cytokines were measured. Bacterial cultures were bred from FML and bacteria were stained for alpha-Gal. Concentration of bacteria in FML was manifold higher than in conventional yoghurt (2 × 105/g yoghurt vs. 1.1 × 107/g FML). Both stained highly positive for Alpha-Gal. Alpha-Gal-specific ABs and cytokines remained unaffected by FML intake. Our results indicated that the consumption of FML does not elicit a humoral immune response in healthy adults. |
International journal of food sciences and nutrition. 2012 May 1;63(3):278-82. | diet; lactobacilli; yoghurt |
| Mangold A, Lebherz D, Papay P, Liepert J, Hlavin G, Lichtenberger C, Adami A, Zimmermann M, Klaus D, Reinisch W, Ankersmit HJ. | 2011 | Anti-Gal titers in healthy adults and inflammatory bowel disease patients. Introduction: ALPHA-GAL is a glycoconjugate present on cell membranes of mammals and bacteria but not humans who display anti-Gal antibodies (AB) in high titers provoked by the commensal gut flora. In the present study, we sought to determine the longitudinal course of alpha-Gal specific AB titers of all isotypes over 8 weeks among healthy adult subjects. Furthermore, we hypothesized that inflammatory bowel disease (IBD) patients display increased anti-Gal titers. Materials and methods: We drew serum from healthy probands (n = 20) weekly for 8 weeks and obtained plasma samples of from patients suffering from Crohn's disease (n = 20) and ulcerative colitis (n = 20). We measured anti-Gal ABs of all isotypes and total immunoglobulin (Ig) content using an enzyme-linked immunosorbent assay technique. For statistical evaluation of the longitudinal titers, we calculated confidence intervals for the slopes of a random intercept model, comparing variances between and within the probands. For group comparisons, we performed paired student t-tests and Pearson correlations. . Results: Alpha-Gal specific IgG, IgM, IgD, and IgA titers remained unvaried within a narrow range upon longitudinal observation. Most probands did not display alpha-Gal specific IgE ABs. Crohn's disease patients showed highly increased alpha-Gal-specific IgA titers compared with control subjects (P < .01). . Conclusion: Apart from IgE, alpha-Gal-specific ABs of all isotypes remained constant over longer time periods in healthy subjects. Thus, significant titer changes actually represent increased antigen exposure and a specific anti-alpha-Gal response. Crohn's disease patients display increased anti-Gal IgA titers compared with healthy controls, which reflects a chronically impaired mucosal gut barrier in this patient cohort. . |
Transplantation Proceedings 2011 Dec 1; 43(10):3964-3968). | autoimmune disease; Crohn's; gastroenterology; gastrointestinal; GI |
| Mangold A, Szerafin T, Hoetzenecker K, Hacker S, Lichtenauer M, Niederpold T, Nickl S, Dworschak M, Blumer R, Auer J, Ankersmit HJ. | 2009 | Alpha-Gal Specific IgG Immune Response after Implantation of Bioprostheses. Background: We have previously shown that the α‐Gal (Galα1.3-Galβ1–4GlcNAc-R) epitope is a relevant xenoantigen present on bioprostheses utilized in cardiac surgery and elicits an α‐Gal specific IgM immune response. We sought to investigate whether that immune response continues after valve implantation. Materials and Methods: We collected plasma samples from patients who underwent bioprosthesis implantation (n = 19) or mechanical valve replacement (n = 8), respectively, prior to, at 10 days and at 3 months after cardiac surgery. ELISA was utilized to quantify α‐Gal specific IgG and IgG subclasses. 3 bioprosthetic tissue samples were obtained from patients who had to undergo re-operation within 1 week (n = 1) or at 12–15 months (n = 2) after the initial operation. We utilized confocal laser scanning microscopy (CLSM) to detect the presence of α‐Gal epitopes (IB4) and cell nuclei (DAPI). Results: α‐Gal specific IgG was significantly increased 3 months after implantation of bioprostheses compared to preoperative values (p < 0.001) and was significantly higher than α‐Gal specific IgG levels of the control group (p < 0.05). IgG3 was the major subclass directed against α‐Gal (p < 0.05, pre- vs. postoperative values). In CLSM analysis we demonstrated that bioprostheses explanted 1 week after implantation contained IB4/DAPI positive cells within the collagen matrix. In contrast, in patients who underwent reoperation after 12 months, porcine tissue showed a complete lack of IB4/DAPI. Conclusion: Our results indicate that the implantation of bioprostheses elicits a specific humoral immune response against α‐Gal bearing cells compared to controls within 3 months after cardiac surgery. The complete absence of IB4/DAPI positive structures 12 months after implantation indicates a specific degradation of α‐Gal bearing cells through previous exposure to the human blood circuit. |
The Thoracic and cardiovascular surgeon. 2009 Jun;57(04):191-5. | heart; cardiac surgery; bioprosthetic heart valves; xenotransplantation |
| Marchal O, Allali D. | 2020 | § [Red Meat Allergy] The goal of this article is to provide an informative review on allergy to mammalian meat. The main allergen contained in « red meat » is the alpha-gal (galactose-alpha-1,3-galactose) that is found in all non-primate mammalian tissues. IgE-mediated allergy to alpha-gal appears typically delayed from the consumption of meat, often three to six hours after ingestion of meat. Common allergic reactions include isolated gastrointestinal symptoms but can potentially be life-threatening with severe anaphylaxis. Diagnosis relies on a thorough clinical history, skin-prick testing and the search for specific IgE. The management of meat allergy consists in the avoidance of all mammalian meat (including gelatins) and other pharmaceutical products that can contain alpha-gal, especially cetuximab. |
Rev Med Suisse. 2020;16(689):684-687. | review |
| Marimuthu MM, Sundaram VA, Emran TB. | 2024 | Extending discussion on alpha-gal syndrome: research needs, clinical significance, and more broad consequences. |
Annals of Medicine and Surgery. 2024 Dec 1;86(12):7482-3. | India; Bangladesh |
| Mariotte D, Dupont B, Gervais R, Galais MP, Laroche D, Tranchant A, Comby E, Bouhier-Leporrier K, Reimund JM, Le Mauff B. | 2011 | Anti-cetuximab IgE ELISA for identification of patients at a high risk of cetuximab-induced anaphylaxis. Cetuximab, a chimeric mouse-human IgG1 monoclonal antibody against the epidermal growth factor receptor, has proven effective in the treatment of metastatic colorectal cancer and squamous cell carcinoma of the head and neck. However, a high incidence of immediate hypersensitivity reactions (HSR) to cetuximab after the first infusion has been observed. We have developed a test for identification of patients likely to show treatment-related HSR to cetuximab. An enzyme-linked immunosorbent assay (ELISA) for detecting anti-cetuximab IgEs was developed and tested on serum samples collected from cancer patients before start of cetuximab treatment, and from healthy blood donors. Similar levels of anti-cetuximab IgE were detected in pre-treatment patient sera (24/92, 26.1%) and sera from healthy blood donors (33/117, 28.2%). HSR were observed in 14 out of the 92 patients (15.2%), and 8 of these (57.1%) were grade 3-4. Anti-cetuximab IgEs were detected in 7/8 of the patients (87.5%) with severe HSRs as compared with 14/78 patients (17.9%) with no HSR (p=0.0002). Predictive value of the anti-cetuximab IgE test for HSR events of grades 3-4 was calculated using Receiver Operating Characteristics analysis. With a cut-off value of 29 arbitrary units for the anti-cetuximab IgE, the ELISA test showed a sensitivity of 87.5%, specificity of 82.1%, positive predictive value of 33.3% and negative predictive value of 98.5%. Anti-cetuximab IgE ELISA detection could be a valuable tool to help the physician anticipate an anaphylaxis episode following cetuximab infusion and opt for a suitable alternative treatment. |
MAbs 2011 Jul 1; 3(4):396-401. | |
| Marrugo J, Hernández L, Villalba V. | 2008 | Prevalence of self-reported food allergy in Cartagena (Colombia) population. BACKGROUND:Food allergy (FA) is an important health problem in western societies; however, there are no data available from developing countries. Studies based on self-reported symptoms range from 1.4 % to 33 %, and it is supposed that FA is more prevalent early in life. To our knowledge in Latin America there has not been a report on prevalence estimates for food allergy in unselected population-based studies. OBJECTIVES:The aim of this study was to determine the prevalence of self-reported food allergy, the most frequent symptoms, the allergens, and the risk factors for FA in a population from Cartagena (Colombia). METHODS:This is a cross-sectional study. A total of 3099 (55.4 % Female, and 44.6 % Male) individuals in a randomised selection, aged 1-83 years, living in neighbourhoods in Cartagena, were asked questions about personal and family history of allergies and food allergy. RESULTS:The overall prevalence of self-reported FA was 14.9 % (Total 461 subjects, 16.4 % female, 12.8 % male). Fruit/vegetables (41.8 %), seafood (26.6 %), and meats (20.8 %), were the most reported allergens. The most frequently reported symptoms were skin (61.4 %), gastrointestinal (29.1 %), and respiratory reactions (8.6 %). FA was most frequent in subjects reporting atopic diseases (62.9 % vs. 29.6 %, chi2 test, p < 0.001). CONCLUSIONS:Self-reported FA was determined in Cartagena population. Fruit/vegetables, seafood, and meats were the most reported allergens. Skin and gastrointestinal symptoms were the most frequent manifestation of FA. Our study is the first report on prevalence estimates for food allergy in a Latin American country. |
Allergologia et immunopathologia. 2008 Nov 1;36(6):320-4. | Latin America; Colombia; meat allergy; prevalence |
| Martelli A, De Chiara A, Corvo M, Restani P, Fiocchi A. | 2002 | Beef allergy in children with cow's milk allergy; cow's milk allergy in children with beef allergy. |
Annals of Allergy, Asthma & Immunology. 2002 Dec 1;89(6):38-43. | beef allergy; milk allergy |
| Martín-Lázaro J, Núñez-Orjales R, González-Guzmán LA, González MT, Boquete M, Carballada F. | 2019 | Galactose-alpha-1,3-galactose (alpha-gal) allergy: first pediatric case in a series of patients in Spain. Introduction and Objectives: Allergy to galactose-α-1,3-galactose (alpha-gal) is a peculiar form of food allergy generally manifesting as an anaphylactic reaction hours after mammalian meat consumption, due to the presence of specific IgE against this oligosaccharide. In addition, immediate anaphylaxis may develop after exposure to other sources of alpha-gal, such as monoclonal antibody cetuximab, vaccines, plasma expanders or anti-snake venoms. Sensitization to alpha-gal has also been implicated in the rapid degeneration of biological valve implants, and recognized as a cause of occupational disease in cattle raisers. The implication of tick bites in this type of sensitization has been accepted by all the research groups dedicated to this disease. Patients and method: The present study describes the clinical and sensitization characteristics of 39 patients diagnosed with alpha-gal allergy in the hospitals of our province (Lugo, Monforte de Lemos and Burela, Spain). . Results: Most patients were middle-age males. Of note, is the fact that the series includes the first pediatric patient reported in Spain to date. The predominant clinical manifestations were urticaria or delayed anaphylaxis after consumption of mammalian meat. Seventy-four percent of the patients reported having suffered a previous tick bite, and the clinical presentation of anaphylaxis was significantly more prevalent in those with a persistent local reaction following the bite than in those with no such reaction (p = 0.032). . Conclusions: A review is also made of the disorder which, due to its variable clinical expression, is referred to as alpha-gal syndrome. The study concludes that a diagnosis of alpha-gal allergy should be considered in patients with urticaria-anaphylaxis of uncertain origin or manifesting after the administration of vaccines or products of bovine/porcine origin. |
Allergologia et immunopathologia. 2020 May 1;48(3):251-8. | Martin-Lazaro J; Nunez-Orjales R; Gonzalez-Guzman LA, Gonzalez MT |
| Martínez-Arcediano A, Audícana Berasategui MT, Areso L, Villarreal Balza De Vallejo MO, Velasco Azagra M, Campandegui Lecuona A, Marquínez Ruíz De Arbulo MB, Ollo Morales P, Fernandez Ibañez E. | 2022 | The relevance of compounding factors and the risk of anaphylaxis in 63 patients allergic to alpha-gal. Background: Compounding factors have been frequently described as helpers in food allergic reactions, not only favouring but also intensifying them. However, in alpha-gal syndrome, cofactors haven been controversial or not clearly identified. Objective: Analyze the data in 63 alpha-gal allergic patients studied in the last 8 years in Araba University Hospital (HUA;Vitoria-Gasteiz;Basque Country, north of Spain), in order to clarify the envolvement of compounding factors, their relevance, and the risk of anaphylaxis. Method: We report 10 women and 53 men (range, 9-86 years) including 2 children and 1 teenager, diagnosed of alpha-gal allergy by skin tests to mammalian meat extracts and to cetuximab;specific IgE to mammalian meats, alpha-gal and Activation Basophil Test (BAT) in 26 cases. The number of patients which presented severe allergic reactions and the implication of possible cofactors involved in severe and non-severe allergic reactions are collected. Results: In 46 % of the patients (29/63), compounding factors were reported. Compounding factors were NSAIDs, exercise, alcohol, emotional stress, intense hot weather, infections, Angiotensin Converting Enzyme (ACE) Inhibitors and Proton Pump Inhibitors (PPIs). NSAIDs were the most reported (8/29), followed by exercise (7/29);alcohol (6/29);infections (3/29) 1 SARS-CoV- 2 virus infection, 1 Varicela virus and 1 bacterial infection. ACE Inhibitors (2/29);PPIs (1/29);intense hot weather (1/29) and emotional stress (1/29). Severe allergic reactions were presented in 44% (28/63) of total cases. Cofactors were involved in 12/28 severe patients (43%). Cofactors were presented in 3/5 anaphylactic shocks (2 alcohol, one of them associated with a bacterial infection, 1 emotional stress) and in 9/23 anaphylaxis (4 exercise, 3 NSAIDs, 1 PPIs, 1 alcohol). 35 cases were non-severe reactions. Cofactors were involved in 29% of non-severe reactions. In 3/35, various compounding factors were involved (9%). Case number (no) 1 exercise and NSAID (diclofenac);no 2 exercise and ACE inhibitor;no 3 exercise, NSAID and intense hot weather. Conclusion: We present 63 allergic alpha gal patients registered in the last 8 years in which, 1. Almost half of the patients, present severe allergic reactions. 2. Compounding factors are presented in 44% of the allergic reactions. 3. In severe cases, compounding factors are involved in 43% of the patients versus in 29% non-severe reactions. |
Allergy: European Journal of Allergy and Clinical Immunology. 2021:546-7. | cofactor |
| Martínez-Arcediano A, de La Viuda Camino E, Ruiz de Galarreta Beristain M, Velasco Azagra M, Longo Areso MN. | 2024 | Is Alpha-Gal an Emerging Allergen in Drug Allergy?. |
Current Treatment Options in Allergy. 2024 Aug 9:1-9. | medical products; drugs; medical devices; perioperative; surgery; Europe; Spain |
| Mateo Borrega MB, Garcia B, Larramendi CH, Azofra J, González Mancebo E, Alvarado MI, Alonso Díaz de Durana MD, Núñez Orjales R, Diéguez MC, Guilarte M, Soriano Galarraga AM, Sosa G, Ferrer A, García Moral A, Beristain AM, Bartra J. | 2019 | IgE-mediated sensitization to galactose-alpha-1,3-galactose (alpha-gal) in urticaria and anaphylaxis in Spain: geographical variations and risk factors. BACKGROUND: The objectives of this study were to investigate the prevalence of sIgE to galactose-α-1,3-galactose (α-gal) in individuals with acute urticaria or anaphylaxis from different geographical areas of Spain and to evaluate the relevance of demographics and lifestyle as risk factors for this immune response. METHODS: Participants were recruited from allergy departments at 14 Spanish hospitals. Patients aged 18 years or older presenting with urticaria or anaphylaxis were enrolled into one of 2 arms: cases and controls. An interviewer-administered questionnaire collecting demographic data, lifestyle habits, and the presence of cofactors was obtained from each participant. sIgE to α-gal and total IgE were determined using ImmunoCAP. sIgE levels ≥0.35 kU/L were considered a positive result. . RESULTS: The study population comprised 160 cases and 126 controls. The median age was 44 years. The overall prevalence of a positive result of sIgE to α-gal was 15.7%; this was higher in cases (26.3%) than in controls (2.4%). The sIgE anti-α-gal positivity rate ranged from 37.68% (rural) to 15.38% (semiurban), and 7.85% (urban). The rates of positivity were 46.32%, (Northern), 0.72% (Center), and 0% (Mediterranean). A positive result for sIgE to α-gal was associated with a history of tick bites, participation in outdoor activities, pet ownership, and ingestion of mammalian meats or innards before the onset of symptoms. Only alcohol consumption could be implicated as a cofactor. . CONCLUSION: Sensitization to α-gal in patients with urticaria or anaphylaxis differs considerably between the 3 geographical areas studied and is related to tick bites. |
Journal of Investigational Allergology & Clinical Immunology. 2019 Jan 24;29(6):436-43. | Europe; Spain; prevalence |
| Mateos-Hernández L, Obregón D, Maye J, Borneres J, Versille N, de la Fuente J, Estrada-Peña A, Hodžić A, Šimon L, Cabezas-Cruz A. | 2020 | Anti-Tick Microbiota Vaccine Impacts Ixodes ricinus Performance during Feeding The tick microbiota is a highly complex ensemble of interacting microorganisms. Keystone taxa, with a central role in the microbial networks, support the stability and fitness of the microbial communities. The keystoneness of taxa in the tick microbiota can be inferred from microbial co-occurrence networks. Microbes with high centrality indexes are highly connected with other taxa of the microbiota and are expected to provide important resources to the microbial community and/or the tick. We reasoned that disturbance of vector microbiota by removal of ubiquitous and abundant keystone bacteria may disrupt the tick-microbiota homeostasis causing harm to the tick host. These observations and reasoning prompted us to test the hypothesis that antibodies targeting keystone bacteria may harm the ticks during feeding on immunized hosts. To this aim, in silico analyses were conducted to identify keystone bacteria in the microbiota of Ixodes nymphs. The family Enterobacteriaceae was among the top keystone taxa identified in Ixodes microbiota. Immunization of α-1,3-galactosyltransferase-deficient-C57BL/6 (α1,3GT KO) mice with a live vaccine containing the Enterobacteriaceae bacterium Escherichia coli strain BL21 revealed that the production of anti-E. coli and anti-α-Gal IgM and IgG was associated with high mortality of I. ricinus nymphs during feeding. However, this effect was absent in two different strains of wild type mice, BALB/c and C57BL/6. This result concurred with a wide distribution of α-1,3-galactosyltransferase genes, and possibly α-Gal, in Enterobacteriaceae and other bacteria of tick microbiota. Interestingly, the weight of I. ricinus nymphs that fed on E. coli-immunized C57BL/6 was significantly higher than the weight of ticks that fed on C57BL/6 immunized with a mock vaccine. Our results suggest that anti-tick microbiota vaccines are a promising tool for the experimental manipulation of vector microbiota, and potentially the control of ticks and tick-borne pathogens. |
Vaccines. 2020 Nov 21; 8(4):702. | |
| Mateos-Hernández L, Risco-Castillo V, Torres-Maravilla E, Bermúdez-Humarán LG, Alberdi P, Hodžić A, Hernández-Jarguin A, Rakotobe S, Galon C, Devillers E, de la Fuente J | 2020 | Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry. Naturally occurring human antibodies (Abs) of the isotypes IgM and IgG and reactive to the galactose-α-1,3-galactose (α-Gal) epitope are associated with protection against infectious diseases, caused by pathogens expressing the glycan. Gut microbiota bacteria expressing α-Gal regulate the immune response to this glycan in animals lacking endogenous α-Gal. Here, we asked whether the production of anti-α-Gal Abs in response to microbiota stimulation in birds, confers protection against infection by Aspergillus fumigatus, a major fungal pathogen that expresses α-Gal in its surface. We demonstrated that the oral administration of Escherichia coli O86:B7 strain, a bacterium with high α-Gal content, reduces the occurrence of granulomas in lungs and protects turkeys from developing acute aspergillosis. Surprisingly, the protective effect of E. coli O86:B7 was not associated with an increase in circulating anti-α-Gal IgY levels, but with a striking reduction of anti-α-Gal IgA in the lungs of infected turkeys. Subcutaneous immunization against α-Gal did not induce a significant reduction of lung anti-α-Gal IgA and failed to protect against an infectious challenge with A. fumigatus. Oral administration of E. coli O86:B7 was not associated with the upregulation of lung cytokines upon A. fumigatus infection. We concluded that the oral administration of bacteria expressing high levels of α-Gal decreases the levels of lung anti-α-Gal IgA, which are mediators of inflammation and lung damage during acute aspergillosis. |
Vaccines. 2020 Jun;8(2):285. | cross-protective immunity; microbiome; microbiota; aspergillosis |
| Mateos-Hernández L, Villar M, Moral A, García-Rodríguez C, Arias TA, de la Osa V, Brito FF, de Mera IG, Alberdi P, Ruiz-Fons F, Cabezas-Cruz A. | 2017 | Tick-host conflict: immunoglobulin E antibodies to tick proteins in patients with anaphylaxis to tick bite. Tick-borne infectious diseases and allergies are a growing problem worldwide. Tick bite allergy has been associated with the direct effect of immunoglobulin E (IgE) response to tick salivary antigens, or secondary to the induction of allergy to red meat consumption through IgE antibodies against the carbohydrate alpha-Gal (Gal alpha 1-3Gal beta 1-(3)4GlcNAc-R). However, despite the growing burden of this pathology, the proteins associated with anaphylaxis to tick bite have not been characterized. To address this question, a comparative proteomics approach was used to characterize tick proteins producing an IgE antibody response in a healthy individual with record of tick bites, which had not resulted in any allergic reactions, and two patients with anaphylactic reactions to Rhipicephalus bursa or Hyalomma marginatum tick bites. Both patients and the healthy individual were red meat tolerant. The results supported a patient-specific IgE antibody response to tick species responsible for the anaphylaxis to tick bite. Both patients and the healthy individual serologically recognized tick proteins with and without alpha-Gal modifications, with proteins differentially recognized by patients but not control sera. These proteins could be used as potential antigens for diagnostics, treatment and prevention of tick bite-induced allergies. |
Oncotarget. 2017 Mar 28;8(13):20630. | Mateos-Hernandez ; Garcia-Rodriguez; vector; tick; Rhipicephalus bursa; Hyalomma marginatum |
| Mathew J, Anooja KF, Ahammed N, Manohar V. | 2023 | Role of Methylene Blue in Refractory Anaphylaxis -A Case Report |
International Journal of Medical Science and Clinical Research Studies. 2023 Oct 16;3(10):2281-3. | India; Kerala; refractory anaphylaxis |
| Mathew S, Fadugba O. | 2022 | SYSTEMIC MASTOCYTOSIS WITH CONCURRENT ALPHA-GAL ASSOCIATED ANAPHYLAXIS. Discussion Our reports highlight the importance of considering food allergens, particularly alpha-gal, in locations with a high incidence of lone star tick bites, as possible triggers for recurrent anaphylaxis in patients with SM. Given the delayed presentation of alpha-gal reactions and the inherent propensity for patients with SM to experience anaphylaxis, this diagnosis can easily be overlooked. The case also suggests the possibility that underlying SM may be associated with more severe manifestations of alpha-gal reaction. |
Annals of Allergy, Asthma & Immunology. 2022 Nov 1;129(5):S87. | systemic mastocytosis |
| Mathews TJ, Altfillisch C, Patel M, Esswein A. | 2023 | S3944 Alpha Gal Syndrome-Induced Vasculitis. |
Official journal of the American College of Gastroenterology| ACG. 2023 Oct 1;118(10S):S2512-3. | vasculitis; dermatology |
| Mathisson DC, Kross SM, Palmer MI, Diuk-Wasser MA | 2021 | Effect of Vegetation on the Abundance of Tick Vectors in the Northeastern United States: A Review of the Literature. |
Journal of Medical Entomology. 2021 Jun 3. | Vectors; tick; tick ecology; lone star tick |
| Matrana D, Myers G, Smith E, Kamboj S. | 2019 | M310 DR. GOOGLE AND THE ALPHA GAL Introduction: Alpha Gal Syndrome (Tick Induced Meat Allergy) is a rare condition that develops weeks to months after a tick bite and leads to anaphylaxis after ingestion of mammalian meats. Case Description: 28-year-old female presents with concern for alpha gal syndrome. Three months after hiking in Northwest Georgia, where she was bitten by a tick, she reports that about four hours after ingestion of a pepperoni pizza, she experienced wheezing, shortness of breath, and hives all over her body. A few weeks later, after ingesting a cheeseburger, she developed similar symptoms. Coincidentally, she heard a podcast about meat allergies where the symptoms described matched hers. As her history and presentation were consistent with Alpha Gal Syndrome, a specific IgE level to Alpha-Gal was ordered and found to be elevated at 46.3 IU/mL. A diagnosis was confirmed, and she was instructed to avoid mammalian meats. Discussion: Approximately three months after a tick bite from the Lonestar Tick, there is an immunoglobulin class switch that is thought to occur in the skin that leads to the development of an IgE antibody to alpha-1,3-galactose, a carbohydrate found on mammalian meats. Since its discovery in 2006, awareness of this rare disease has significantly increased through news outlets and social media platforms. The podcast mentioned by our patient, featuring leading experts on this rare diagnosis, was factually accurate and was presented in a way that potential patients can comprehend. When produced correctly and factually accurate, social media can be a powerful tool to help raise awareness to rare diseases. |
Annals of Allergy, Asthma & Immunology. 2019 Nov 1;123(5):S127-8. | diagnosis; physican awareness; patient-driven diagnosis; radiolab; awareness |
| Matucci A, Vultaggio A, Nencini F, Maggi E. | 2020 | Anaphylactic reactions to biological drugs. Purpose of review: This review summarizes the current knowledge of the pathogenic mechanisms of biologics-induced anaphylaxis, and the diagnostic and prophylactic strategies in the management of potentially reactive patients, to improve the safety profile of biologics. Recent findings: The recent knowledge on the topic highlights the involvement of both effector and regulatory mechanisms in the immune response to biological agents. In addition, the impact of biological's immunogenicity on hypersensitivity reactions has been confirmed in a wider number of studies, defining some details about the kinetics of antidrug antibodies development, specifically immunoglobulin G (IgG) and immunoglobulin E (IgE). . Summary: Biological agents may induce anaphylaxis, mainly through the induction of antidrug antibodies. Biologics-related infusion reactions are often clinically consistent with type I hypersensitivity, but IgG antidrug antibodies may also be involved. The immune response toward biologicals is orchestrated by both effector and regulatory T cells. In addition, nonantibody-dependent mechanisms may occur. Among clinicians persists today again a low awareness, not only of the possibility to understand the immunological mechanisms behind anaphylaxis to biologicals but also the opportunity to apply potential strategies for the management of reactive patients aimed to guarantee a safe retreatment. |
Current Opinion in Allergy and Clinical Immunology. 2020 Aug 1;20(4):346-51. | biologics; monoclonal antibody; mAb |
| Maurer M, Church MK, Metz M, Starkhammar M, Hamsten C, van Hage M. | 2015 | Galactose-alpha-1,3-Galactose Allergy Is Not a Hitherto Unrecognized Cause of Chronic Spontaneous Urticaria. |
International archives of allergy and immunology. 2015;167(4):250-2. | chronic spontaneous urticaria; CSU; chronic urticaria |
| Mawhirt SL, Banta E. | 2019 | Successful intravenous heparin administration during coronary revascularization surgery in a patient with alpha-gal anaphylaxis history. Allergy to galactose-alpha-1,3-galactose (alpha-gal) presents as an immunoglobulin E (IgE)-mediated, yet delayed-onset hypersensitivity reaction to non-primate mammalian meat. Alpha-gal sensitization develops after tick bite exposure. The lone-star tick ( Amblyomma americanum) represents the North American vector, spanning a relatively vast southeast, midwest, and northeast geographic distribution. Allergic manifestations include urticaria/angioedema, abdominal pain/diarrhea, or anaphylaxis, occurring approximately 3 to 6 hours after ingestion. Alpha-gal hypersensitivity is not limited to food-related consumption. Other potential alpha-gal exposures include bioprosthetic heart valves and vaccines or medications (porcine/bovine origin or gelatin-containing), such as heparin. |
Annals of Allergy, Asthma & Immunology. 2019 Oct 1;123(4):399-401. | |
| Mazzoleni A, Mallet JM, Rovero P, Papini AM. | 2019 | Glycoreplica peptides to investigate molecular mechanisms of immune-mediated physiological versus pathological conditions. Investigation of the role of saccharides and glycoconjugates in mechanisms of immune-mediated physiological and pathological conditions is a hot topic. In fact, in many autoimmune diseases cross-reactivity between sugar moieties exposed on exogenous pathogens and self-molecules has long been hinted. Several peptides have been reported as mimetics of glycans specifically interacting with sugar-binding antibodies. The seek for these glycoreplica peptides is instrumental in characterizing antigen mimicry pathways and their involvement in triggering autoimmunity. Therefore, peptides mimicking glycan-protein interactions are valuable molecular tools to overcome the difficulties of oligosaccharide preparations. The clinical impact of peptide-based probes for autoimmune diseases diagnosis and follow-up is emerging only recently as just the tip of the iceberg of an overlooked potential. Here we provide a brief overview of the relevance of the structural and functional aspects of peptide probes and their mimicry effect in autoimmunity mechanisms for promising applications in diagnostics and therapeutics. |
Archives of biochemistry and biophysics. 2019 Mar 15;663:44-53. | peptide mimetic |
| McCladdie T, Herman M. | 2025 | Alpha-Gal Syndrome: An Emerging Tick-Borne Allergy to Red Meat. |
Cureus. 2025 Feb 27;17(2). | GI phenotype; GI variant; gastroenterology |
| McCladdie T, Herman M. | 2025 | Alpha-gal syndrome: An emerging tick-borne allergy to red meat. |
Cureus. Published online February 27, 2025. doi:10.7759/cureus.79746 | |
| McGill SK, Commins SP, Peery AF, Galanko J, Keku TO, Shaheen NJ, Anderson C, Sandler RS. | 2023 | Alpha-gal Sensitization in a US Screening Population is Not Associated with Decreased Meat Intake or Gastrointestinal Symptoms. Background and aims: Patients with alpha-gal syndrome, a delayed reaction to mammalian meat, can present with isolated gastrointestinal (GI) symptoms. We aimed to estimate the frequency of alpha-gal sensitization in a Southeastern US population and to determine the association between sensitization and mammalian product dietary intake and GI symptoms. Methods: We performed a cross-sectional study of participants who underwent a screening colonoscopy at our center between 2013-2015. We quantified serum alpha-gal IgE antibodies in patients who prospectively enrolled at screening colonoscopy and compared diet intake and lower GI symptoms reported in standardized questionnaires among patients with elevated alpha-gal IgE antibodies and those not sensitized to alpha-gal. Results: Alpha-gal IgE antibodies were common-31.4% of screening colonoscopy patients (127/404) had elevated serum alpha-gal IgE >0.1 kU/L. Alpha-gal sensitized participants endorsed similar rates of abdominal pain compared to those without alpha-gal antibodies (33% vs. 38%, adjusted odds ratio 0.9, 95% CI 0.7-1.3). Mammalian meat consumption did not differ based on alpha-gal sensitization status (average 1.43 servings/day in sensitized patients vs. 1.50 in alpha-gal IgE negative, p=0.9). Alpha-gal sensitized individuals with levels ≥10 (n=21) were overrepresented in the lowest quartiles of mammalian meat consumption, but not among people with GI symptoms in general. People with high alpha-gal antibody levels >2 kU/L (n=45) or ≥10U/L (n=21) did not have reduced mean daily mammalian meat intake compared to seronegative people. Conclusion: Elevated alpha-gal IgE antibodies were common and not associated with reduced mammalian meat intake, abdominal pain or diarrhea. Seropositivity did not predict symptomatic alpha-gal sensitization in this general screening population. Other host factors likely contribute to phenotypic expression of alpha-gal syndrome. |
Official journal of the American College of Gastroenterology| ACG. 2022 May 12:10-4309. | prevalence; testing; sensitization; IgE; asymptomatic |
| McGill SK, Hashash JG, Platts-Mills TA. | 2023 | **AGA Clinical Practice Update on Alpha-Gal Syndrome for the GI Clinician: Commentary. Description: Alpha-gal syndrome is an emerging allergy first described in the early 2000s. The allergy can cause anaphylaxis, gastrointestinal (GI) symptoms, and skin changes one to several hours after ingestion of mammalian products. A GI phenotype that is increasingly recognized manifests with nonspecific symptoms like abdominal pain, diarrhea, nausea or vomiting without predominant skin, respiratory or circulatory symptoms. Though the syndrome has been reported on all continents except Antarctica, in the United States most reports are within the range of the Lone Star tick, extending from New York and Iowa to Texas and Florida. The purpose of this AGA Clinical Practice Update (CPU) Commentary is to increase awareness among gastroenterologists about the presentation and management of alpha-gal syndrome. Methods: This CPU commentary was commissioned and approved by the AGA Institute Clinical Practice Updates Committee (CPUC) and the AGA Governing Board to provide timely guidance on a topic of high clinical importance to the AGA membership and underwent internal peer review by the CPUC and external peer review through standard procedures of Clinical Gastroenterology and Hepatology. This expert commentary incorporates important as well as recently published studies in this field, and it reflects the experiences of the authors. Formal ratings regarding the quality of evidence or strength of the presented considerations were not included since systematic reviews were not performed. |
Clinical Gastroenterology and Hepatology. | gastroenterology; GI -only phenotype; GI variant; atypical; diarrhea; abdominal pain; vomiting; no rash; no urticaria; |
| McGill SK, Levin ME, Shaheen NJ, Cotton CC, Platts-Mills TA, Commins SP. | 2022 | Gastrointestinal-isolated Distress is Common in Alpha-gal Allergic Patients on Mammalian Meat Challenge. Background and Aims: Alpha-gal allergy causes a delayed reaction to mammalian meats and has been reported worldwide. Patients with the allergy may present with isolated gastrointestinal (GI) symptoms, but this phenotype is poorly understood. Methods: We pooled and analyzed symptoms and demographics of patients from two prospective cohorts of patients with a diagnosis of alpha-gal allergy who reacted after eating mammalian meat under observation. We compared the characteristics of patients who demonstrated GI-isolated symptoms on a challenge with those who exhibited symptoms outside the GI tract (skin, respiratory, and circulatory). . Results: Among the 91 children and adult alpha-gal allergic patients who exhibited symptoms after oral challenge with mammalian meat, 72.5% experienced GI distress with one or more GI symptoms, which was the most frequent class of symptoms, compared with skin changes in 57.1% and respiratory distress in 5.5%. The most common GI symptoms were abdominal pain (71%) and vomiting (22.0%). GI-isolated symptoms occurred in 37 patients (40.7%) who reacted, and those patients reacted more quickly than patients who exhibited systemic symptoms (median onset of symptoms in GI-isolated group 90 min vs 120 min) and were more likely to be children than adults (relative risk=1.94, 95% CI: 1.04-3.63). . Conclusions: Isolated-GI distress occurred in 4 in every 10 alpha-gal allergic individuals who developed symptoms on oral food challenge with mammalian meat. Alpha-gal allergic patients, particularly children, may exhibit GI distress alone, and adult and pediatric gastroenterologists should be aware of the diagnosis and management of the allergy. |
Journal of Clinical Gastroenterology. 2022:10-97. | gastroenterology; GI; abdominal pain; IBS; diarrhea; GI variant; GI only; GI phenotype |
| McGill SK, Richards Jr RD, Commins SP. | 2022 | Suddenly Steakless: A Gastroenterologist’s Guide to Managing Alpha-gal Allergy. Alpha-gal allergy is an emerging clinical syndrome, first described in the 2000s, that can cause gastrointestinal (GI) distress, hives, angioedema and anaphylaxis hours after ingestion of pork, beef and other mammalian meat or -derived products. Various publications in the allergy, GI and general medicine literature have described patients with the allergy who present with GI-isolated symptoms without typical allergic symptoms like angioedema or hives.2-8 Here we aim to inform gastroenterologists on how to diagnose and manage alpha-gal allergy. |
Official journal of the American College of Gastroenterology| ACG. 2022 Apr 8:10-4309. | gastroenterology; GI; abdominal pain; IBS; diarrhea |
| McGregor C, Byrne G, Rahmani B, Chisari E, Kyriakopoulou K, Burriesci G. | 2016 | Physical equivalency of wild type and galactose α 1,3 galactose free porcine pericardium; a new source material for bioprosthetic heart valves. Humans make high levels of antibody to carbohydrates with terminal galactose α 1,3 galactose (Gal) modifications. This Gal antigen is widely expressed in other mammals and is present on an array of current animal derived biomedical devices including bioprosthetic heart valves. There is growing interest in using Gal-free animal tissues from Gal knockout pigs (GTKO) as these tissues would not be affected by anti-Gal antibody mediated injury. In this study we compare the composition and biophysical characteristics of glutaraldehyde fixed porcine pericardium from standard and GTKO pigs. We show that with the exception of the Gal antigen which is only present in standard pig tissue both GTKO and standard pig tissue have the same general morphology and collagen content. Moreover uniaxial stress testing and suture retention testing indicate the tissues are equivalent in tensile strength. These studies indicate that genetic disruption of the α-galactosyltransferase (GGTA-1) which blocks synthesis of the Gal antigen has no significant impact on the structural integrity of porcine pericardium and suggest that this tissue could be directly substituted for standard pig pericardium in biomedical devices such as bioprosthetic heart valves. |
Acta biomaterialia. 2016 Sep 1;41:204-9. | bioprosthetic heart valve; cardiac; cardiopulmonary surgery |
| McHugh DJ. | 2003 | A guide to the seaweed industry. | A guide to the seaweed industry. | carrageenan |
| McInnis A, Root K, Rizer C, Bradley D. | 2021 | Diagnosing a Crisis: The Conundrum of Alpha-Gal. The often-encountered allergic reaction of unknown etiology can be a perplexing diagnostic conundrum in any clinical environment. Alpha-gal syndrome is an allergic reaction to mammalian meat consumption that occurs after the bite of certain hard ticks, mites, or chiggers. This potentially lethal allergic reaction is the result of an immunoglobulin E antibody response to a certain carbohydrate found in almost all mammalian meats and meat products. Epidemiologically, alpha-gal has been observed worldwide, but in the United States the prevalence is higher in the southeastern states because of the common hard tick vector known as the lone star tick. Providers should be aware of the recent scientific information available to assist clinicians at the point of care with diagnosis and treatment. |
The Journal for Nurse Practitioners. 2021 Jun 16. | Nursing |
| McRae AS, Tidwell WP, Patel S, Lombard FW | 2022 | Heparin desensitisation prior to cardiopulmonary bypass in a patient with alpha‐gal allergy. This case report describes the implementation of a heparin desensitisation strategy for a patient with confirmed galactose-alpha-1,3-galactose (alpha-gal) allergy, prior to cardiac surgery. We describe the pre-, intra- and postoperative management. We believe this report can enhance the limited data currently in existence on alternative strategies for heparin utilisation in cardiopulmonary bypass in a previously intolerant patient population. |
Anaesthesia Reports. 2022 Jul;10(2):e12203. | Perioperative; surgery; medical products; cardiac; cardio; cardiopulmonary; heparin |
| Mehlich J, Fischer J, Hilger C, Swiontek K, Morisset M, Codreanu-Morel F, Schiener M, Blank S, Ollert M, Darsow U, Biedermann T. | 2019 | ‡ The basophil activation test differentiates between patients with alpha-gal syndrome and asymptomatic alpha-gal sensitization. Background: Galactose-alpha-1,3-galactose (alpha-gal) syndrome is characterized by the presence of serum specific IgE antibodies to alpha-gal and delayed type I allergic reactions to the carbohydrate alpha-gal after consumption of mammalian (red) meat products and drugs of mammalian origin. Diagnostics currently rely on patient history, skin tests, determination of serum specific IgE antibodies, and oral food or drug challenges. Objective: We sought to assess the utility of different basophil parameters (basophil reactivity and sensitivity, the ratio of the percentage of CD63+ basophils induced by the alpha-gal–containing allergen to the percentage of CD63+ basophils after stimulation with anti-FcεRI antibody [%CD63+/anti-FcεRI], and area under the dose-response curve [AUC]) as biomarkers for the clinical outcome of patients with alpha-gal syndrome compared with subjects with asymptomatic alpha-gal sensitization. Methods: In addition to routine diagnostics, a basophil activation test (Flow CAST) with different concentrations of alpha-gal–containing allergens (eg, commercially available alpha-gal–carrying proteins and pork kidney extracts) was performed in 21 patients with alpha-gal syndrome, 12 alpha-gal–sensitized subjects, and 18 control subjects. Results: Alpha-gal–containing allergens induced strong basophil activation in a dose-dependent manner in patients. Basophil reactivity at distinct allergen concentrations, the %CD63+/anti-FcεRI ratio across most allergen concentrations, the AUC of dose-response curves, and basophil allergen threshold sensitivity (CD-sens) with pork kidney extract were significantly higher in patients with alpha-gal syndrome compared with those in sensitized subjects. All parameters were negative in control subjects. Conclusion: The basophil activation test should be considered as an additional diagnostic test before performing time-consuming and potentially risky oral provocation tests. The %CD63+/anti-FcεRI ratio for all allergens and AUCs for pork kidney were the best parameters for distinguishing patients with alpha-gal syndrome from subjects with asymptomatic alpha-gal sensitization. |
Journal of Allergy and Clinical Immunology. 2019 Jan 1;143(1):182-9. | diagnosis; testing; basophil activation test; CD63; CCR3 |
| Mehlich J. | 2021 | Basophilenaktivierungstest zur Differenzierung von Patienten mit Alpha-Gal-Syndrom und asymptomatischen Patienten mit Sensibilisierung auf alpha-Gal |
(Doctoral dissertation, Technische Universität München). | testing; basophil activation test |
| Melani NB, Tambourgi EB, Silveira E. | 2020 | Lipases: From production to applications. |
Separation & Purification Reviews. 2020 Apr 2;49(2):143-58. | mammalian byproduct; porcine; lipase |
| Melchiors BL, Garvey LH. | 2020 | Investigation of perioperative hypersensitivity reactions: an update. Purpose of review: The purpose of this review is to provide an update on how best to manage the investigation of suspected perioperative hypersensitivity reactions based on recent literature and key publications. Recent findings: In the past two years, several very important initiatives have been taken in the field of perioperative hypersensitivity. The 6th national audit project in the United Kingdom has provided new knowledge through a series of studies, including a nationwide prospective study, and the European Academy of Allergy and Clinical Immunology has commissioned a position paper with updated recommendations for investigations. Lastly, a large international working group comprising experts in anesthesiology, allergology, and immunology, the International Suspected Perioperative Allergic Reactions group, has published a series of articles providing updates and new insights into several different key areas of perioperative hypersensitivity. . Summary: The investigation of perioperative hypersensitivity reactions is highly complex and aims to identify the correct culprit to ensure future avoidance but also to disprove allergy to other suspected culprits, making them available for subsequent anesthesia. To achieve this, close collaboration between anesthesiologists and allergists is called upon to ensure the best possible outcome for the patient. |
Current Opinion in Allergy and Clinical Immunology. 2020 Aug 1;20(4):338-45. | |
| Mendes AA, Oliveira PC, de Castro HF. | 2012 | Properties and biotechnological applications of porcine pancreatic lipase. |
Journal of Molecular Catalysis B: Enzymatic. 2012 Jun 1;78:119-34. | mammalian byproduct; porcine; lipase |
| Mendoza J. | 2020 | Repeat Anaphylaxis to the MMR Vaccine Mediated by IgE Sensitivity to Gelatin. It is estimated that a severe allergic reaction to any vaccine occurs at a rate of 1 per 1.3 per million doses of vaccines given. MMR is typically a well tolerated vaccination with rare reports of severe allergic reactions. Reactions to the MMR vaccine are often caused by additive or residual vaccine components. In addition to MMR viral antigens, the vaccine also contains egg protein, neomycin, sorbitol, and gelatin. MMR vaccination is mandatory for new recruits in the military. We report a case of anaphylaxis following MMR vaccination. Laboratory and skin testing suggest that anaphylaxis was due to an IgE mediated antibody reaction to the gelatin component of the vaccine. |
59MDW San Antonio United States; 2020 Jan 30. | vaccination; vaccine; MMR; gelatin; gelatine |
| Menzies SK, Thomas AO, Tianyi FL, Abubakar SB, Nasidi A, Durfa N, Patel R, Trelfa A, Lalloo DG, Habib AG, Harrison RA. | 2021 | Livestock herding and Fulani ethnicity are a combined risk factor for development of early adverse reactions to antivenom treatment: Findings from a cross-sectional study in Nigeria. Background: Adverse reactions to antivenom considerably complicate the clinical management of snakebite envenomed patients because it necessitates a temporary suspension of life-saving antivenom, increases costs and can compromise patient outcomes. This study sought to explore the association between cattle-herding occupation and ethnic group and the occurrence of early adverse reactions to antivenom. Methods: This cross-sectional study was conducted between the 25th April and 11th July 2011 at the Kaltungo General Hospital in north east Nigeria. The exposure variable of cattle-herding occupation showed a strong correlation with the ethnic group variable, thus these were combined into a new variable with three categories (Fulani and herder, either Fulani or herder, and neither Fulani nor herder). The outcome variable was the occurrence of early adverse reactions, defined as any new symptoms occurring within 6 hours of antivenom administration. Odds Ratios were estimated using multivariable logistic regression models controlling for potential confounders. Results: Among 231 envenomed snakebite victims, the overall incidence of early adverse reactions was 11.9% (95% confidence intervals: 8.0–16.9%). Patients who were Fulani and herders had a higher incidence of early adverse reactions compared to patients who were neither Fulani nor herder (20% vs 5.7%). After adjusting for age and gender, victims who were Fulani and herders were 5.9 times more likely to have an early adverse reaction, compared to victims who were neither Fulani nor herders (95% CI: 1.88–18.59; p = 0.002). Interpretation: To the best of our knowledge, this is the first study to provide evidence of higher odds of early adverse reactions among patients from a particular occupation and/or ethnic group. We recommend that snake envenomed patients of Fulani origin be especially closely monitored for adverse reactions, that hospitals receiving these patients be appropriately resourced to manage both envenoming and adverse reactions and that premedication with adrenaline should be considered. Our findings provide an argument for speculation on the influence of immunological or lifestyle-related differences on the occurrence of early adverse reactions to antivenom. |
PLOS Neglected Tropical Diseases. 2021 Aug 12;15(8):e0009518. | Africa; medical products; antivenom |
| Merritt T, Platt J. | 2023 | Observed Relationships Between Time and Severity of Allergic Reactions to Galactose-alpha-1, 3-galactose and Underlying Diagnosed Medical Conditions. ABSTRACT |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB96. | Facebook survey |
| Merritt TK, Bermingham MD, Agah S, Meredith RT, Smith BR, Chapman MD. | 2025 | Diagnostic cat and dog allergenic products contain alpha-gal. |
The Journal of Allergy and Clinical Immunology: In Practice. 2025 Mar 18. | cat; dog; pets |
| Mesonzhnik N, Belushenko A, Novikova P, Kukharenko A, Afonin M. | 2024 | Enhanced N-Glycan Profiling of Therapeutic Monoclonal Antibodies through the Application of Upper-Hinge Middle-Up Level LC-HRMS Analysis. |
Antibodies. 2024 Aug 6;13(3):66. | biologics; monoclonal antibodies; CHO; Chinese Hamster ovary; variable glycosylation; golimumab; Simponi |
| Michel S, Scherer K, Heijnen IA, Bircher AJ. | 2014 | Skin prick test and basophil reactivity to cetuximab in patients with IgE to alpha-gal and allergy to red meat. Severe hypersensitivity reactions to red meat with delay of several hours in patients with IgE to alpha-gal (galactose-alpha-1,3-galactose) have been reported. The diagnosis of meat allergy is difficult, because of the limited sensitivity of skin prick tests and specific IgE tests to meat extracts. These circumstances have been explained by the delayed expression of alpha-gal due to digestive processes. Because of the low sensitivity of skin prick tests to meat, we studied the possibility to perform skin prick tests with cetuximab, which carries the alpha-gal epitope. Skin prick and intradermal tests with cetuximab were clearly positive in 2 of 2 patients. As a further diagnostic step, we performed basophil activation tests with cetuximab. Skin prick tests and basophil activation test using cetuximab may be a more sensitive alternative in patients with an assumed allergy to meat. |
Allergy. 2014 Mar;69(3):403-5. | |
| Miller CK, Mendoza JC, Coop CA. | 2020 | Anaphylaxis to MMR Vaccine Mediated by IgE Sensitivity to Gelatin. The measles-mumps-rubella (MMR) vaccine is generally well tolerated, and reports of anaphylaxis to the vaccine are rare. IgE-mediated reactions to vaccines are often caused by additives or residual vaccine components. An inability to obtain proper immunizations can be a disqualifying component to military service. We report a case of anaphylaxis to the MMR vaccine in a new military recruit sensitized to gelatin IgE. |
Military Medicine. 2020 May 12. | pharmacy; pharmaceutical;vaccine; MMR |
| Miller MJ, Lee P, Lee BG, Flegel WA, West‐Mitchell K, Conry‐Cantilena K, De Giorgi V. | 2024 | Consideration for alpha‐gal syndrome in two critically ill persons with group O blood who received group B plasma. |
Transfusion. 2024 Apr 3. | Transfusion; blood type |
| Mirakhur B, Chung C, Hatley T, Satinover S, Hosen J, Zhou Q, Gold D, Mauro D, Platts-Mills TA. | 2008 | Anaphylactic reactions to cetuximab in patients with IgE antibodies to the xenoantigen galactose-alpha-1,3-galactose. Cetuximab is a chimeric (mouse/human) IgG1 monoclonal antibody against the epidermal growth factor receptor and is approved for use in patients with colorectal cancer and head and neck squamous cell carcinoma. A high prevalence of hypersensitivity reactions (HSR) related to cetuximab has been reported from some areas of the United States; however, the mechanism underlying these reactions is unknown. |
Journal of Allergy and Clinical Immunology. 2008 Feb 1;121(2):S67. | |
| Mitchell CL, Lin FC, Vaughn M, Apperson CS, Meshnick SR, Commins SP. | 2020 | Association between lone star tick bites and increased alpha-gal sensitization: evidence from a prospective cohort of outdoor workers. Background: Alpha-gal is an oligosaccharide implicated in delayed anaphylaxis following red meat consumption. Exposure to tick bites has been correlated with development of an allergic response to alpha-gal. However, evidence prospectively linking exposure to a single tick species and an immune response to alpha-gal is lacking. Methods: We used serum samples from a prior study cohort of outdoor workers in North Carolina, USA, with high exposure to the lone star tick, Amblyomma americanum, to prospectively evaluate the relationship between tick bites and anti-alpha-gal IgE antibodies. Results: Individuals who reported exposure to one or more tick bites were significantly more likely to have a positive change in anti-alpha-gal IgE compared to individuals with no reported tick bites. This relationship was not dependent on time. A trend toward increasing number of tick bites and increased anti-alpha-gal IgE levels was observed but not statistically significant. Conclusion: To our knowledge, this is the first study to prospectively link documented exposure to A. americanum bites and increased sensitization to alpha-gal in a cohort of outdoor workers. Our results support the role of A. americanum as likely agents for eliciting an allergic response to red meat, and highlight the importance of preventing tick bites. |
Parasites & Vectors. 2020 Dec;13(1):1-4. | Prevalence |
| Mittermann I, Dzoro S, Gattinger P, Botha M, Basera W, Facey‐Thomas HE, Gaunt B, Genuneit J, Gray CL, Hlela C, Flicker S | 2020 | Molecular IgE‐sensitisation profiles of urban and rural children in South Africa. Background: Allergens can act as disease‐triggering factors in atopic dermatitis (AD) patients. The aim of the study was to elucidate the molecular IgE sensitization profile in children with and without AD living in urban and rural areas of South Africa. Methods: Specific IgE reactivity was assessed in 166 Black South African children aged 9‐38 months using a comprehensive panel of microarrayed allergens. According to clinical characterization children fell in four groups, urban AD cases (n = 32), urban controls (non‐AD, n = 40), rural cases (n = 49) and rural controls (non‐AD, n = 45). Results: IgE reactivity to at least one of the allergens was detected in 94% of urban and 86% of rural AD children. House dust mite (HDM; 81% urban, 74% rural AD) and animal‐derived allergens (50% urban, 31% rural AD) were the most frequently recognized respiratory allergens, whereas IgE to pollen allergens was almost absent. Urban AD children showed significantly higher frequency of IgE reactivity (50%) to mouse lipocalin, Mus m 1, than rural AD children (12%). The most frequently recognized food allergens were from egg (63% urban, 43% rural AD), peanut (31% vs 41%), and soybean (22% vs 27%), whereas milk sensitization was rare. α‐gal‐specific IgE almost exclusively occurred in rural children (AD: 14%, non‐AD: 49%). Conclusion: Molecular allergy diagnosis detects frequent IgE sensitization to HDM, animal but not pollen allergens and to egg, peanut, and soy, but not milk allergens in African AD children. Urban AD children reacted more often to Mus m 1, whereas α‐gal sensitization is more common in rural children likely due to parasite exposure. |
Pediatric Allergy and Immunology. 2020 Sep 24. | Africa; South Africa; prevalence; epidemiology; rural populations |
| Molaei G, Little EA, Williams SC, Stafford KC. | 2019 | Bracing for the worst—Range expansion of the lone star tick in the northeastern United States. ...Abundant reproductive hosts, an increasingly hospitable climate, and genetic plasticity of the lone star tick support the continued invasion and establishment of this tick in the Northeast. Increasing population densities and subsequent range expansion, in conjunction with nondiscriminating biting habits and the capacity to transmit diverse pathogens, position the lone star tick as an important emerging health threat to humans, domesticated animals, and wildlife. It’s also plausible that the lone star tick will displace local tick species, transmit different pathogens than those species, and alter the tickborne disease landscape. We believe it’s essential for practitioners and the public to develop a heightened awareness of the health risks associated with emergent tick vectors such as the lone star tick and their potential for changing the dynamics of tickborne diseases in the northeastern United States and elsewhere. |
New England Journal of Medicine. 2019 Dec 5;381(23):2189-92. | lone star tick; vector ecology |
| Mollah F, Zacharek MA, Benjamin MR. | 2024 | What Is Alpha-Gal Syndrome?. |
JAMA. 2023 Dec 8. | Review |
| Montassier E, Al-Ghalith GA, Mathé C, Le Bastard Q, Douillard V, Garnier A, Guimon R, Raimondeau B, Touchefeu Y, Duchalais E, Vince N. | 2020 | Distribution of Bacterial α-1,3-Galactosyltransferase Genes in the Human Gut Microbiome. Because of a loss-of-function mutation in the GGTA1 gene, humans are unable to synthetize α1,3-Galactose (Gal) decorated glycans and develop high levels of circulating anti-α1,3-Galactose antibodies (anti-Gal Abs). Anti-Gal Abs have been identified as a major obstacle of organ xenotransplantation and play a role in several host-pathogen relationships including potential susceptibility to infection. Anti-Gal Abs are supposed to stem from immunization against the gut microbiota, an assumption derived from the observation that some pathogens display α1,3-Gal and that antibiotic treatment decreases the level of anti-Gal. However, there is little information to date concerning the microorganisms producing α1,3-Gal in the human gut microbiome. Here, available α1,3-Galactosyltransferase (GT) gene sequences from gut bacteria were selectively quantified for the first time in the gut microbiome shotgun sequences of 163 adult individuals from three published population-based metagenomics analyses. We showed that most of the gut microbiome of adult individuals contained a small set of bacteria bearing α1,3-GT genes. These bacteria belong mainly to the Enterobacteriaceae family, including Escherichia coli, but also to Pasteurellaceae genera, Haemophilus influenza and Lactobacillus species. α1,3-Gal antigens and α1,3-GT activity were detected in healthy stools of individuals exhibiting α1,3-GT bacterial gene sequences in their shotgun data. |
Frontiers in Immunology. 2020 Jan 13;10:3000. | gut biome; gastroenterology; intestine; GI |
| Montiel VR, Gamella M, Blázquez-García M, Serafín V, Molina E, Pingarrón JM, Benedé S, Campuzano S. | 2024 | Electrochemical bioplatform to manage alpha-gal syndrome by tracking the carbohydrate allergen in meat. |
Talanta. 2024 Feb 29:125851. | Testing; meat test |
| Monzón JD, Atkinson EG, Henn BM, Benach JL. | 2016 | Population and Evolutionary Genomics of Amblyomma americanum, and Expanding Arthropod Disease Vector. The lone star tick, Amblyomma americanum, is an important disease vector and the most frequent tick found attached to humans in the eastern United States. The lone star tick has recently experienced a rapid range expansion into the Northeast and Midwest, but despite this emerging infectious threat to wildlife, livestock, and human health, little is known about the genetic causes and consequences of the geographic expansion. In the first population genomic analysis of any tick species, we characterize the genetic diversity and population structure of A. americanum across its current geographic range, which has recently expanded. Using a high-throughput genotyping-by-sequencing approach, we discovered more than 8,000 single nucleotide polymorphisms in 90 ticks from five locations. Surprisingly, newly established populations in New York (NY) and Oklahoma (OK) are as diverse as historic range populations in North and South Carolina. However, substantial population structure occurs among regions, such that new populations in NY and OK are genetically distinct from historic range populations and from one another. Ticks from a laboratory colony are genetically distinct from wild populations, underscoring the need to account for natural variation when conducting transmission or immunological studies, many of which utilize laboratory-reared ticks. An FST-outlier analysis comparing a recently established population to a long-standing population detected numerous outlier sites, compatible with positive and balancing selection, highlighting the potential for adaptation during the range expansion. This study provides a framework for applying high-throughput DNA sequencing technologies for future investigations of ticks, which are common vectors of diseases. |
Genome biology and evolution. 2016 May 1;8(5):1351-60. | Monzon JD; vector; lone star tick |
| Morisset M, Jacquenet S, Croizier A, Astier C, Beaudouin E, Codreanu-Morel F, Cordebar V, Kanny G, Moneret-Vautrin D. | 2010 | Anaphylaxis to beef or pork kidney due to IgE antibodies specific for galactose-alpha-1,3-galactose. No abstract available |
Allergy: European Journal of Allergy and Clinical Immunology. 2010 Jun;65:587-8. | |
| Morisset M, Richard C, Astier C, Jacquenet S, Croizier A, Beaudouin E, Cordebar V, Morel‐Codreanu F, Petit N, Moneret‐Vautrin DA, Kanny G. | 2012 | Anaphylaxis to pork kidney due to IgE antibodies specific for galactose-alpha-1,3-galactose. Background: Carbohydrate‐specific IgE antibodies present on non-primate mammalian proteins were incriminated recently in delayed meat anaphylaxis. The aim of this study was to explore whether anaphylaxis to mammalian kidney is also associated with galactose‐α‐1,3‐galactose (α-Gal)‐specific IgE. Methods: Fourteen patients with anaphylaxis to pork or beef kidney underwent prick tests to meat and kidney. Some patients also underwent skin tests to Erbitux® (cetuximab). IgE antibodies to α-Gal, swine urine proteins, beef and pork meat, serum albumin proteins, cat, and rFel d 1 were measured by ImmunoCAP ®. The α-Gal levels were estimated in meats and kidney by ELISA inhibition assay. Cross‐reactivity between αG al and pork kidney was studied with the ImmunoCAP ® inhibition assay. Results: Among the 14 patients, 12 presented with anaphylactic shock. Reactions occurred within 2 h from exposure in 67% of patients. Associated risk factors were observed in 10 cases, and alcohol was the main cofactor. Three patients underwent an oral challenge to pork kidney, and anaphylaxis occurred after ingestion of small quantities (1–2 g). Prick tests to kidney were positive in 54% of patients. All tested patients showed positive skin tests to Erbitux®. All patients tested positive for IgE to αG al, with levels ranging from 0.4 to 294 kU/l. IgE binding to α-Gal was inhibited by raw pork kidney extract (mean, 77%; range, 55–87%), which showed a high amount of α-Gal determinants. Conclusions: Pork or beef kidney anaphylaxis is related to α-Gal IgE. Its peculiar severity could be due to an elevated content of α-Gal epitopes in kidney. |
Allergy 2012; 67: 699–704. | |
| Mosedale DE, Chauhan A, Schofield PM, Grainger DJ. | 2006 | A pattern of anti-carbohydrate antibody responses present in patients with advanced atherosclerosis. We have previously shown that an antibody pool present in normal human serum binds cytokine receptors in vitro and may therefore interfere with assays that capture cytokines using their receptors. Here we show that this antibody pool is the same as the natural antibody termed anti-gal, that binds to the α-galactosyl carbohydrate epitope (α-gal) and which is the predominant obstacle to xenotransplantation. We report that there are high levels of IgD anti α-gal in most volunteers, in addition to the IgG2, IgA and IgM immunoglobulin isotypes against α-gal previously described. To determine if anti-gal may interfere with assays that depend on capture of cytokine with its receptor, we measured levels of several anti-carbohydrate antibodies in a cohort of patients with advanced atherosclerosis that had previously been used to measure levels of active TGF-β using such an assay. For many isotype / carbohydrate combinations, there is a large and significant difference between the levels of anti-carbohydrate antibodies in patients with atherosclerosis and controls, after adjustment for age, sex and blood group. These results are similar to the previous data obtained for active TGF-β, and therefore we cannot discount the possibility that anti-gal contributed to the previous data. Following further adjustment for several risk factors associated with cardiovascular disease, several anti-carbohydrate antibodies were still significantly different between patients and controls. Therefore, anti-carbohydrate antibodies may represent a new class of risk factors that may be associated with presence of advanced atherosclerosis, although larger studies will be required to confirm this hypothesis. |
Journal of immunological methods. 2006 Feb 20;309(1-2):182-91. | cardiology; cardiac; carbohydrate allergy; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Mozzicato S, James H, Land MH, Pochan S, Workman LJ, Platts-Mills T, Commins SP. | 2013 | Appearance of CD63+ Basophils After Food Challenge Occurs in Both Alpha-Gal Positive Subjects and Controls. RATIONALE: Flow cytometry has been used to monitor basophilactivation after allergen challenge by detecting surface expression ofCD63 and CD203c. The purpose of this study was to 1) assess whether the presence of IgE to alpha-gal was necessary for in vivo activation of basophils and, 2) whether activation required ingestion of mammalian meat. METHODS: Informed consent was obtained from subjects with IgE toalpha-gal (n510) who reported delayed urticarial reactions, and fromcontrols (n59). After obtaining baseline blood work, beef or chicken (100 grams) was consumed by subjects and controls. Peripheral blood was assessed for in vivo CD63 and CD203c expression. RESULTS: In alpha-gal positive subjects, symptoms appeared 4-5 hourspost-beef consumption; however, no symptoms appeared in controls orfollowing challenge with non-mammalian meat. CD63 expression increased 4-6 hours after consumption of meat in 8/10 subjects with IgE to alpha-gal (20.3% above baseline, range 2.2%-60.2%). Expression ofCD203c was not increased. In 6/9 controls, CD63 expression increased5-6 hours after beef ingestion without symptoms (47.3% above baseline,range 8.3%-76.3%). Consumption of chicken did not cause symptoms inany subjects but CD63 expression increased in 3 of 4 challenges at 4-6hours (28%, range 5.7-42.4%). CONCLUSIONS: The clinical delay in alpha-gal positive subjectscorrelated with in vivo basophil activation. Meat challenge caused a similar pattern of activation without symptoms in controls. While these results support the utility of CD63 as a marker in patients with IgE-mediated food allergy, the data suggest that there may be alternate pathways for activation of CD63 |
Journal of Allergy and Clinical Immunology. 2013 Feb 1;131(2):AB217. | |
| Mozzicato S, James HR, Land MH, Pochan SL, Workman LJ, Platts-Mills TA, Commins SP. | 2012 | Delayed Food Challenge Reactions Correspond Temporally to the Appearance of CD63+Basophils in Subjects with IgE to alpha-Gal. Allergen-stimulated basophil activation can be assessed using the activation markers CD63 and CD203c. Patients who develop IgE to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) report reactions that occur 3-6 hours after eating mammalian meat. The purpose of this study was to document the clinical delay and assess in vivo activation of basophils. |
Journal of Allergy and Clinical Immunology. 2012 Feb 1;129(2):AB1. | |
| Mozzicato SM, Tripathi A, Posthumus JB, Platts-Mills TA, Commins SP. | 2014 | Porcine or bovine valve replacement in 3 patients with IgE antibodies to the mammalian oligosaccharide galactose-alpha-1,3,-galactose. Letter to the editor Patients who develop IgE to the oligosaccharide galactose-alpha-1, 3-galactose (alpha-gal) report delayed allergic reactions after eating beef, pork or lamb. To date, there have been no published reports indicating whether IgE to alpha-gal is associated with a risk of anaphylaxis at the time of engraftment of a bovine or porcine valve. This case series documents the clinical courses of three patients with elevated IgE to alpha-gal who required porcine or bovine valve replacement. Two patients experienced perioperative or postoperative hypersensitivity reactions, but all three are tolerating valve replacement. |
The journal of allergy and clinical immunology in practice. 2014 Sep;2(5):637. | bioprosthetic heart valve cardiac cardiopulmonary surgery |
| Mu Y, Shao A, Shi L, Du B, Zhang Y, Luo J, Xu L, Qu S. | 2022 | Immunological Risk Assessment of Xenogeneic Dural Patch by Comparing with Raw Material via GTKO Mice. |
BioMed Research International. 2022 Jan 17;2022. | medical product; dural patch |
| Muglia C, Kar I, Gong M, Hermes-DeSantis ER, Monteleone C. | 2015 | Anaphylaxis to medications containing meat byproducts in an alpha-gal sensitized individual. We present a case of alpha-gal allergy in conjunction with allergic reactions to medications that contain magnesium stearate, which may be of bovine origin. Physicians should be aware of the possible cross-reactivity between alpha-gal and medications that contain meat byproducts because inadequate avoidance can result in anaphylaxis. |
The journal of allergy and clinical immunology. In practice. 2015;3(5):796. | |
| Mülleneisen NK, Bergenroth T, Salge S. | 2022 | Das Alpha-Gal-Syndrom. Pneumologie. |
Pneumologie. 2022 May;76(05):362-4. | Europe; Germany |
| Muller J, Radej J, Kriz M, Hunkova E, Kasparek J, Matejovic M. | 2023 | Alpha-gal syndrome–A case report of tick-borne anaphylactic shock. The most common cause of vasoplegic shock in critical care is sepsis. However, although rarely and only in specifically sensitised individuals previously bitten by a tick, red meat may provoke a delayed allergic reaction called an alpha-gal syndrome. We present a case of a protracted life-threatening manifestation of alpha-gal syndrome, which, due to an unusual absence of typical features of anaphylaxis can masquerade as septic shock and calls attention to the premature diagnostic closure as a contributor to diagnostic error. Alpha-gal syndrome is a relatively new, but increasingly recognised health issue. We propose that alpha-gal syndrome should be considered in the differential diagnosis of vasoplegic shock of unclear aetiology even in the absence of typical allergic symptomatology and typical allergen exposure since alpha-gal is present in a wide variety of carriers. |
European Journal of Case Reports in Internal Medicine. 2023 Jun 19. | vasoplegic shock; cardiac arrest; pork kidney |
| Mullins RJ, James H, Platts-Mills TA, Commins S. | 2012 | ** Relationship between red meat allergy and sensitization to gelatin and galactose-alpha-1,3-galactose. Background: We have observed patients clinically allergic to red meat and meat-derived gelatin. Objective: We describe a prospective evaluation of the clinical significance of gelatin sensitization, the predictive value of a positive test result, and an examination of the relationship between allergic reactions to red meat and sensitization to gelatin and galactose-alpha-1,3-galactose (alpha-Gal). Methods: Adult patients evaluated in the 1997-2011 period for suspected allergy/anaphylaxis to medication, insect venom, or food were skin tested with gelatin colloid. In vitro (ImmunoCAP) testing was undertaken where possible. Results: Positive gelatin test results were observed in 40 of 1335 subjects: 30 of 40 patients with red meat allergy (12 also clinically allergic to gelatin), 2 of 2 patients with gelatin colloid-induced anaphylaxis, 4 of 172 patients with idiopathic anaphylaxis (all responded to intravenous gelatin challenge of 0.02-0.4 g), and 4 of 368 patients with drug allergy. Test results were negative in all patients with venom allergy (n = 241), non-meat food allergy (n = 222), and miscellaneous disorders (n = 290). ImmunoCAP results were positive to a-Gal in 20 of 24 patients with meat allergy and in 20 of 22 patients with positive gelatin skin test results. The results of gelatin skin testing and anti-alpha-Gal IgE measurements were strongly correlated (r = 0.46, P < .01). alpha-Gal was detected in bovine gelatin colloids at concentrations of approximately 0.44 to 0.52 mu g/g gelatin by means of inhibition RIA. Conclusion: Most patients allergic to red meat were sensitized to gelatin, and a subset was clinically allergic to both. The detection of a-Gal in gelatin and correlation between the results of a-Gal and gelatin testing raise the possibility that a-Gal IgE might be the target of reactivity to gelatin. The pathogenic relationship between tick bites and sensitization to red meat, alpha-Gal, and gelatin (with or without clinical reactivity) remains uncertain. |
Journal of Allergy and Clinical Immunology. 2012 May 1;129(5):1334-42. | gelatin gelatine |
| Mullins RJA. | 2008 | Clinical Significance of Sensitisation to Gelatine Colloids in 800 Patients. RATIONALE: Gelatine is one of several meat-derived allergens. Evaluation of 2 index cases with anaphylaxis (Ax) to meat and intraoperative gelatine colloid prompted a prospective examination of the significance of gelatine sensitisation. METHODS: Between 2000-7, 800 adults presenting with food (FAx)/ other Ax, drug (DA), venom allergy (VA) plus control disorders underwent SPT and intradermal testing (IDT) with neat Haemaccel and Gelofusine. Where possible, ImmunoCap was used to measure gelatine IgE. . RESULTS: Skin testing: 3 patients had positive SPT; all meat Ax. 27 had positive gelatine IDT (1GIDT): 16/25 meat Ax (including 2 index cases); 0/155 non-meat FAx; 2/15 eosinophilic oesophagitis; 5/98 idiopathic Ax (IAx); DA (2/183); VA (1/123); control disease (1/191); 0/10 miscellaneous Ax. Titrated IDT in 12 cases showed 1GIDT with neat (12 cases) 1/10 (11), 1/100 (7) and 1/1000 gelatine (2 cases). In vitro: 10/11 patients with 1GIDT had gelatine IgE < 0.35 kU/L (including challenge positives). Challenges: Ax occurred in 7/7 cases with 1GIDT exposed to IV gelatine colloid; 2 index cases; 1 accidental exposure in a meat Ax/1GIDT. 4/4 IAx (all 1GIDT) reacted to 1-4 gm gelatine on deliberate IV challenge. Challenges were negative in 2/2 meat Ax/negative GIDT. Followup: 6 with meat Ax/1GIDT had Ax after oral gelatine without meat exposure. . CONCLUSIONS: Some are co-sensitised to gelatine6meat. Sensitisation conveys a risk for oral/parenteral gelatine Ax6meat. The dose required to trigger symptoms, need for IDT to detect sensitisation and usually negative in vitro data suggests low level/affinity IgE. The significance of sensitisation in some controls is uncertain; some had titratable IDT. |
Journal of Allergy and Clinical Immunology. 2008 Feb 1;121(2):S26. | |
| Mur Gimeno P, Lombardero Vega M, Jiménez Burgos F, Lozano Cejudo C, Sancho Calatrava E, Alk-Abelló SA. | 2017 | Red Meat Allergy and Castleman’s Disease. Background: Anaphylaxis, angioedema or hives have been described after eating red meat. Tickbites are progressively accepted as the sensitizing agent. Castleman’s disease is a lymphoproliferativeprocess with different impacts on long-term outcome depending on its centricity. Hyalommalusitanicum is the most prevalent tick in Castilla-La Mancha. Methods: Male, 44 years of age, diagnosed with seasonal rhinoconjunctivitis who reported frequentepisodes of anaphylaxis in the past six months 4-5 hours after eating meat or offal of lamb. Hetolerated beef, pork, venison, wild boar, rabbit and chicken. He acknowledges having been bittenby ticks. Results: SPT against common aeroallergens: positive for grass and olive pollens. SPT withcommercial meats and bovine gelatin-derived colloids (Gelafundin®): negative. IDT with red meatsand gelatines: positive. Specific IgE (ImmunoCAP Thermofisher) for meats (lamb 1.54 KU/L, pork0.82 KU/L, veal 4.94 KU/l), anisakis 14.6 KU/L, ascaris 1.47 KU/L and α-gal 38 KU/L. Spirometry:mixed pattern with bronchodilator response. Chest CT: adenopathy of 13 mm in the left axilla.Lymph node biopsy: compatible with unicentric Castleman’s disease, hyaline-vascular type. Conclusion: We describe two unusual processes in the same patient: delayed anaphylaxis aftereating lamb, controlled by exclusion diet, and unicentric Castleman’s disease treated with surgicalremoval of the lymph node. Ticks population in our area differs from ticks in Europe and the northof Europe. |
Ann Clin Case Rep. 2017; 2.;1335. | |
| Mur Gimeno P, Martin Iglesias A, Armagnague Mallada H, Lombardero Vega M, Sancho Calatrava E. | 2015 | Red meat allergy and gelatine sensitization. No abstract available |
ALLERGY 2015 Sep 1; 70: 488-488). | gelatin gelatine |
| Murangi T, Prakash P, Moreira BP, Basera W, Botha M, Cunningham S, Facey-Thomas H, Halajian A, Joshi L, Ramjith J, Falcone F, Horsnell W, Levin ME. | 2021 | Ascaris lumbricoides and ticks associated with sensitisation to Galactose α1,3-galactose and elicitation of the alpha-gal syndrome. BackgroundIgE to galactose alpha-1,3 galactose (alpha-gal) causes alpha-gal syndrome (AGS) delayed anaphylaxis after ingestion of mammalian meat. Development of sensitization has been attributed to tick bites, however the possible role of other parasites has not been well studied. ObjectiveWe assessed presence, relative abundances, and site of localisation of alpha-gal containing proteins in common ecto- and endo-parasites endemic in a high AGS prevalence area. We investigated the ability of ascaris antigens to elicit a reaction in a humanised rat basophil in-vitro sensitisation model. MethodsTotal IgE, Ascaris-specific IgE, and alpha-gal IgE were measured in sera of challenge-proven AGS patients and non-allergic controls. Presence, concentration and localisation of alpha-gal was assessed in parasites by ELISA, Western blotting and Immunohistochemistry (IHC). The ability of A. lumbricoides antigen to elicit IgE dependent reactivity was demonstrated using the RS-ATL8 basophil reporter system. ResultsAlpha-gal IgE correlated with A. lumbricoides-specific IgE. Alpha-gal protein at 70-130kDa was detected in A. lumbricoides at concentrations higher than those found in Rhipicephalus evertsi and Amblyomma hebraeum ticks. IHC localised alpha-gal in tick salivary acini and the helminth gut. Non-alpha-gal containing A lumbricoides antigens activated RS-ATL8 basophils primed with serum from AGS subjects. ConclusionWe demonstrate the presence, relative abundances, and site of localisation of alpha-gal containing proteins in parasites. The activation of RS-ATL8 IgE reporter cells primed with serum from AGS subjects on exposure to non-alpha-gal containing A lumbricoides proteins indicates a possible role of exposure to A. lumbricoides for alpha-gal sensitisation and clinical reactivity. |
J Allergy Clin Immunol. 2021 Jul 29. | Africa; South Africa; vector; endoparastie; helminth; ascaris |
| Muratore A, Barnes EL, Long MD, Herfarth HH, McGill S. | 2024 | Alpha Guy? No, Alpha Gal—Important to Remember in Patients with IBD in Endemic Areas. |
Digestive Diseases and Sciences. 2024 Nov 26:1-4. | gastroenterological; gastroenterology; IBD; ulcerative colitis; Crohn's |
| Murugan AV, Oliveira T, Alagesan K, Mojtahedinyazdi Y, Mariethoz J, Hayes C, Lisacek F, Karlsson N, Nothaft H, Szymanski C, Finlayson K. | 2021 | Evolutionary Glycomics: A Comprehensive Study of Vertebrate Host Serum/Plasma Glycome Using Orthogonal Glycomics Techniques Eukaryotic Vertebrate host glycosylation machinery has been subject to immense evolutionary pressure. Besides, being crucial for host sustenance, glyco-epitopes are also key-regulators of inter-species pathogen transmission. Significant evolutionary events such as loss of N-glycolyl neuraminic acid (Neu5Gc) or alpha Galactose (α-Gal) epitopes in species such as humans have been relevant for species development and have significantly impacted the ongoing arms race between pathogen and their hosts. Comprehensive knowledge on Vertebrate species-specific glycosylation is still scattered, thereby leaving a substantial gap in our understanding of their glycome evolution. Serum/plasma N- and O-glycomes of 35 different Vertebrate species (mammals, marsupials, birds, reptiles and fish) were analysed by two orthogonal glycomics methods, Porous Graphitised Carbon nano- Liquid Chromatography coupled to Electrospray Ionisation Tandem Mass Spectrometry (PGC nano-LC ESI-MS/MS) and Matrix Associated Laser Desorption Ionisation Time-of-flight Mass Spectrometry (MALDI TOF MS). Sialic acid diversity was additionally captured using High Performance Liquid Chromatography (HPLC) analyses of 1,2 Diamino Methylenedioxybenzene dichloride (DMB)- labelled sialic acids. Vertebrate serum/plasma glycome predominantly contained complex di-, mono sialylated glycans. Core fucosylation of these N-glycans was strongly species dependent, as were the non-reducing end modifications. Most species showed a preference for incorporation of either N-acetyl neuraminic acid (NeuAc) or NeuGc, with exceptions such as rats that use both. Anseriformes (Goose, Duck) N-glycans carried GalNAc-GlcNAc (LacDiNAc) epitopes that, however, were absent in Galliformes (Chicken, Turkey). Reptilians (e.g. Green sea turtles) had high levels of α-Gal epitopes, and Saltwater Crocodile uniquely showed high amounts of oligomannose N-glycans in serum. This largest, vertebrate species-specific serum/plasma glycan and MS/MS spectral data is currently in the process of being made available open access through our collaboration with glycan focussed database such as Glyconnect and UniCarbDB. |
The FASEB Journal.;35. | Vertebrate; reptile; turtle |
| Mustafayev R, Civelek EL, Orhan FA, Yüksel H, Boz AB, Şekerel BE. | 2013 | Similar prevalence, different spectrum: IgE-mediated food allergy among Turkish adolescents. Background: Scarcity of reliable data on food allergy prevalence exists in Turkey. We aimed to assess reported and confirmed IgE-mediated food allergy prevalence, and define the spectrum of allergenic food. Methods: We prospectively evaluated the ISAAC Phase II study population for food allergy. Participants that reported experiencing food allergy symptom in the last year and/or were skin prick test positive for a predefined list of food allergens, were interviewed via telephone, and those considered as having food allergy were invited to undergo clinical investigation, including challenge tests. Results: A total of 6963 questionnaires were available. Parental reported food allergy prevalence and skin prick sensitisation rate were 20.2 ± 0.9% and 5.9 ± 0.6%. According to the above-defined criteria, 1162 children (symptom positive n = 909, skin prick test positive n = 301, both positive n = 48) were selected and 813 (70.0%) were interviewed via telephone. Out of 152 adolescents reporting a current complaint, 87 accepted clinical investigation. There were 12 food allergies diagnosed in nine adolescents, with food allergy prevalence of 0.16 ± 0.11%. The most common foods involved in allergic reactions were walnut (n = 3) and beef meat (n = 2), followed by hen's egg (n = 1), peanut (n = 1), spinach (n = 1), kiwi (n = 1), cheese (n = 1), hazelnut (n = 1) and peach (n = 1). Conclusions: While parental reported food allergy prevalence was within the range reported previously, confirmed IgE-mediated food allergy prevalence among adolescents was at least 0.16%, and the spectrum of foods involved in allergy differed from Western countries, implying environmental factors may play a role. |
Allergologia et immunopathologia. 2013 Nov 1;41(6):387-96. | Asia; Europe; Turkey; prevalence |
| Muthu M, Vickram AS, Emran TB. | 2024 | Extending discussion on alpha-gal syndrome: research needs, clinical significance, and more broad consequences. Annals of Medicine and Surgery.:10-97. |
Annals of Medicine and Surgery.:10-97. | Asia; India |
| Mutoni JD, Coutelier JP, Rujeni N, Mutesa L, Cani PD. | 2022 | Possible Interactions between Malaria, Helminthiases and the Gut Microbiota: A Short Review. Malaria, caused by the Plasmodium species, is an infectious disease responsible for more than 600 thousand deaths and more than 200 million morbidity cases annually. With above 90% of those deaths and cases, sub-Saharan Africa is affected disproportionately. Malaria clinical manifestations range from asymptomatic to simple, mild, and severe disease. External factors such as the gut microbiota and helminthiases have been shown to affect malaria clinical manifestations. However, little is known about whether the gut microbiota has the potential to influence malaria clinical manifestations in humans. Similarly, many previous studies have shown divergent results on the effects of helminths on malaria clinical manifestations. To date, a few studies, mainly murine, have shown the gut microbiota’s capacity to modulate malaria’s prospective risk of infection, transmission, and severity. This short review seeks to summarize recent literature about possible interactions between malaria, helminthiases, and the gut microbiota. The knowledge from this exercise will inform innovation possibilities for future tools, technologies, approaches, and policies around the prevention and management of malaria in endemic countries. |
Microorganisms. 2022 Mar 27;10(4):721. | malaria; helminths; gut microbiome |
| Nakagawa Y, Chinuki Y, Ogino R, Yamasaki K, Aiba S, Ugajin T, Yokozeki H, Kitamura K, Morita E. | 2022 | Cohort study of subclinical sensitization against galactose‐α‐1, 3‐galactose in Japan: Prevalence and regional variations. Sensitization to galactose-α-1,3-galactose (α-Gal) leads to the development of α-Gal syndrome, which includes red meat allergy and cetuximab-induced anaphylaxis. Since tick bites represent the main cause of α-Gal sensitization, it was speculated that sensitization to α-Gal occurs throughout Japan. However, few cohort studies have investigated α-Gal sensitization in Japan. Therefore, we aimed to elucidate the subclinical sensitization rate to α-Gal in Japan. Sera were obtained from 300 participants without food or cetuximab allergy at Shimane University Hospital (Shimane prefecture), Tokyo Medical and Dental University Hospital (Tokyo metropolis), and Tohoku University Hospital (Miyagi prefecture). ImmunoCAP-bovine thyroglobulin (BTG), ImmunoCAP-beef, and IgE immunoblotting with cetuximab were performed to detect α-Gal-specific IgE. Clinical information was collected from participants using a questionnaire. The overall positivity rate of ImmunoCAP-BTG was 4.0% without significant inter-institute differences, whereas that for ImmunoCAP-beef was 9.7% with a significant inter-institute difference. Tokyo Medical and Dental University Hospital (19.0%) had the highest positivity rate. The positivity rate based on cetuximab IgE immunoblotting was 2.7%, without any significant inter-institute differences. The overall positivity rate for both ImmunoCAP-BTG and cetuximab immunoblotting was 2.0%, with a significant inter-institute difference; 5.0% of Shimane University Hospital was the highest. Two cases showed sensitization against the non-α-Gal epitope of cetuximab. The overall positivity rate for both ImmunoCAP-beef and cetuximab immunoblotting was 1.3%, without significant inter-institute differences. Male sex was associated with positive beef-specific IgE. The prevalence of subclinical sensitization to α-Gal is estimated at 2.0%–4.0% in Japan and may be higher in rural areas, supporting an association between tick bites and α-Gal sensitization. In contrast, the prevalence of subclinical sensitization to beef is 9.7% in Japan and is highest in Tokyo Metropolis, suggesting the presence of another IgE-binding epitope apart from α-Gal and another sensitization route in the sensitization to beef IgE. |
The Journal of Dermatology. 2022 Sep 12. | Asia; Japan; beef allergy; prevalence sensitization |
| Nakagawa Y, Chinuki Y, Ueda K, Tsedendorj O, Ugajin T, Yokozeki H, Morita E. | 2019 | 175 Prevalence and regional differences of sensitization to galactose-a-1,3-galactose and/or cetuximab in Japan. Research has shown that the principal cause of cetuximab-induced anaphylaxis is anti-oligosaccharide IgE antibodies specific for galactose-α-1,3-galactose (α-Gal) present on the mouse-derived Fab portion of the cetuximab heavy chain. Furthermore, it has been revealed that patients who are allergic to cetuximab also develop an allergic reaction to mammalian meat containing the α-Gal owing to cross-reactivity, and the presumed cause of sensitization is tick bites. The prevalence of red meat allergy is high in Shimane Prefecture located at the western mountainous area of Japan, as is tick-transmitted Japanese spotted fever. On the other hand, Tokyo Medical and Dental University (TMDU) is located in an urban area, so there are few mountains and forests and the occasion of tick bites are limited. In this study, we aimed to clarify the difference of α-Gal and/or cetuximab specific IgE retention rate in Japan. We enrolled 100 subjects from Shimane University and 50 subjects from TMDU, who had consulted with complaining anything except food allergy. We interviewed about their clinical background. Serum specific IgE antibodies to α-Gal and beef were measured using ImmunoCAPTM. Furthermore, serum specific IgE antibodies to cetuximab was measured using immunoblotting. As a result, the α-Gal-specific IgE were detected (≥ 0.10 kUa/L) in 16 out of 100 subjects in Shimane University and 8 of 50 subjects in TMDU. Moreover, among them, 11 of the 16 in Shimane University and all 8 in TMDU were positive (≥ 0.35 kUa/L) for the beef-specific-IgE test. Additionally, immunoblotting showed 5 of 100 subjects (5%) in Shimane University and 2 subjects (4%) in TMDU have IgE antibody to cetuximab. This study showed that there is almost no difference of α-Gal and/or cetuximab specific IgE retention rate between rural area and urban area in Japan. Therefore, clinicians should be aware of allergies caused by α-Gal all over Japan. |
Journal of Investigative Dermatology. 2019 Sep 1;139(9):S244. | Asia; Japan; prevalence |
| Nalçacı M. | 2024 | Mysterious allergy caused by Tick Bite: Alpha-Gal syndrome. |
Mysterious allergy caused by Tick Bite: Alpha-Gal syndrome. Turkiye Parazitol Derg. 2024;48(3):195-207. | Europe; Turkey; review |
| Nalin F, Scarmozzino R, Arcolaci A, Olivieri B, Tommasi M, Bonadonna P, Zanoni G. | 2024 | Alpha-gal syndrome: when treatment of hypovolemic shock can lead to anaphylaxis. |
Allergologia et Immunopathologia. 2024 May 1;52(3):60-4. | Italy; Europe; pharmaceuticals; gelatin; gelatin-based plasma volume expanders; Geloplasma; perioperative |
| Narlesky MR, Palting A, Sukpraprut-Braaten S, Powell A, Strayhan R. | 2022 | Initiating Psychotropic Treatment in a Patient With Alpha-Gal Syndrome. |
Cureus. 2022 Aug 26;14(8). | psychology; psychiatry; depression; psychopharmacology |
| Naso F, Gandaglia A, Bottio T, Tarzia V, Nottle MB, d'Apice AJ, Cowan PJ, Cozzi E, Galli C, Lagutina I, Lazzari G. | 2013 | First quantification of alpha-Gal epitope in current glutaraldehyde-fixed heart valve bioprostheses. Background: Glutaraldehyde fixation does not guarantee complete tissue biocompatibility in current clinical bioprosthetic heart valves (BHVs). Particularly, circulating anti-aGal human antibodies increase significantly from just 10 days after a BHV implantation. The inactivation of such epitope should be mandatory to meet the requirements for a perspectively safe clinical application; nevertheless, its quantitative assessment in commercially available BHVs has never been carried out. Methods: In this investigation, seven different models of BHVs were tested. The number of epitopes was determined with reference to a standard aGal source by an ELISA test. The presence of xenoantigen was subsequently confirmed by immunofluorescence analysis. Porcine tissue, knockout for the aGal epitopes, was used as negative control. . Results: EpicTM valve was the only model among those tested, in which the aGal antigen appeared to be completely shielded. Composite TrifectaTM valve exhibited conflicting results: cusps of bovine pericardial tissue were devoid of reactive aGal epitopes, while the stent cover strip of porcine pericardium still maintained 30% of active antigens originally present in native tissue. All other tested BHVs express an aGal amount not significantly different from that exhibited by porcine Mosaic valve (5.2 0.6 9 1010 each 10 mg of tissue). . Conclusions: For the first time, the quantitative evaluation of the aGal epitope in heart valve bioprostheses, already in clinical practice for about 40 yrs, was finally determined. Such quantification might provide indications of biocompatibility relevant for the selection of bioprosthetic devices and an increase in the confidence of the patient. It might become a major quality control tool in the production and redirection of future investigation in the quest for aGal-free long-lasting substitutes. |
Xenotransplantation. 2013 Jul;20(4):252-61. | perioperative care; pharmaceutical; pharmacy; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; |
| Naso F, Gandaglia A, Iop L, Spina M, Gerosa G. | 2012 | Alpha-Gal detectors in xenotransplantation research: a word of caution. Xenogeneic tissues are currently employed in clinical practice to create biological substitutes (bioprosthetic heart valves) and in the repair of various damaged tissues (pericardium, gastric-mucosa, nerves, cartilage). Many studies have shown that xenogeneic tissues express superficial epitopes as alpha-Gal, capable of triggering hyperacute and acute vascular rejection phenomena. Currently, no tissue treatment has proven able to completely mask or inactivate such epitopes. In fact, neither glutaraldehyde fixation nor decellularisation procedures ensure a definitive solution because of the persistence of reactive xenoantigen residues. The ability to ascertain alpha-Gal epitope removal from a xenogeneic tissue is closely related to the possibility of its quantitative determination. In the past, detection of the alpha-Gal epitope relied on the use of alpha-Gal reactive isolectin molecules and was limited to isolated cells. Recently, the quantitative evaluation of this antigen has been carried out in whole connective tissue through the use of the monoclonal antibody M86. This article provides an overview of the implications of the alpha-Gal epitope in the current clinical scenario and a definitive comparison between the reliability and specificity of isolectines vs. M86 in alpha-Gal determination. |
Xenotransplantation. 2012 Jul;19(4):215-20. | perioperative care; pharmaceutical; pharmacy; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease; medical products; bioprosthetic heart valve; |
| Nelson Q, Terzian W, Kelly B. | 2023 | FROM TICK TO TRAUMA: ALPHA-GAL IN THE TRAUMA BAY. Introduction: Galactose-alpha-1,3-galactose (alpha-gal) is the antigen in a delayed IgE-mediated allergy associated with sensitization via Amblyomma americanum (lone star tick). We present a case of alpha-gal anaphylaxis in rural Nebraska complicated by unstable vertebral fracture related to hypotensive syncope.Case Description: A 60 yo Caucasian female presented by ambulance for trauma transfer from a rural hospital for a displaced C5 fracture, hypotension, and suspected anaphylactic shock. At 11pm that night she developed diffuse urticaria, followed by tongue swelling and shortness of breath. In route to the local ER, she began to feel dizzy. Whilst checking in to the rural ER, she had a syncopal event fracturing her C5 vertebra. She was given initial anaphylaxis treatment with epinephrine. Then, she was promptly transferred to a tertiary trauma center for further assessment of her neck trauma along with need for vasopressor support due to hypotension. Four hours prior to the reaction, she had eaten a hamburger and Cheetos, and tolerated beef without issue previously. Interestingly, she was recently treated prophylactically for Lyme disease for several embedded ticks. After discharge, she saw an allergist and was found to have a markedly elevated galactose-alpha-1,3-galactose IgE level of 97.70 kU/L.Discussion: Alpha-gal syndrome is a delayed IgE-mediated allergy that usually presents hours after exposure to mammalian meat. Amblyomma americanum ticks are associated with sensitization and have a growing geographic distribution, as evidenced by this case in Nebraska. This case highlights that anaphylaxis can result in significant morbidity (e.g. vertebral fracture due to hypotension), and must be recognized and treated promptly. |
Annals of Allergy, Asthma & Immunology. 2023 Nov 1;131(5):S173. | morbidity; injury; syncope; fracture |
| Nguyen M, Heath J. | 2024 | Galactose-alpha-1, 3-galactose syndrome. |
Journal of Food Allergy (USA). 2020 Sep 1;2(1):108-10. | Review |
| Niu Q, Wei W, Huang Z, Zhang J, Yang B, Wang L. | 2019 | Association between food allergy and ankylosing spondylitis: An observational study. Food allergies can alter the gut microbiome composition, increasing the risk of conditions such as ankylosing spondylitis (AS).To identify the association between specific allergens and AS, we investigated the differences in the serum levels of 14 food antigen-specific immunoglobulin (Ig) G between AS patients and healthy participants. The association between the levels of these antibodies and disease activity was assessed by measuring the inflammatory marker C-reactive protein (CRP).We enrolled 75 AS patients and 78 healthy controls who had undergone antigen-specific IgG tests in West China Hospital between January 2015 and October 2017, and performed enzyme-linked immunosorbent assays for specific IgG against 14 food allergens: rice, egg, mushroom, milk, pork, chicken, beef, crab, codfish, corn, soybean, tomato, shrimp, and wheat. The following tests were used to analyze differences between AS patients and healthy controls: χ2 test for sex, and a 2-tailed Student t-test or Mann–Whitney U test based on the results of Levene test for age and IgG levels. Correlations between IgG and CRP levels were calculated using a Spearman's correlation.AS patients had significantly higher serum levels of beef-, crab-, and pork-specific IgG than did healthy participants. In addition, the serum levels of pork-specific IgG were significantly and positively correlated with CRP.These results suggest that α-Gal, the predominant natural antigen in mammalian red meat, might play a potential role in the pathogenesis of AS, and therefore, AS patients should exclude such allergenic foods, including beef, crab and pork, from their daily diet. |
Medicine. 2019 Feb;98(6). | autoimmune; rheumatology; ankylosing spondylitis |
| Nkurunungi G, Mpairwe H, Versteeg SA, van Diepen A, Nassuuna J, Kabagenyi J, Nambuya I, Sanya RE, Nampijja M, Serna S, Reichardt NC. | 2020 | Cross‐reactive carbohydrate determinant‐specific IgE obscures true atopy and exhibits⍺‐1, 3‐fucose epitope‐specific inverse associations with asthma. Background: In high‐income, temperate countries, IgE to allergen extracts is a risk factor for, and mediator of, allergy‐related diseases (ARDs). In the tropics, positive IgE tests are also prevalent, but rarely associated with ARD. Instead, IgE responses to ubiquitous cross‐reactive carbohydrate determinants (CCDs) on plant, insect and parasite glycoproteins, rather than to established major allergens, are dominant. Because anti‐CCD IgE has limited clinical relevance, it may impact ARD phenotyping and assessment of contribution of atopy to ARD. . Methods: Using an allergen extract‐based test, a glycan and an allergen (glyco)protein microarray, we mapped IgE fine specificity among Ugandan rural Schistosoma mansoni (Sm )‐endemic communities, proximate urban communities, and importantly in asthmatic and nonasthmatic schoolchildren. . Results: Overall, IgE sensitization to extracts was highly prevalent (43%‐73%) but allergen arrays indicated that this was not attributable to established major allergenic components of the extracts (0%‐36%); instead, over 40% of all participants recognized CCD‐bearing components. Using glycan arrays, we dissected IgE responses to specific glycan moieties and found that reactivity to classical CCD epitopes (core β‐1,2‐xylose, α‐1,3‐fucose) was positively associated with sensitization to extracts, rural environment and Sm infection, but not with skin reactivity to extracts or sensitization to their major allergenic components. Interestingly, we discovered that reactivity to only a subset of core α‐1,3‐fucose‐carrying N‐glycans was inversely associated with asthma. . Conclusions: CCD reactivity is not just an epiphenomenon of parasite exposure hampering specificity of allergy diagnostics; mechanistic studies should investigate whether specific CCD moieties identified here are implicated in the protective effect of certain environmental exposures against asthma. |
Allergy. 2020 Jun 22. | |
| Noor K, Orren J | 2023 | Alpha Gal Syndrome: A symptomatic presentation in the Emergency Room. |
Preprint. https://doi.org/10.21203/rs.3.rs-3628265/v1 | |
| Nouar D, Lemoine R, Carré-Faure MC, Cottet J, Hoarau C. | 2018 | Induction de tolérance à l’alpha-gal sous omalizumab: étape 1: suivi des TAB après omalizumab. IntroductionL’anaphylaxie alimentaire aux viandes de mammifères (bœuf, porc, agneau) est liée au galactose-α-1,3-galactose (alpha-gal) contenu dans les abats et viandes rouges. La sensibilisation a lieu aussi après morsure de tique. Cette anaphylaxie semi-retardée (6 à 8 h) peut entraîner des chocs anaphylactiques sévères. À l’heure actuelle il n’existe pas de traitement hormis l’éviction des viandes incriminées et la prescription d’adrénaline.MéthodesNous présentons les cas de 2 patients ayant une anaphylaxie sévère à l’alpha-gal et pour lesquels une immunothérapie spécifique est envisagée. Le patient A présente une anaphylaxie de grade 3 6 h après consommation de boudin blanc tandis que le patient B a eu 3 épisodes d’anaphylaxie de grade 3 8 h après un repas avec viande de bœuf et saucisses de porc. L’étape 1 est de traiter par omalizumab avant ITO. L’efficacité de l’anti-IgE a été évaluée par un suivi clinico-biologique régulier et test d’activation des basophiles (TAB) mensuel à l’alpha-gal.RésultatsPatient A : prick test (PT) à la présure et au boudin blanc positifs, IgE spécifiques alpha-gal à 89 kUA/L. Injection d’omalizumab tous les 15 jours. Éviction des viandes rouges et abats mais a consommé par inadvertance un bouillon de bœuf sans incident. Patient B : PT à la présure négatif, IgE alpha-gal > 100 kUA/L, traitement identique et a réintroduit de lui-même la viande rouge et le bœuf sans problème en évitant les abats et le porc. TAB mensuels : activation spécifique à l’alpha-gal qui a quasi disparu après 2e injection d’omalizumab dans les deux cas.DiscussionL’anti-IgE est ici efficace. Le TAB est un test fonctionnel permettant de suivre précisément l’efficacité du traitement. Un TPO à l’alpha-gal à définir est intéressant. Il faudra également étudier la corrélation des résultats du TAB alpha-gal et du TPO chez ces deux patients.ConclusionNous constatons chez ces deux patients une disparition de la réponse spécifique vis-à-vis de l’alpha-gal sous omalizumab avec un suivi par TAB nous permettant de débuter une ITO. |
Revue Française d'Allergologie. 2018 Apr 1;58(3):235. | management; omalizumab |
| Nourian MM, Stone Jr CA, Siegrist KK, Riess ML | 2023 | Perioperative implications of patients with alpha gal allergies. Alpha Gal Syndrome (AGS) is an emerging immune response to mammalian products (MP) containing the oligosaccharide galactose-α-1,3 galactose (α-Gal) which includes meats and inactive ingredients in certain medications. This becomes clinically important in the perioperative realm as MPs are commonly found in the operating room, and pre- and post-operative settings, and can trigger responses as severe as anaphylaxis. In this review, authors discuss the epidemiology, diagnosis and treatment of AGS reactions. Additionally, strategies are explored in order to screen and prevent exposure to MP with a multidisciplinary approach. While this emerging allergy is still not fully understood, it is of paramount importance that all anesthesia providers recognize the implications of MP exposure in AGS patients and ultimately prevent harm in this highly vulnerable population. |
Journal of Clinical Anesthesia. 2023 Jun 1;86:111056. | Perioperative; surgery; medical products; induction agents; analgesics; anticoagulants; medical devices; heparin |
| Novak P, Giannetti MP, Weller E, Hamilton MJ, Castells M. | 2021 | Mast cell disorders are associated with decreased cerebral blood flow and small fiber neuropathy. |
Annals of Allergy, Asthma & Immunology. 2021 Oct 11. | Neurology; symptoms; neuropathy; mast cell disorder |
| Nuñez R, Carballada F, Gonzalez-Quintela A, Gomez-Rial J, Boquete M, Vidal C. | 2011 | Delayed mammalian meat-induced anaphylaxis due to galactose-alpha-1,3-galactose in 5 European patients. Letter to the editor ...Here we present 5 cases of delayed anaphylaxis to red meatin Europe (northwestern Spain). In these cases, a-gal-sIgE was demonstrated. Skin prick tests (SPTs) with a beef extract were positive, and inhibition experiments showed that beef-sIgE positivity was due to a-gal sensitization. Most patients reported a history of tick bites |
Journal of Allergy and Clinical Immunology. 2011 Nov 1;128(5):1122. | Nunez R; |
| Nuñez-Orjales R, Martin-Lazaro J, Lopez-Freire S, Galan-Nieto A, Lombardero-Vega M, Carballada-Gonzalez F. | 2017 | Bovine Amniotic Fluid: A New and Occupational Source of Galactose-alpha-1,3-Galactose. In 2009, Commins et al reported a series of patients with delayed anaphylaxis, angioedema, and urticaria after consumption of red meat or dairy products. In 2011, the first cases showing the same features were reported in Spain. Since then, several additional sources of galactose-α-1,3galactose (α-gal) have been reported, namely, mammalian innards [3], gelatin-containing foods and drugs, and bioprosthetic aortic valves [7]. Here, we report the cases of 3 cattle workers who presented with allergic symptoms after assisting the veterinarian during calving. |
Journal of Investigational Allergology & Clinical Immunology. 2017 Jan 1;27(5):313-4. | Nunez-Orjales R; Spain; Europe; occupational medicine; farming; cattle |
| Nwamara U, Kaplan MC, Mason N, Ingemi AI. | 2021 | A Retrospective Evaluation of Heparin Product Reactions in Patients with Alpha-Gal Allergies. Background: Alpha-gal allergy, also known as red meat allergy or alpha-gal syndrome, can present after bites of certain tick species that contain galactose-alpha-1,3-galactose (alpha-gal) carbohydrate. Following this exposure, patients may develop an allergic reaction after mammalian meat consumption. Some heparin products are derived from porcine intestinal tissue, and it is therefore possible that administering these medications to a patient with an alpha-gal allergy may trigger a reaction. Objective: The purpose of this study was to evaluate the incidence of reactions to porcine heparin products in patients with an alpha-gal allergy. Methods: A retrospective case series was conducted by review of electronic medical record data. Patients included were between the ages of 18 and 89 years, with a documented alpha-gal or red meat allergy and an admission to a hospital in the Sentara Healthcare system. The primary outcome was the incidence of allergic reactions upon exposure to heparin products in patients with a documented alpha-gal allergy. Results: Patients with a documented alpha-gal allergy received a heparin product in 57 of 158 hospital visits (36.1%). Heparin products were tolerated in 56 of the 57 visits (98.3%). The incidence of an alpha-gal reaction to unfractionated heparin was 2.6% (1/39) while the incidence of an alpha-gal reaction to enoxaparin was 0% (0/22). Conclusion and Relevance: Heparin products were associated with a low incidence of alpha-gal reactions among patients with documented alpha-gal allergy. It is possible that enoxaparin poses less of a risk for reaction in these patients compared to unfractionated heparin. |
Ticks Tick Borne Dis. Published online November 11, 2021:101869. | Pharmacy; pharmaceutical; perioperative; medical products; heparin; surgery; cardiac; cardiology |
| O'Neil BH, Allen R, Spigel DR, Stinchcombe TE, Moore DT, Berlin JD, Goldberg RM. | 2007 | High Incidence of Cetuximab-Related Infusion Reactions in Tennessee and North Carolina and the Association With Atopic History. Purpose: To confirm the anecdotal observation that patients in North Carolina (NC) and Tennessee (TN) treated with cetuximab experience hypersensitivity reactions (HSR) at a much higher rate than are reported nationally and internationally (≤ 3%). Patients and Methods: Data from patients treated with cetuximab on clinical trials (n = 88) at three research sites were analyzed for grade 3 or 4 HSR. Additional information was obtained from medical records for patients treated with cetuximab at the University of North Carolina (Chapel Hill, NC) to determine whether history of other significant allergy was a risk factor for HSR to cetuximab. Results: Data for 88 patients on clinical trials and an additional 55 patients treated outside of trials were included in this analysis. Patients had a variety of tumor types. For the clinical trial group (n = 88), the overall rate of grade 3 to 4 HSR was 22%, significantly higher than the rate noted in any large published trial. All HSRs occurred during the first dose. There was a strong relationship between prior allergy history and chance of HSR. Conclusion: At the sites in neighboring NC and TN studied, HSR was far more common than reported in national studies. History of prior allergy is a strong predictor of HSR. Further investigation of more specific predictors of HSR in the US middle south region is warranted, and patients being treated with cetuximab in this area should be observed particularly closely during their first infusion. |
Journal of Clinical Oncology. 2007 Aug 20;25(24):3644-8. | |
| Ockerman HW, Hansen CL. | 1999 | Animal by-product processing & utilization. [Book] |
Renewable Energy. 2012 Sep 1;45:138-45. | mammalian byproducts |
| Ohashi T, Fujiyama K, Takegawa K. | 2020 | Identification of novel α1, 3-galactosyltransferase and elimination of α-galactose-containing glycans by disruption of multiple α-galactosyltransferase genes in Schizosaccharomyces pombe. Background: We searched for unidentified α1,3-galactosyltransferases in Schizosaccharomyces pombe and identified three novel genes (otg1+–otg3+). Results: The Otg proteins were found to be glycosyltransferases with the ability to form α1,3-linkages between Gal and α-Man residues. Conclusion: Complete elimination of α-galactosylation in S. pombe was achieved by multiple deletions of newly found otg+ genes. Significance: This is the first study to functionally identify and characterize novel α1,3-galactosyltransferases in S. pombe. |
Journal of Biological Chemistry. 2012 Nov 9;287(46):38866-75. | fungi |
| Ohshita N, Ichimaru Y, Gamoh S, Tsuji K, Kishimoto N, Tsutsumi YM, Momota Y. | 2017 | Management of infusion reactions associated with cetuximab treatment: A case report. Cetuximab is a drug targeting the epidermal growth factor receptor, which is indicated for the treatment of unresectable advanced or recurrent head and neck or colorectal cancer. Cetuximab also enhances the cytotoxic effects of radiation in squamous cell carcinoma. The severity of infusion reactions (IR) is categorized from grade 1 to 5; grades 3 and 4 are associated with life-threatening reactions (anaphylaxis), whereas grade 5 indicates death. The incidence of grade 3-4 IR with premedication is reported to be 1.1%. We herein describe a case of a 77-year-old man who developed IR during intravenous administration of cetuximab. The patient developed grade 3-4 anaphylaxis with pruritus, rash and urticaria, followed by hypotension and bradycardia. The timely diagnosis and treatment with intravenous infusion of a vasopressor drug and Ringer's acetate solution proved to be effective. The case presented herein demonstrated an unfeatured aspect of cetuximab-related IR as dermatological reactions over the entire body followed by circulatory collapse. |
Molecular and Clinical Oncology. 2017 Jun 1;6(6):853-5. | non-tick vectors; parasites; ectoparasites; mites; allergen; cross-reactivity; cross-reaction; flounder roe; fish; sushi |
| Ohta T, Yoshikawa S, Tabakawa Y, Yamaji K, Ishiwata K, Shitara H, Taya C, Oh-Hora M, Kawano Y, Miyake K, Yamanishi Y. | 2017 | Skin CD4+ Memory T Cells Plan and Essential Role in Acquired Anti-Tick Immunity through Interleukin-3-Mediated Basophil Recruitment to Tick-Feeding Sites. Ticks, blood-sucking arthropods, serve as vectors for transmission of infectious diseases including Lyme borreliosis. After tick infestation, several animal species can develop resistance to subsequent infestations, reducing the risk of transmission. In a mouse model, basophils reportedly infiltrate tick-feeding sites during the second but not first infestation and play a crucial role in the expression of acquired tick resistance. However, the mechanism underlying basophil recruitment to the second tick-feeding site remains ill-defined. Here, we investigated cells and their products responsible for the basophil recruitment. Little or no basophil infiltration was detected in T-cell-deficient mice, and adoptive transfer of CD4+ but not CD8+ T cells reconstituted it. Il3 gene expression was highly upregulated at the second tick-feeding site, and adoptive transfer of interleukin-3 (IL-3)-sufficient but not IL-3-deficient CD4+ T cells conferred the basophil infiltration on T-cell-deficient mice, indicating that the CD4+ T-cell-derived IL-3 is essential for the basophil recruitment. Notably, IL-3+ resident CD4+ memory T cells were detected even before the second infestation in previously uninfested skin distant from the first tick-feeding site. Taken together, IL-3 produced locally by skin CD4+ memory T cells appears to play a crucial role in basophil recruitment to the second tick-feeding site. |
Frontiers in immunology. 2017 Oct 16;8:1348. | |
| OKUBO K, SEKO A, SATO A, SATSUMI K, OKUMOTO N. | 1991 | Identification of rainbow trout of delayed maturity (3-year maturation) based on cortical alveolar glycoproteins (hyosophorin). |
Nippon Suisan Gakkaishi. 1991;57(7):1355-64. | fish; fish egg; roe; hyosophorin |
| Okuda T. | 2024 | Characterization of antibodies induced by immunization of mice with isoglobotrihexosylceramide (iGb3). |
Characterization of antibodies induced by immunization of mice with isoglobotrihexosylceramide (iGb3). Biochemistry and Biophysics Reports. 2024 Dec 1;40:101855. | glycans; antibodies; cross-reactivitiy |
| Okumura H, Inaba S, Kawashima A. | 2024 | Approaches to Alpha-Gal Syndrome in Japan. |
Annals of Emergency Medicine. 2024 Apr 1;83(4):419. | Japan; flounder roe |
| Olafson P. | 2014 | *Ticks and the Mammalian Meat Allergy Topic Brief: Beef Safety. Warmer temperatures and longer days signal the start to spring and summer chores on most cattle ranches. While the time spent outdoors is refreshing after the winter months, it brings with it an increased risk for not only heat exhaustion and dehydration but also for exposure to disease‐transmitting insects and ticks. Within the past three years, the novel Heartland and Bourbon viruses were discovered, both of which are transmitted via tick bites and resulted in human illnesses in Missouri, Tennessee and Kansas. Tick‐borne diseases of humans and livestock are well documented, as are immediate allergic skin reactions that can occur upon being bitten. But what if a tick bite could also cause a food allergy to red meat? It may sound like something straight out of the Twilight Zone, but tick bites and specific sugar modifications on red meat are actually the major players in the intriguing, highly publicized mammalian meat allergy. Note: this article is most interesting for it's map showing CDC data for percent positive rates for IgE to alpha‐gal within each of six regions in the United States, 2012‐2013 |
MMWR Morb Mortal Wkly Rep. 2014;63(12):270-1. | prevalence |
| Olivera-Ardid S, Bello-Gil D, Tuzikov A, Araujo RN, Ferrero-Alves Y, García Figueroa BE, Labrador-Horrillo M, García-Pérez AL, Bovin N, Mañez R. | 2022 | Poly-L-Lysine-Based αGal-Glycoconjugates for Treating Anti-αGal IgE-Mediated Diseases. The Spike protein of SARS-CoV-2, its receptor-binding domain (RBD), and its primary receptor ACE2 are extensively glycosylated. The impact of this post-translational modification on viral entry is yet unestablished. We expressed different glycoforms of the Spike-protein and ACE2 in CRISPR-Cas9 glycoengineered cells, and developed corresponding SARS-CoV-2 pseudovirus. We observed that N- and O-glycans had only minor contribution to Spike-ACE2 binding. However, these carbohydrates played a major role in regulating viral entry. Blocking N-glycan biosynthesis at the oligomannose stage using both genetic approaches and the small molecule kifunensine dramatically reduced viral entry into ACE2 expressing HEK293T cells. Blocking O-glycan elaboration also partially blocked viral entry. Mechanistic studies suggest multiple roles for glycans during viral entry. Among them, inhibition of N-glycan biosynthesis enhanced Spike-protein proteolysis. This could reduce RBD presentation on virus, lowering binding to host ACE2 and decreasing viral entry. Overall, chemical inhibitors of glycosylation may be evaluated for COVID-19. |
Frontiers in Immunology. 2022:1252. | Treatment |
| Organic Materials Review Institute for the USDA National Organic Program. | 2012 | Gelatin Processing |
||
| Orhan F, Karakas T, Cakir M, Aksoy A, Baki A, Gedik Y. | 2009 | Prevalence of immunoglobulin E‐mediated food allergy in 6–9‐year‐old urban schoolchildren in the eastern Black Sea region of Turkey. Background: The prevalence of adverse reactions to food in childhood in Turkey is not known. Objective: We aimed to investigate the prevalence and characteristics of IgE‐mediated food allergies (FAs) in 6–9‐year‐old urban schoolchildren. Methods: This cross‐sectional study recruited 3500 of the randomly selected 6–9‐year‐old urban schoolchildren from the eastern Black Sea region of Turkey during 2006. Following a self‐administered questionnaire completed by the parents and the child, consenting children were invited for skin prick tests (SPTs) and oral food challenges. Children with suspected IgE‐mediated FA were skin prick tested with a predefined panel of food allergens (milk, hen's egg, soy, wheat, peanut, fish, and hazelnut), aeroallergens (Dermatophagoides pteronyssinus, Dermatophagoides farinae , cat, dog, Alternaria , grass pollen mix, weed pollen mix, and tree pollen mix), and food allergens reported in the questionnaire. All children with a positive SPT to any food were invited for a double‐blind, placebo‐controlled food challenge (DBPCFC). The prevalence of IgE‐mediated FA was established using DBPCFCs. . Results: The response rate to the questionnaire was 78.2% (2739/3500). The estimated prevalence of parental‐reported IgE‐mediated FA was 5.7% (156/2739) [95% confidence interval (CI), 4.83–6.57%]. The rate of sensitization to the food allergens was 33.1% (48/145) in the parental‐reported group. The confirmed prevalence of IgE‐mediated FA by means of DBPCFC in 6–9‐year‐old urban schoolchildren living in the eastern Black Sea region of Turkey was 0.80% (22/2739) (95% CI, 0.47–1.13%). The most common allergenic foods were beef (31.8%), cow's milk (18.1%), cocoa (18.1%), hen's egg (13.6%), and kiwi (13.6%). Conclusions: The rate of reported IgE‐mediated FA was significantly higher than clinically confirmed FA by means of DBPCFC (odds ratio, 7.46; 95% CI, 4.67–12.01; P <0.0001). The order of allergenic foods was different and somewhat unique to the eastern Black Sea region of Turkey when compared with western countries. |
Clinical & Experimental Allergy. 2009 Jul;39(7):1027-35. | Turkey; Asia; Europe; beef allergy; family history |
| Orhan F, Sekerel BE. | 2013 | Beef allergy: a review of 12 cases. Background: Although beef allergy has long been considered a rare condition, the number of studies regarding the nature, epidemiology, and symptoms of beef allergy has been increasing. We aimed to describe the results of allergy work‐up of 12 patients who have a convincing history of acute allergic symptoms following beef ingestion. Methods: Detailed histories of 10 children and two adult relatives were obtained and patients underwent skin prick tests with commercial beef extract, raw beef and cooked beef. Serum total and beef‐specific IgE were measured. Labial, and in selected cases, open food challenges were undertaken. Results: Interestingly, the rate of family history of beef allergy was 67% (8/12). Three patients (two with commercial extract, and one with cooked beef) had positive skin test responses to beef. Ten (83%) patients had elevated serum IgE concentrations (median 316.5 kU/l, range 9–1321 kU/l) and the beef‐specific IgE was positive in all patients (median 6.23 kUA/l, range 0.83–36.6 kUA/l). Labial food challenge was positive in four (30%) patients. Of the five patients who underwent open food challenges, three were positive and two tolerated the beef administered. Conclusions: We conclude that skin prick tests do not accurately diagnose IgE‐mediated sensitization to beef. Thus, patients with suspected beef allergy should be screened additionally for beef‐specific IgE antibodies, and in selected cases oral food challenge should be carried out to verify the diagnosis. |
Journal of Allergy and Clinical Immunology. 2018 Jan 1;141(1):41-58. | Turkey; Asia; Europe; beef allergy |
| Pacheco I, de Mera IG, Brito FF, Torrijos EG, Villar M, Contreras M, Lima-Barbero JF, Doncel-Pérez E, Cabezas-Cruz A, Gortázar C, de la Fuente J. | 2020 | Characterization of the anti-α-Gal antibody profile in association with Guillain-Barré syndrome, implications for tick-related allergic reactions. Humans evolved by losing the capacity to synthesize the glycan Galα1-3Galβ1-(3)4GlcNAc-R (α-Gal), which resulted in the capacity to develop a protective response mediated by anti-α-Gal IgM/IgG antibodies against pathogens containing this modification on membrane proteins. As an evolutionary trade-off, humans can develop the alpha-Gal syndrome (AGS), a recently diagnosed disease mainly associated with allergic reactions to mammalian meat consumption. The etiology of the AGS is the exposure to tick bites and the IgE antibody response against α-Gal-containing glycoproteins and glycolipids. The objective of this study was to characterize the anti-α-Gal antibody response in association with the immune-mediated peripheral neuropathy, Guillain-Barré syndrome (GBS), and compare it with different factors known to modulate the antibody response to α-Gal such as exposure to tick bites and development of allergic reactions in response to tick bites. The results showed a significant decrease in the IgM/IgG response to α-Gal in GBS patients when compared to healthy individuals. In contrast, the IgM/IgG levels to α-Gal did not change in patients with allergic reactions to tick bites. The IgE response was not affected in GBS patients, but as expected, the IgE levels significantly increased in individuals exposed to tick bites and patients with tick-associated allergies. These results suggest that the immune pathways of anti-α-Gal IgM/IgG and IgE production are independent. Further studies should consider the susceptibility to allergic reactions to tick bites in GBS patients. |
Ticks and Tick-borne Diseases. | Guillain-Barre |
| Pacheco-Quito EM, Ruiz-Caro R, Veiga MD. | 2020 | Carrageenan: Drug Delivery Systems and Other Biomedical Applications. Marine resources are today a renewable source of various compounds, such as polysaccharides, that are used in the pharmaceutical, medical, cosmetic, and food fields. In recent years, considerable attention has been focused on carrageenan-based biomaterials due to their multifunctional qualities, including biodegradability, biocompatibility, and non-toxicity, in addition to bioactive attributes, such as their antiviral, antibacterial, antihyperlipidemic, anticoagulant, antioxidant, antitumor, and immunomodulating properties. They have been applied in pharmaceutical formulations as both their bioactive and physicochemical properties make them suitable biomaterials for drug delivery, and recently for the development of tissue engineering. This article provides a review of recent research on the various types of carrageenan-based biomedical and pharmaceutical applications. |
Marine Drugs. 2020 Nov;18(11):583. | Carrageenan; pharmaceutical; medical product |
| Paddock CD, Yabsley MJ. | 2007 | Ecological havoc, the rise of white-tailed deer, and the emergence of Amblyomma americanum-associated zoonoses in the United States. Two infectious diseases, and one presumably infectious disease, each vectored by or associated with the bite of the lone star tick ( Amblyomma americanum ), were identified and characterized by clinicians and scientists in the United States during the 1980s and 1990s. These three conditions—human monocytic (or monocytotropic) ehrlichiosis (HME), Ehrlichia ewingii ehrlichiosis, and southern tick-associated rash illness (STARI)—undoubtedly existed in the United States prior to this time. However, the near-simultaneous recognition of these diseases is remarkable and suggests the involvement of a unifying process that thrust multiple pathogens into the sphere of human recognition. |
In:Wildlife and emerging zoonotic diseases: the biology, circumstances and consequences of cross-species transmission 2007 (pp. 289-324). Springer, Berlin, Heidelberg. | Deer; prevalence |
| Padler-Karavani V, Yu H, Cao H, Chokhawala H, Karp F, Varki N, Chen X, Varki A. | 2008 | Diversity in specificity, abundance, and composition of anti-Neu5Gc antibodies in normal humans: potential implications for disease. Human heterophile antibodies that agglutinate animal erythrocytes are known to detect the nonhuman sialic acid N-glycolylneuraminic acid (Neu5Gc). This monosaccharide cannot by itself fill the binding site (paratope) of an antibody and can also be modified and presented in various linkages, on diverse underlying glycans. Thus, we hypothesized that the human anti-Neu5Gc antibody response is diverse and polyclonal. Here, we use a novel set of natural and chemoenzymatically synthesized glycans to show that normal humans have an abundant and diverse spectrum of such anti-Neu5Gc antibodies, directed against a variety of Neu5Gc-containing epitopes. High sensitivity and specificity assays were achieved by using N-acetylneuraminic acid (Neu5Ac)-containing probes (differing from Neu5Gc by one less oxygen atom) as optimal background controls. The commonest anti-Neu5Gc antibodies are of the IgG class. Moreover, the range of reactivity and Ig classes of antibodies vary greatly amongst normal humans, with some individuals having remarkably large amounts, even surpassing levels of some well-known natural blood group and xenoreactive antibodies. We purified these anti-Neu5Gc antibodies from individual human sera using a newly developed affinity method and showed that they bind to wild-type but not Neu5Gc-deficient mouse tissues. Moreover, they bind back to human carcinomas that have accumulated Neu5Gc in vivo. As dietary Neu5Gc is primarily found in red meat and milk products, we suggest that this ongoing antigen-antibody reaction may generate chronic inflammation, possibly contributing to the high frequency of diet-related carcinomas and other diseases in humans. |
Glycobiology. 2008 Oct 1;18(10):818-30. | glycan antibody; glycan antigen; sialic acid; Neu5Gc; carbohydrate allergy |
| Panda AK, Tripathy R, Das BK. | 2020 | Plasmodium falciparum Infection May Protect a Population from Severe Acute Respiratory Syndrome Coronavirus 2 Infection. Letter to the editor |
The Journal of Infectious Diseases. 2020 Nov 1;222(9):1570-1. | |
| Panella NA, Nicholson WL, Komar N, Burkhalter KL, Hughes HR, Theuret DP, Blocher BH, Sexton C, Connelly R, Rothfeldt L, Kenney JL. | 2024 | Field-Collected Ticks From Benton County, Arkansas, and Prevalence of Associated Pathogens. |
Journal of Medical Entomology. 2024 Mar 27:tjae040. | vector; tick; lone star tick; Arkansas; coinfection; tick-borne disease; Ehrlichiosis; tularemia; Bourbon virus |
| Pantazis DA, Santra G. | 2025 | Conformational Profile of Galactose‐α‐1, 3‐Galactose (α‐Gal) and Structural Basis of Its Immunological Response. Here we present a thorough conformational analysis of α-Gal using a unique combination of techniques, ranging from classical dynamics to a staged automatic conformer generation and screening using a quantum-mechanics-based protocol elaborated in the present work. The results reveal a remarkably constrained and rigid conformational profile that is minimally responsive to solvation. Subsequently, we study the binding of α-Gal to the M86 antibody using multiscale hybrid (QM/MM) calculations. Quantum mechanical analysis of the binding in terms of non-covalent interactions, local energy decomposition, and quantities derived from the quantum theory of atoms in molecules, enable us to identify and quantify the key interactions that form the structural basis of α-Gal's immunological response. |
Chemistry–A European Journal.:e202500050. | chemistry; conformation; glycobiology; carbohydate chemistry |
| Panthawong A, Chareonviriyaphap T, Doggett SL. | 2020 | Toxicity and persistence of permethrin‐impregnated clothing against the Australian paralysis tick, Ixodes holocyclus (Acari: Ixodidae). Permethrin is a pyrethroid insecticide that has been widely used for the impregnation of fabrics to prevent the bites from arthropods such as mosquitoes and ticks. There are two types of permethrin impregnation: Do‐It‐Yourself (DIY) packs and pre‐impregnated fabrics. Both forms have been on sale for many years in Australia, however to date, no data are available regarding their efficacy against Ixodes holocyclus. The aims of this study were to test and compare the contact toxicity of a DIY product versus two pre‐impregnated fabrics (shirt and trousers) against I. holocyclus, and to test the efficacy of the fabrics after repeated laundering. All treated and untreated fabrics were tested before laundering (0 washes) and after 10, 30 and 50 washes. Five ticks were placed onto each test fabric for 2 min, with four replicates for a total of 20 ticks per test. Both knockdown and mortality of I. holocyclus ticks were recorded at 60 min and 24 h, respectively. Logistic regression analysis was used to assess the relationship between knockdown and mortality in ticks exposed to each fabric product, before and after laundering. All of the unwashed treated fabrics were effective in causing 100% knockdown. With 10 washes, the percentage of knockdown with the pre‐impregnated shirt and trousers was 95% and 90%, respectively. The DIY product was less effective with only 15% knockdown. The levels of knockdown with the pre‐impregnated shirt and trousers further decreased with 30 washes to 70% and 20%, respectively, and then further declined to 45% and 20% with 50 washes. For the DIY product, knockdown was only 10% and 5% with 30 and 50 washes, respectively. There was minimal mortality recorded at 24 h even with the unwashed fabrics. This study indicated that the pre‐impregnated product was more effective in repelling I. holocyclus ticks than the DIY impregnation pack and the efficacy of this product degrades notably after 10 washes. |
Austral Entomology. 2020. | Vector; tick; prevention; repellent; permethrin |
| Parenteau-Bareil R, Gauvin R, Berthod F. | 2010 | Collagen-based biomaterials for tissue engineering applications. Collagen is the most widely distributed class of proteins in the human body. The use of collagen-based biomaterials in the field of tissue engineering applications has been intensively growing over the past decades. Multiple cross-linking methods were investigated and different combinations with other biopolymers were explored in order to improve tissue function. Collagen possesses a major advantage in being biodegradable, biocompatible, easily available and highly versatile. However, since collagen is a protein, it remains difficult to sterilize without alterations to its structure. This review presents a comprehensive overview of the various applications of collagen-based biomaterials developed for tissue engineering, aimed at providing a functional material for use in regenerative medicine from the laboratory bench to the patient bedside. |
Materials. 2010 Mar;3(3):1863-87. | |
| Park HJ, Suk KS, Park JW. | 2018 | A case of intraoperative anaphylaxis caused by bovine-derived thrombin. |
Allergy, asthma & immunology research. 2018 Mar 1;10(2):184-6. | Primary beef allergy; thrombin |
| Park JS, Yoo Y, Kwon JW. | 2024 | Multiple Allergen Simultaneous Test for Food Allergens Cannot Screen Wheat-Dependent, Exercise-Induced Anaphylaxis and α-Gal Syndrome. MAST for sIgE to food allergens cannot screen WDEIA and AGS. The tests for sIgE to a specific component of food allergen, such as omega-5 gliadin for WDEIA and α-gal for AGS, should be used to screen WDEIA and AGS. |
Yonsei Medical Journal. 2024 Apr 12;65. | diagnosis; testing; MAST |
| Park KH, Lee J, Beom SH, Shin SJ, Ahn JB, Kim SR, Lee JH, Park JW. | 2021 | Nationwide pharmacovigilance data for cetuximab-induced anaphylaxis and predictive model validation using prospective specific IgE detection Background: Cetuximab (chimeric monoclonal antibody to human epidermal growth factor receptor) is used to treat colorectal and head and neck cancers. Due to cross-reactivity with galactose-α-1,3-galactose (alpha-gal), it can induce hypersensitivity even at first administration. We aimed to determine the incidence and clinical manifestation of cetuximab-induced anaphylaxis, and to establish a means of predicting its incidence in patients ahead of treatment. Methods: Nationwide and single-center pharmacovigilance data from 2010 to 2017 were collected from the Korea Institute of Drug Safety-Korea Adverse Event Reporting System and Severance Regional Pharmacovigilance Center. Patients scheduled for cetuximab administration were enrolled prospectively. A skin prick test was carried out and serum IgE specific to cetuximab and cross-reactive allergens were measured. Reactions were monitored after cetuximab infusion. Results: Over 8 years, there were 23 reports of anaphylaxis nationwide. In a single-center study, incidence of cetuximab-induced anaphylaxis was 1.1%. Most anaphylaxis occurred at first injection (93.3%), even under pretreatment with anti-allergic drugs. Four of 64 patients (6.3%) experienced severe anaphylaxis. The median cetuximab-specific IgE titer was 6.9 kUA/L in patients experiencing anaphylaxis and 0 kUA/L in those who did not (P < 0.001). The results of alpha-gal, beef sIgE, and cetuximab skin prick testing were similar to those of cetuximab sIgE. Patients who did not experience hypersensitivity were negative in all 4 allergy tests. Its positive and negative predictive values were 100%. Conclusions: Specific IgE detection of cetuximab or alpha-gal can accurately predict cetuximab-induced anaphylaxis prior to first administration. |
World Allergy Organization Journal. 2021 Jul 1;14(7):100553. | Asia; Korea; hypersensitivity; HSR; medical products,' monoclonal antibody; mAb; cetuximab |
| Park Y, Kim D, Boorgula GD, De Schutter K, Smagghe G, Šimo L, Archer-Hartmann SA, Azadi P. | 2020 | Alpha-gal and cross-reactive carbohydrate determinants in the N-glycans of salivary glands in the lone star tick, Amblyomma americanum. Ticks are important ectoparasites and vectors of numerous human and animal pathogens. Ticks secrete saliva that contains various bioactive materials to evade the host defense system, and often facilitates the pathogen transmission. In addition, the Lone star tick saliva is thought to be the sensitizer in red meat allergy that is characterized by an allergic reaction to glycan moieties carrying terminal galactose-alpha-1,3-galactose (aGal). To assess N-glycome of Amblyomma americanum, we examined the N-glycan structures in male and female salivary glands at three different feeding stages and in carcasses of partially fed lone star ticks. We also surveyed the genes involved in the N-glycosylation in the tick species. The aGal epitopes and cross-reactive carbohydrate determinants (CCD) increases over time after the onset of blood feeding in both male and female A. americanum. These CCDs include xylosylation of the core mannose, 1,3-mono and 1,3- and 1,6-difucosylations of the basal GlcNac and mono- or diantennary aGal. Combinations of both xylosylation and aGal and fucosylation and aGal were also found on the N-glycan structures. While the enzymes required for the early steps of the N-glycosylation pathway are quite conserved, the enzymes involved in the later stages of N-glycan maturation in the Golgi apparatus are highly diverged from those of insects. Most of all, we propose that the aGal serves as a molecular mimicry of bioactive proteins during tick feedings on mammalian hosts, while it contributes as a sensitizer of allergy in atypical host human. |
Vaccines. 2020 Mar;8(1):18. | |
| Patel C, Iweala OI. | 2020 | ‘Doc, will I ever eat steak again?’: diagnosis and management of alpha-gal syndrome. Purpose of review: Alpha-gal syndrome encompasses a constellation of symptoms associated with immune-mediated hypersensitivity responses to galactose-alpha-1,3-galactose (alpha-gal). The purpose of this review is to discuss our current understanding of the etiology, clinical symptoms, natural history, epidemiology, and management of alpha-gal syndrome. Recent findings: Sensitization to alpha-gal is associated with bites from ectoparasites like the lone star tick Amblyomma americanum. Allergic reactions in alpha-gal syndrome are often delayed and inconsistent. The magnitude of the allergic response depends on co-factors like exercise and alcohol consumption and the amount of alpha-gal and fat present in the food. Assaying alpha-gal-specific IgE in the serum is the primary diagnostic test used to confirm the allergy. Long-term management of the condition involves avoidance of both mammalian food products and tick bites. Summary: Alpha-gal syndrome disrupts the current paradigm for understanding food allergy. Exposure to an ectoparasite is critical for the development of specific IgE antibodies underlying sensitization, and allergic reactions depend on the activation of mast cells and basophils sensitized with IgE against a carbohydrate rather than a protein. Research in this field may lead to the development of improved diagnostic and therapeutic tools that can revolutionize the management of patients with alpha-gal syndrome. |
Current Opinion in Pediatrics. 2020 Sep 29. | Pediatric; children; 34,000 diagnosed |
| Patel J, Wilson J. | 2020 | M310 ALPHA GAL SYNDROME MANIFESTING AS ISOLATED GASTROINTESTINAL SYMPTOMS IN A MARRIED COUPLE Introduction: IgE to galactose-α-1,3-galactose (α-gal) is implicated in a syndrome of mammalian meat allergy. Hives and anaphylaxis are classic manifestations of the α-gal syndrome (AGS), but gastrointestinal (GI) symptoms are also common. Increasingly we recognize patients with isolated GI symptoms, but to date this has been little described in the literature. Case Description: A 53 year old female and a 59 year old male who historically tolerated mammalian meat presented to the Allergy clinic with complaints delayed abdominal pain after ingestion of mammalian meat that started in May 2020. In both patients the symptoms first manifested with severe abdominal pain 2-4 hours after eating sausage ziti. Subsequently, both had similar reactions to bacon and cheeseburger. On a diet avoiding mammalian meat there were no recurrent events, except the wife reported abdominal pain after accidental ingestion of pork. Skin prick testing to beef, but not chicken, was positive for both patients. A serum IgE to α-gal was 39.80 kU/L and 37.80 kU/L in the husband and the wife, respectively. On focused history both patients denied any hives, rash, itch, shortness of breath or anaphylaxis that accompanied their episodes. Of note, both patients had a history of multiple tick bites, including itchy bites this past Spring. Discussion: This case is illustrative of our experience that there are patients with IgE to α-gal who develop isolated GI symptoms to mammalian meat. Such cases of “GI variant” AGS may be common in certain populations where lone star ticks are endemic. |
Annals of Allergy, Asthma & Immunology. 2020 Nov 1;125(5):S99-100. | Gastroenterology; gastrointestinal; GI variant; abdominal pain |
| Patel R, Jaglan A, Aguileraserna C, Pandya K, Goldstein L, Serna CA. | 2024 | Unraveling Alpha-Gal Syndrome: A Case Study of a Rare Meat Allergy. |
Cureus. 2024 Jul 26;16(7). | Ohio |
| Pattanaik D, Lieberman P, Lieberman J, Pongdee T, Keene AT. | 2018 | **The changing face of anaphylaxis in adults and adolescents. Background: Our institution has published serial studies of adults and adolescents with anaphylactic events. The first series was published in 1993 and the last was published in 2006. It was our perception that the nature of anaphylactic episodes had changed over the 2 decades since the last review. Objective: To determine whether the etiologies and presentations of anaphylaxis have changed during the past decade in our population. Methods: Patient charts were identified based on International Classification of Diseases, Ninth Revision codes for anaphylactic shock. Charts identified were analyzed for clinical symptoms reported, co-morbidities, etiology, investigative testing, and subsequent treatment. These cases were categorized as definitive, probable, or idiopathic based on history and results from testing, similar to our prior reports. Results: We identified 281 possible cases, of which 218 met criteria for anaphylaxis. Of these cases, median age was 42 years (range 9–78) and 64% were female. In the review of cases, 85 (39%) were determined to have a definitive etiology, 57 were determined to have a probable etiology (26%), and 76 (35%) were idiopathic. Interestingly, of those with a definitive cause, the most common etiology identified was galactose-α-1,3-galactose, accounting for 28 cases (33%). Foods were the second leading cause, accounting for 24 cases (28%). Conclusion: In this follow-up report on anaphylaxis etiology from a single center, the most common etiology was galactose-α-1,3-galactose. This differs greatly from prior reports from our center. Interestingly, the percentage of cases attributed to idiopathic anaphylaxis decreased from 59% in our previous report to 35% in the present report, which could largely be explained by the number of galactose-α-1,3-galactose cases. |
Annals of Allergy, Asthma & Immunology. 2018 Nov 1;121(5):594-7. | |
| Pattarabanjird T, Wilson JM, Erickson LD, Workman LJ, Qiao H, Ghosheh Y, Gulati R, Durant C, Vallejo J, Saigusa R, Platts-Mills TA. | 2021 | Chemokine receptor activation enhances memory B cell class switching linked to IgE sensitization to alpha gal and cardiovascular disease. Background: Recent studies have suggested that IgE sensitization to α-gal is associated with coronary artery disease (CAD). However, the B cell subtype(s) responsible for production of IgE to α-gal and mechanisms mediating this production remain elusive. Methods: Single cell multi-omics sequencing, was utilized to phenotype B cells obtained from 60 subjects that had undergone coronary angiography in whom serum IgE was evaluated by ImmunoCAP. Bioinformatics approaches were used to identify B cell subtype(s) and transcriptomic signatures associated with α-gal sensitization. In vitro characterization of chemokine/chemokine receptor pairs on switched memory B cells associated with IgE to α-gal was performed. Results: Of the 60 patients, 17 (28%) were positive for IgE to α-gal. CITESeq identified CCR6+ class-switched memory (SWM) B cells and CXCR4 expresssion on these CCR6+ SWM B cells as significantly associated with IgE sensitization to α-gal but not to other common allergens (peanut or inhalants). In vitro studies of enriched human B cells revealed significantly greater IgE on SWM B cells with high CCR6 and CXCR4 expression 10 days after cells were treated with IL-4 and CD40 to stimulate class switch recombination. Both CCL20 (CCR6 ligand) and CXCL12 (ligand for CXCR4) increased the expression of IgE on SWM B cells expressing their receptors. However, they appeared to have unique pathways mediating this effect as only CCL20 increased activation-induced cytidine deaminase (AID), while CXCL12 drove proliferation of CXCR4+ SWM B cells. Lastly, correlation analysis indicated an association between CAD severity and the frequency of both CCR6+ SWM and CXCR4+ SWM B cells. Conclusions: CCR6+ SWM B cells were identified as potential producers of IgE to α-gal in CAD patients. Additionally, our findings highlighted non-chemotaxis roles of CCL20/CCR6 and CXCL12/CXCR4 signaling in mediating IgE class switching and cell proliferation of SWM B cells respectively. Results may have important implications for a better understanding and better therapeutic approaches for subjects with IgE sensitization to α-gal. |
Frontiers in Cardiovascular Medicine. 2022 Jan 13;8:791028. | coronary artery disease; cardiac; CAD; atherosclerosis; cardiovascular; cardiology |
| Paulk R, Bresch D, Jerath M, Commins S. | 2020 | Prevalence of Alpha-Gal Sensitization. Rationale: IgE antibodies to galactose-alpha-1,3-galactose (alpha-gal), a mammalian oligosaccharide, have been associated with delayed urticaria and anaphylaxis to the ingestion of mammalian meat. However, the prevalence of alpha-gal sensitization in asymptomatic individuals is unknown. We sought to determine this false positive rate.Methods: Eighty-six volunteers without a diagnosis of alpha-gal food allergy were consented from a university allergy practice in North Carolina. A questionnaire was used to elicit demographic, medical, dietary, and enviromental exposure history. Alpha-gal specific IgE and total IgE tests were run on their serum.Results: Of the 86 subjects, 24.4% (n=21) tested positive to alpha-gal IgE in the absence of a known diagnosis of alpha-gal food allergy. Seventy six percent of these 21 (n=16) were confirmed to be tolerating mammalian meat ingestion without adverse effects. The average age of alpha-gal sensitized subjects was 60 years old. They were predominately Caucasian with an equal gender distribution. All of the alpha-gal sensitized subjects had a recent history of tick bites and 86% (n=18) had concomitant atopic disease. The mean alpha-gal IgE level was 3.60 kU/L (range 0.35-15.30 kU/L) and total IgE was 371 kU/L (range 27.3-1124 kU/L).Conclusions: Alpha-gal sensitization occurs in asymptomatic patients, and in certain populations, prevalence of this sensitization is high. Since sensitization does not imply allergy, more research is needed to determine the positive and negative predictive value of alpha-gal IgE testing to guide its use in making the diagnosis of alpha-gal food allergy. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB142. | Prevalence |
| Pearce OM, Samraj AN, Läubli H, Varki NM, Varki A. | 2015 | Reply to Mackenzie: A comparison of Neu5Gc and α-gal xenoantigens. We appreciate the thoughtful comments of K. J. Mackenzie (1) regarding our findings, concerning how a red meat-derived glycan can promote inflammation and cancer progression (2). At first glance, there do indeed appear to be very close similarities between the nonhuman sialic acid N-glycolylneuraminic acid (Neu5Gc) antigen we are describing and the well-known nonhuman “α-Gal” antigen (Galα1-3Galβ1-3/4GlcNAcβ1-R), which is also present in red meat, and can account for allergic reactions to such foods (3). However, there are also significant differences (see table 1 in ref. 4) that make the metabolic details and outcomes of the respective immune responses dissimilar...Given these considerations, α-gal antibodies are more likely to be involved in allergic reactions or associated with rejection of xenografts, and probably not related to the chronic inflammation associated with malignancies. However, further studies are needed to be certain, and also to ask if there are other examples of in vivo conversion of dietary xeno-antigens into xeno-autoantigens, besides Neu5Gc. |
Proceedings of the National Academy of Sciences. 2015 Mar 24;112(12):E1405-. | glycan antibody; glycan antigen; sialic acid; Neu5Gc |
| Pedersen HS, Sørensen JA, Madsen F, Linneberg A, Leth‐Møller KB, Vestergaard C, Thomsen SF. | 2022 | Prevalence, predictors, and clinical relevance of α‐gal sensitization in patients with chronic urticaria. Background: Little is known about α‐gal (galactose‐α‐1,3‐galactose) sensitization in patients with chronic urticaria (CU). The aim of this study was to examine the prevalence, predictors and clinical relevance of α‐gal sensitization in patients with CU. Methods: Two consecutive cohorts of newly referred patients with CU from a primary care allergology practice and a tertiary hospital dermatology department, plus a control group with allergic disease, but not CU, from the allergology practice, were interviewed and screened for α‐gal sensitization (serum specific‐IgE ≥0.35 KU/L). Results: Of 733 patients included, 21 (5.6%) and 11 (3.9%) of CU patients from private practice and hospital, respectively, were α‐gal sensitized. In total, 8 patients (38.1% of sensitized patients, and 2.1% of all CU patients) from private practice, and 2 patients (18.2% of sensitized patients, and 0.7% of all CU patients) from hospital, had clinically relevant α‐gal allergy. In private practice, male sex (47.6 vs. 24.7%), p = 0.020, obesity (33.3 vs. 23.6%), p = 0.302, and frequency of angioedema (61.9 vs. 51.4%), p = 0.350; and in hospital, male sex (72.7 vs. 27.9%), p = 0.003, and high total immunoglobulin E (median 168 vs. 70.5 KU/L), p = 0.022 were associated with α‐gal sensitization. Conclusion: α‐gal sensitization is observed in a small fraction of CU patients with only few patients experiencing clinically relevant sensitization. Certain patients, particularly from primary care, may constitute a relevant population for aimed testing. |
NEJM Evidence. 2022 Oct 25;1(11):EVIDmr2200210. | Chronic urticaria; diagnosis |
| Pek, C.H., Cheong, C.S.J., Yap, Y.L., Doggett, S., Lim, T.C., Ong, W.C. and Lim, J. | 2016 | Rare Cause of Facial Palsy: Case Report of Tick Paralysis by Ixodes Holocyclus Imported by a Patient Traveling into Singapore from Australia. Background: Ticks are blood-sucking arachnids that feed on all classes of vertebrates, including humans. Ixodes holocyclus, also known as the Australian Paralysis Tick, is capable of causing a myriad of clinical issues in humans and companion animals, including the transmission of infectious agents, toxin-mediated paralysis, allergic and inflammatory reactions, and mammalian meat allergies in humans. The Australian Paralysis Tick is endemic to Australia, and only two other exported cases have been reported in the literature. Case Report We report the third exported case of tick paralysis caused by I. holocyclus, which was imported on a patient into Singapore. We also discuss the clinical course of the patient, the salient points of management, and the proper removal of this tick species. Why Should An Emergency Physician Be Aware of This? With increasing air travel, emergency physicians need to be aware of and to identify imported cases of tick paralysis to institute proper management and advice to the patient. We also describe the tick identification features and proper method of removal of this tick species. |
The Journal of emergency medicine. 2016 Nov 1;51(5):e109-14. | |
| Pelletier T, Alvarez-Arango S, Sameeta FN, Manos E, Jerschow E. | 2018 | Meat reintroduction in a patient with alpha-gal allergy. … The patient also recalled a tick bite in New York State 1 year before these episodes, with a local reaction including erythema and pruritus lasting 6 months. Therefore, specific serum galactose-α-1,3-galactose (α-gal) immunoglobulin E (sIgE) was checked and found to be elevated to 46 kU/L. Total serum IgE was 264 IU/mL (Fig 1). The patient was diagnosed with α-gal allergy and advised to abstain from red meat. … On 3-year follow-up, she had avoided red meat and had not experienced any additional reactions. She had continued ingesting other animal products, including dairy. The patient wished to reintroduce meat into her diet. Repeat α-gal testing was 3.5 kU/L, total IgE 60.8 IU/mL, and beef IgE 0.30 kU/L. She underwent an oral challenge with red meat; she was given a cumulative amount of 220 g prosciutto (70 g, then 150 g after 2 hours) and observed for a total of 5.5 hours. She remained asymptomatic. The patient began ingesting modest amounts of meat regularly without reaction. On follow-up 8 months later, α-gal decreased to 1.6 kU/L, total IgE to 49 IU/L, and beef IgE to 0.2 kU/L. . One year after reintroduction, she presented after 1 episode of burning sensation of palms and feet after eating beef. This occurred after a week of increased exercise and sun exposure. She denied additional tick bites. Alpha-gal increased to 3.14 kU/L. Patient self-resumed red meat consumption and has not had any additional reactions. Alpha-gal again decreased to 1.47 kU/L 5 months after this episode. We believe that this is the first reported case of successful, unrestricted reintroduction of red meat for a patient with α-gal allergy. |
Annals of Allergy, Asthma & Immunology. 2018 Jul 1;121(1):123-4. | Reintroduction of red meat |
| Peralta T, Roizen G, Crisóstomo N, Aguilera-Insunza R. | 2023 | What is New in Alpha-Gal Syndrome?. |
Current Treatment Options in Allergy. 2023 Nov 22:1-4. | Review; Latin America; Chile |
| Perota A, Lagutina I, Duchi R, Zanfrini E, Lazzari G, Judor JP, Conchon S, Bach JM, Bottio T, Gerosa G, Costa C. | 2019 | Generation of cattle knockout for galactose-a1,3-galactose and N-glycolylneuraminic acid antigens. Two well-characterized carbohydrate epitopes are absent in humans but present in other mammals. These are galactose-α1,3-galactose (αGal) and N-glycolylneuraminic acid (Neu5Gc) which are introduced by the activities of two enzymes including α(1,3) galactosyltransferase (encoded by the GGTA1 gene) and CMP-Neu5Gc hydroxylase (encoded by the CMAH gene) that are inactive in humans but present in cattle. Hence, bovine-derived products are antigenic in humans who receive bioprosthetic heart valves (BHVs) or those that suffer from red meat syndrome. Using programmable nucleases, we disrupted (knockout, KO) GGTA1 and CMAH genes encoding for the enzymes that catalyse the synthesis of αGal and Neu5Gc, respectively, in both male and female bovine fibroblasts. The KO in clonally selected fibroblasts was detected by polymerase chain reaction (PCR) and confirmed by Sanger sequencing. Selected fibroblasts colonies were used for somatic cell nuclear transfer (SCNT) to produce cloned embryos that were implanted in surrogate recipient heifers. Fifty-three embryos were implanted in 33 recipients’ heifers; 3 pregnancies were carried to term and delivered 3 live calves. Primary cell cultures were established from the 3 calves and following molecular analyses confirmed the genetic deletions. FACS analysis showed the double-KO phenotype for both antigens confirming the mutated genotypes. Availability of such cattle double-KO model lacking both αGal and Neu5Gc offers a unique opportunity to study the functionality of BHV manufactured with tissues of potentially lower immunogenicity, as well as a possible new clinical approach to help patients with red meat allergy syndrome due to the presence of these xenoantigens in the diet. |
Xenotransplantation. 2019 Sep;26(5):e12524. | |
| Perusko M, Apostolovic D, Kiewiet MG, Grundström J, Hamsten C, Starkhammar M, Cirkovic Velickovic T, van Hage M | 2021 | Bovine γ‐globulin, lactoferrin and lactoperoxidase are relevant bovine milk allergens in patients with α‐Gal syndrome. Background: Mammalian meat is the most common trigger of the allergic reactions in patients with α-Gal syndrome (AGS). Milk and dairy, although less often, also cause a significant number of allergic manifestations. The aim of this study was to identify α-Gal-containing bovine milk proteins with allergenic properties among AGS patients. Methods: Thirty-eight AGS patients with IgE to milk were included in the study. Milk proteins were analyzed for the presence of α-Gal and for binding by patients’ IgE using immunoblot, ImmunoCAP, and inhibition ELISA. Allergenicity of milk and milk proteins was assessed by basophil activation test. Results: More than half of the AGS patients reported allergic reactions to milk or dairy products. Bovine γ-globulin (BGG), lactoferrin (LF), and lactoperoxidase (LPO) were identified as α-Gal carrying proteins which were recognized by AGS patients’ IgE. Whey mirrored the anti-α-Gal and IgE reactivity of BGG, LF, and LPO. Eighty-nine percent of the patients displayed IgE to BGG, 91% to LF, and 57% to LPO. Inhibition of α-Gal-specific IgE binding was achieved by BGG, LF, LPO, and whey. These proteins also activated AGS patients’ basophils. Interestingly, at lower concentrations, LF was the most potent inhibitor of IgE binding, and the most potent activator of basophils. Conclusion: BGG, LF, and LPO were all found to be relevant milk α-Gal-containing glycoproteins that bound AGS patients’ IgE antibodies and activated their basophils. |
Allergy. 2021 May 3. | Milk; dairy; Europe; Sweden; whey; lactoferrin; lactoperoxidase; BGG; bovine gammaglobulin |
| Peruško M, Apostolović D, Starkhammar M, Ćirković-Veličković T, van Hage M. | 2019 | Novel insights into the allergenic relationship between red meat and bovine milk. Background: Red meat allergy is a severe form of food allergy with delayed symptoms including anaphylaxis where the IgE antibodies are directed against a carbohydrate epitope, galactose-α-1,3-galactose (α-Gal). Many red meat allergic patients report allergic symptoms upon consumption of milk or dairy products. The aim of the project was to investigate the allergenic relationship between bovine milk and red meat at a molecular level. Methods: Adults with diagnosed red meat allergy (n = 27) were recruited and their specific IgE levels to α-Gal, beef and milk were analyzed by ImmunoCAP. Milk proteins were assayed by immunoblot and inhibition ELISA for the presence of the α-Gal epitope and for the binding to red meat allergic patients’ IgE. The involvement of the carbohydrate epitope in the IgE binding to milk proteins was assessed by an inhibition assay with thyroglobulin. Basophil activation test was performed with milk and milk proteins in samples from 11 red meat allergic patients and 2 controls. Results: All patients were IgE positive to milk, but the IgE levels to milk were lower than those to α-Gal or beef. Significant correlations between IgE levels to milk and α-Gal (rs=0.64, P < 0.01), as well as between milk and beef (rs=0.90, P < 0.01) were observed. Immunoblot analysis of milk proteins revealed bovine γ-globulin (BGG) as α-Gal carrier. Other milk proteins, α-lactalbumin, β-lactoglobulin, α-casein, β-casein and κ-casein were negative for the presence of α-Gal epitope. BGG was also shown to bind IgE antibodies of red meat allergic patients. Inhibition immunoblot with thyroglobulin resulted in the loss of IgE binding to BGG. Additionally, ELISA experiments showed that BGG, as well as whey proteins exert a dose-dependent inhibition of red meat allergic patients’ IgE binding to α-Gal. Inhibition with raw milk and commercially available milk preparations showed that raw milk exerted a slightly higher inhibition of the IgE binding to the α-Gal epitope than the commercially available milks. Importantly, activation of red meat allergic patient’s basophils by BGG and milk was demonstrated. Conclusion: BGG was identified as a major milk carrier of the α-Gal epitope that bound IgE antibodies and furthermore activated basophils of red meat allergic patients. This study highlights the importance of milk as allergenic food source among the meat allergic population. |
Allergy. 2019; 74: 596-596. | Nutrition; diet; dairy; mammalian byproducts; dairy byproducts; milk; BGG; bovine gamma-globulin; lactalbumin; lactoglobulin; casein; Europe; Sweden; |
| Perusko M, Grundström J, Eldh M, Hamsten C, Apostolovic D, van Hage M. | 2024 | The α-Gal epitope-the cause of a global allergic disease. |
Frontiers in Immunology. 2024 Jan 22;15:1335911. | Review article; Europe; Sweden; Serbia |
| Perusko M, Grundström J, Eldh M, Reinhardt A, Fuhrmann V, Düzakin M, Hamsten C, Starkhammar M, Apostolovic D, van Hage M. | 2024 | Allergenic potency of various foods of mammalian origin in patients with α‐gal syndrome. |
Allergy. 2024. | Quantification; potency; threshold |
| Peters C, Jarlot S, Pirson F. | 2016 | † Anaphylaxie peranesthésique à la gélatine associée à une allergie alimentaire à l’alpha-gal./Peranaesthetic anaphylaxis due to gelatine associated with food allergy to alpha-gal. Summary: Recently, galactose-α-1,3-galactose, also known as alpha-gal, an oligosaccharide found in all mammals except primates, has been identified as an allergen responsible of immediate anaphylaxis during cetuximab perfusion or late-onset anaphylaxis after consumption of mammal meat. Some subjects with mammal meat allergy also present gelatin sensitization. We describe the observation of a patient with an allergy to mammal kidneys due to an IgE-mediated alpha-gal allergy and an anaphylactic reaction to gelatin-based plasma substitute (Geloplasma®). |
Anesthésie & Réanimation. 2016 Mar 1;2(2):123-5. | gelatin, gelatine, volume expander, plasma substitute, plasma expander |
| Peterson CJ, Mohankumar P, Tarbox JA, Nugent K. | 2024 | Alpha-Gal Syndrome: A Review for the General Internist. |
The American Journal of the Medical Sciences. 2024 Nov 28. | primary care provider; internal medicine; internist |
| Peterson H, Wells DA, Marjoncu D, Holman K. | 2023 | Use of antithymocyte globulin (rabbit) in a patient with known alpha-gal syndrome undergoing allogenic stem cell transplantation. Introduction: Alpha-gal syndrome (AGS) is a hypersensitivity disorder in which tick bites-most commonly from the lone star tick (Ambylomma americanum)-trigger immunoglobulin E-mediated hypersensitivity reaction upon exposure to oligosaccharide galactosse-alpha-1,3-galactose (α-gal). α-gal is most notorious for being found in "red meat" products but is present in mammalian meats such as beef, pork, lamb, rabbit, and others. Manifestations of AGS hypersensitivity are variable. There is currently no in vivo data describing allergic reactions against rabbit products in patients with AGS. Case report: Here, we describe a case of a 44-year-old male with myelodysplastic syndrome and a known history of AGS undergoing allogeneic hematopoietic cell transplantation (allo-HSCT) with the use of rabbit antithymocyte globulin (rATG) for graft-versus-host disease (GVHD) prophylaxis. Management and outcome: The risk of cross-reactivity against rATG in our patient with AGS could not be ruled out and, therefore, a test dose was administered. The patient tolerated the test dose with no signs of anaphylaxis. After demonstrating tolerance to the test dose, rATG was utilized for GVHD prophylaxis. Discussion: Due to the heterogeneity of AGS manifestations in patients, the use of rATG in patients with known AGS should be considered on a case-by-case basis. The administration of a test dose may help predict the occurrence of severe hypersensitivity reactions. The limited data surrounding the risk of AGS with rabbit-containing products and the various indications for the use of rATG warrants more in-depth study of the reactivity of this medication in this population. |
Journal of Oncology Pharmacy Practice. 2023 Nov 7:10781552231212648. | oncology; rabbit; pharmacy; pharmaceutical; medical products; antithymocyte globulin |
| Petralia LM, van Diepen A, Lokker LA, Nguyen DL, Sartono E, Khatri V, Kalyanasundaram R, Taron CH, Foster JM, Hokke CH. | 2022 | Mass spectrometric and glycan microarray-based characterization of the filarial nematode Brugia malayi glycome reveals anionic and zwitterionic glycan antigens. Hundreds of million people worldwide are infected with filarial nematodes, responsible for lymphatic filariasis (LF) and other diseases causing chronic disablement. Elimination programs have resulted in a substantial reduction of the rate of infection in certain areas creating a need for sensitive and reliable diagnostic tools to establish robust population surveillance, avoid LF resurgence and meet the World Health Organization (WHO) objectives for 2030. Glycans from parasitic helminths are emerging as potential antigens for use in diagnostic serological assays. However, despite its crucial role in host-parasite interactions, filarial glycosylation is still largely structurally and functionally uncharacterized. Therefore, we investigated the glycan repertoire of the filarial nematode Brugia malayi (B. malayi) to identify putative species-specific elements. Glycosphingolipid (GSL) and N-linked glycans were extracted from several life-stages using enzymatic release, and characterized using a combination of MALDI-TOF-MS and glycan sequencing techniques. In addition, HPLC-purified GSL and N-glycans were printed onto microarrays to assess the host anti-glycan antibody response during infection. Comprehensive glycomic analysis of B. malayi revealed the presence of several putative antigenic motifs such as phosphorylcholine, widespread in filarial nematodes, and terminal glucuronic acid-containing glycans. Glycan microarray screening showed a recognition of most B. malayi glycans by immunoglobulins from rhesus macaques at different time points after infection with B. malayi which permitted the characterization of the dynamics of anti-glycan immunoglobulin (Ig) G and M responses during establishment of brugian filariasis. A significant level of IgG binding to the parasite glycans was also detected in infected human plasma, while IgG binding to glycans decreased after anthelmintic treatment of these individuals. Altogether, our work identifies B. malayi N-linked and GSL-glycan antigens and reveals antibody responses from the host that could be exploited as potential markers for LF. |
Molecular & Cellular Proteomics. 2022 Jan 20:100201. | Cross-reactive antigens |
| Pfutzner W, Brockow K. | 2018 | † Perioperative drug reactions - practical recommendations for allergy testing and patient management. Background: Allergy testing for perioperative drug reactions poses a particular diagnostic challenge. Neuromuscular blocking agents (NMBA) and antibiotics are among the most common triggers. In principle, however, any drug administered perioperatively is capable of causing a hypersensitivity reaction. Methods: This article is an overview of selected scientific articles and is based on research in PubMed, specialist databases, and guidelines. Results: Besides patient’s history and laboratory tests (the latter being feasible to only a limited extent), skin tests play a particularly important role. To obtain clinical relevant results, profound knowledge on the best point in time for testing, the drug concentrations to be used, how to perform tests correctly, and the assessment criteria is of special importance. Conclusion: Final outcomes of the diagnostic procedures should be providing thorough information of the patient about the findings, drugs that should be avoided in the future as well as alternative preparations, and, if necessary, preventive measures to be taken in the event of further surgical interventions. |
Allergo journal international. 2018 Jun 1;27(4):126-9. | review article; perioperative care; medication; drug; pharmaceutical; pharmacy; pharmacist; |
| Piedmonte NP, Vinci VC, Daniels TJ, Backenson BP, Falco RC. | 2020 | Seasonal Activity of Haemaphysalis longicornis (Acari: Ixodidae) in Southern New York State. The Asian longhorned tick, Haemaphysalis longicornis Neumann, is a species native to eastern Asia that has recently been discovered in the United States. In its native range, H. longicornis transmits pathogens that cause disease in humans and livestock. It is currently unknown whether H. longicornis will act as a vector in the United States. Understanding its seasonal activity patterns will be important in identifying which times of the year represent greatest potential risk to humans and livestock should this species become a threat to animal or public health. A study site was established in Yonkers, NY near the residence associated with the first reported human bite from H. longicornis in the United States. Ticks were collected once each week from July 2018 to November 2019. Haemaphysalis longicornis larvae were most active from August to November, nymphs from April to July, and adult females from June to September. This pattern of activity suggests that H. longicornis is capable of completing a generation within a single year and matches the patterns observed in its other ranges in the northern hemisphere. The data presented here contribute to a growing database for H. longicornis phenology in the northeastern United States. Potential implications of the short life cycle for the tick’s vectorial capacity are discussed. |
Journal of Medical Entomology. 2020 Oct 14. | Vector; tick; Haemaphysalis longicornis |
| Pinion AK, Gierer SA. | 2015 | A Novel Description of Polyarthralgia with Alpha-Gal Allergy. RATIONALE: Southern tick-associated rash illness (STARI) is a disease characterized by erythema migrans and flu-like symptoms that is temporally associated with a bite from Amblyomma americanum (Lone Star tick). Preliminary polymerase chain reaction studies have suggested that STARI is caused by Borrelia lonestari, a spirochete closely related to Borrelia burgdorferi. Delayed anaphylaxis to red meat with an elevated serum IgE to galactose-alpha-1,3-galactose occurring with STARI has not been reported. METHODS: IgE to Galactose-Alpha-1,3-Galactose was performed at ViraCor-IBT Laboratories Incorporated. . RESULTS: Patient is a 38 year old male with recurrent episodes of anaphylaxis manifested by urticaria, angioedema, shortness of breath, wheezing, diarrhea and hypotension. Episodes occurred 6-8 hours after ingesting red meat. IgE to alpha-gal was elevated at 12.10kU/L. He complained of a rash, polyarthralgia, and fatigue with a recent tick bite. Given his clinical presentation, the fact that Lyme Disease is uncommon in this area, and his elevated IgE to alpha-gal, the patient was suspected of having STARI caused by a bite from the Lone Star tick. He was empirically treated with doxycycline 100mg by mouth twice daily for 10 days and had complete resolution of polyarthralgia and fatigue. He avoided red meat and had no further episodes of anaphylaxis. . CONCLUSIONS: We believe this is the first reported case of STARI in a patient with delayed anaphylaxis to red meat as a result of a Lone Star tick bite. Clinicians should be aware of STARI as a potential diagnosis in patients with alpha-gal allergy who have concurrent flu-like symptoms, polyarthralgia, and a characteristic rash. |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB253. | arthritis; rheumatology; polyarthralgia |
| Pino GB, Piazza A, Schultz M, Matern D, Hall PL. | 2024 | Incorrect laboratory test selection is common in the evaluation of alpha-gal syndrome and Fabry disease |
J Allergy Clin Immunol Pract. 2023;11(10):3263-3264. | diagnosis; testing; testing error; Fabry; α-galactosidase; alpha-galactosidase |
| Pinson ML, Waibel KH. | 2015 | Safe administration of a gelatin-containing vaccine in an adult with galactose-a-1,3-galactose allergy. Immunoglobulin (Ig) E antibodies to galactose-α-1,3-galactose (α-Gal) are associated with delayed anaphylaxis to mammalian food products and gelatin-based foods (Commins et al., J Allergy Clin Immunol 2009;123:426; Caponetto et al., J Allergy Clin Immunol Pract 2013;1:302). We describe a patient with α-Gal allergy who successfully tolerated the live zoster vaccine and we review anaphylactic reactions reported to this vaccine. Our patient, who tolerated a vaccine containing the highest gelatin content, is reassuring but continued safety assessment of gelatin-containing vaccines for this patient cohort is recommended as there are multiple factors for this patient cohort that influence the reaction risk. |
Vaccine. 2015 Mar 3;33(10):1231-2. | |
| Pipperger L, Koske I, Wild N, Müllauer B, Krenn D, Stoiber H, Wollmann G, Kimpel J, von Laer D, Bánki Z. | 2019 | Xenoantigen-dependent complement-mediated neutralization of lymphocytic choriomeningitis virus glycoprotein-pseudotyped vesicular stomatitis virus in human serum. Neutralization by antibodies and complement limits the effective dose and thus the therapeutic efficacy of oncolytic viruses after systemic application. We and others previously showed that pseudotyping of oncolytic rhabdoviruses such as maraba virus and vesicular stomatitis virus (VSV) with the lymphocytic choriomeningitis virus glycoprotein (LCMV-GP) results in only a weak induction of neutralizing antibodies. Moreover, LCMV-GP-pseudotyped VSV (VSV-GP) was significantly more stable in normal human serum (NHS) than VSV. Here, we demonstrate that depending on the cell line used for virus production, VSV-GP showed different complement sensitivities in nonimmune NHS. The NHS-mediated titer reduction of VSV-GP was dependent on activation of the classical complement pathway, mainly by natural IgM antibodies against xenoantigens such as galactose-α-(1,3)-galactose (α-Gal) or N-glycolylneuraminic acid (Neu5Gc) expressed on nonhuman production cell lines. VSV-GP produced on human cell lines was stable in NHS. However, VSV-GP generated in transduced human cells expressing α-Gal became sensitive to NHS. Furthermore, GP-specific antibodies induced complement-mediated neutralization of VSV-GP independently of the producer cell line, suggesting that complement regulatory proteins potentially acquired by the virus during the budding process are not sufficient to rescue the virus from antibody-dependent complement-mediated lysis. Thus, our study points to the importance of a careful selection of cell lines for viral vector production for clinical use. |
Journal of Virology. 2019 Jun 26:JVI-00567. | |
| Pisazka V, Duscher G, Hodžić A, Reider N, Allerberger F. | 2019 | Alpha-gal allergy after a tick bite in Austria. Tick bites can cause the alpha-gal syndrome, which is characterized by delayed anaphylactic reactions mainly to red meat and offal due to IgE antibodies against mammalian galactose-alpha-1.3-galactose carbohydrate (alpha-gal). Ixodes ricinus bites are considered the primary cause of IgE antibody responses specific for alpha-gal in Europe. This article reports on a 51-year-old Austrian male who acquired a tick bite in Austria in spring 2017, which, within 48h, resulted in prolonged inflammation of the skin area around the bite. The patient experienced an allergic reaction 3 months later approximately 8h after eating a medium rare steak for dinner. The symptoms included an itchy rash on both sides of the torso and on both arms which persisted for several hours. In spring 2018, the patient suffered another tick bite. The patient's skin reaction was similar to that of the previous year. In the following months, the patient experienced five episodes of severe allergic reactions, each during the night after having eaten beef for dinner. The symptoms included pruritic urticarial rash involving the entire body along with swollen hands, diarrhea, vomiting and in some episodes even shortness of breath. At the request of the patient, specific IgE antibodies against alpha-gal were determined, revealing a highly positive result (>100kU/l). This brief report aims to raise awareness that recurrent delayed anaphylactic reactions to food can develop after tick bites. |
Wiener klinische Wochenschrift. 2019 Aug 1;131(15-16):385-8. | Europe; Austria |
| Pita J, Ciobanu A, Loureiro C, Todo-Bom A. | 2018 | Alergia a galactose-α-1, 3-galactose The aim of this article is to review allergy to galactose-α-1,3-galactose. The authors performed a search in Pubmed and selected 24 articles in the last 5 years. Galactose-alpha-1,3-galactose (α-gal) is an oligosaccharide present in mammals, except in humans and higher primates. α-gal hypersensitivity differs from other IgE-mediated reactions, particularly on the late-onset of symptoms and is characterized by the association between a confirmed episode of tick bite and the posterior development of urticaria, anaphylaxis or gastrointestinal symptoms, two to six hours after red meat ingestion. Reactions to cetuximab, a monoclonal antibody against EGFR (epidermal growth factor receptor) occur immediately after the first administration, due to the presence of the epitope α-gal. Skin prick tests utility is limited, as they are not highly specific, and dosing the serum specific IgE to α-gal is an essential analysis for diagnosis and monitoring of the disease. |
Revista Portuguesa de Imunoalergologia. 2018 Mar;26(1):11-9. | review article |
| Pitsios C, Dimitriou A, Vassilopoulou E. | 2021 | Speculations on red meat allergy due to α-Gal; its connection to coronary artery disease, suggested dietary guidance and allergy testing. |
EUR ANN ALLERGY CLIN IMMUNOL. 2021 Jul;53(4):193-5. | Greece; Cyprus; coronary artery disease |
| Platt J, Merritt T. | 2022 | Exploratory Survey Research Study of 2,000 Alpha-gal Syndrome Patients: Symptoms and Experiences in the United States Alpha-gal Syndrome (AGS),“Galactose-alpha-1, 3-Galactose allergy” is associated with a tick bite and is the first known carbohydrate-based allergy. While commonly recognized symptoms are gastrointestinal, integumentary, respiratory, and cardiovascular, scarce documentation exists of the extent and range of symptoms experienced by AGS patients. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB322. | survey; symptoms |
| Platts-Mills T, Jappe U, Hilger C, van Hage M, Gadermaier G, Spillner E, Lidholm J, Keshavarz B, Aalberse R, Van Ree R, Goodman R. | 2022 | Alpha-gal as the newest member of the glycan epitopes recognized in allergen nomenclature for cross-reactive carbohydrates. Rationale: The first publications on cross-reactive carbohydrate epitopes as targets of IgE antibodies to pollen protein appeared over 30 years ago, but in general they were not relevant to pollen symptoms. By contrast, the recently described IgE specific for alpha-gal which is cross reactive over many mammalian molecules, are causally related to two forms of anaphylaxis. Methods: Identification of protein allergens is based on the species of origin, assuming that each amino acid chain reflects a specific gene (www.allergen.org). By contrast, the blood group oligosaccharides including alpha-gal are produced by a sequence of enzymes in the endoplasmic reticulum and the golgi. The absence of alpha-gal in the primates reflects a de-functioning mutation in the gene for alpha 1, 3 galactosyl transferase, that occurred ∼20 million years ago. Results: The incorporation of glycan nomenclature into the IUIS allergen nomenclature database raised many problems, because of the contrast with protein epitopes. Oligosaccharide epitopes can be on lipids with an O-linkage, and this linkage is relevant to lipid particles entering the circulation as chylomicrons or LDL. The terminology used for describing oligosaccharides is complex, but most epitopes can be illustrated as stick diagram and are relatively small. Conclusions: The new addition to the IUIS/WHO database is jointly funded by AAAAI and EAACI, and includes both structures and evidence about the clinical relevance of the IgE antibodies. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB219. | Nomenclature |
| Platts-Mills T, Keshavarz B, La Russa J, Wilson J. | 2020 | Description of Fire Ant Anaphylaxis (FAA) Cases in the USA: Inverse Relationship to the α-Gal syndrome (AGS) in the Southeast. Rationale: During an investigation into the epidemiology of the AGS we found a regional “shortage” of cases in the deep south which was inconsistent with reports that lone star ticks (Amblyomma americanum), the dominant cause of IgE sensitization to α-Gal in the USA, were established in that area. We considered that the invasive fire ant, an established predator of lone star ticks, could explain this inconsistency. . Methods: We conducted a survey of allergy clinics, studying an area within and north of the USDA fire ant quarantine. The presence of FAA and AGS cases were plotted on maps showing county-level fire ant quarantine data from 1931 to 2018, as well as the CDC-reported distribution of lone star ticks. . Results: Data on cases of FAA and AGS was obtained from 87 clinics. Large numbers of FAA cases (≥20) were reported by most of the clinics within the area quarantined prior to 1974; in areas that were quarantined between 1974 and 2018 the results were variable and very few cases were reported in clinics outside the FA quarantine area. Importantly, within the reported range of the lone star ticks there was a strong inverse correlation between cases of FAA and cases of AGS (P<0.001). . Conclusions: Fire ants are an important regional cause of anaphylaxis in the USA. The low number of cases of AGS along the Gulf of Mexico and in Texas correlates strongly with the presence of FAA, a finding which may best be explained by the well-established ability of fire ants to eradicate ticks. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB76. | |
| Platts-Mills T. | 2022 | EDITORIAL COMMENTARY: Sensitisation of Forest workers to the oligosaccharide galactose alpha-1,3-galactose (alpha-gal) is strongly associated with tick bites but not withevidence of tick borne infections. |
Infectious Diseases. 2022 Apr 5:1-3. | |
| Platts-Mills TA, Commins SP, Biedermann T, van Hage M, Levin M, Beck LA, Diuk-Wasser M, Jappe U, Apostolovic D, Minnicozzi M, Plaut M. | 2020 | §** On the cause and consequences of IgE to galactose-α-1,3-galactose: A report from the National Institute of Allergy and Infectious Diseases Workshop on Understanding IgE-Mediated Mammalian Meat Allergy The mammalian meat allergy known as the “α-Gal syndrome” relates to IgE specific for galactose-α-1,3-galactose (α-Gal), an oligosaccharide that is present in cells and tissues of nonprimate mammals. The recognition of delayed reactions to food derived from mammals in patients with IgE to α-Gal and also the association with tick bites have been increasing worldwide. In 2018, the National Institute of Allergy and Infectious Diseases, Division of Allergy, Immunology and Transplantation, sponsored a workshop on this emerging tick-related disease. International experts from the fields of tick biology, allergy, immunology, infectious disease, and dermatology discussed the current state of our understanding of this emerging medical condition. The participants provided suggestions for specific research priorities and for the development of resources to advance our knowledge of the mechanisms, diagnosis, management, and prevention of this allergic disease. This publication is a summary of the workshop and the panel’s recommendations are presented herein. |
Journal of Allergy and Clinical Immunology. 2020 Feb 10. | NIAID workshop; review |
| Platts-Mills TA, Li RC, Keshavarz B, Smith AR, Wilson JM. | 2019 | **‡ Diagnosis and management of patients with the alpha-Gal syndrome. The alpha-Gal syndrome has many novel features that are relevant to diagnosis and management. In most cases the diagnosis can be made on a history of delayed allergic reactions to red meat and the blood test for IgE to the oligosaccharide galactose-alpha-1,3-galactose (alpha-Gal). In general, the diagnosis also dictates the primary treatment, i.e. - avoiding mammalian meat and also dairy in some cases. In the USA the lone star tick is the primary cause of this disease but different ticks are responsible in other countries. Blood levels of IgE to alpha-Gal often drop in patients who avoid recurrent tick bites, but the rate of decline is variable. Similarly, the delay before reactions is variable and the severity of the allergic reactions is not predicted by the delay or the titer of specific IgE. Some mammalian-derived products are only relevant to select patient groups, such as heart valves, gelatin-based plasma expanders, and pancreatic enzymes. A minority of cases may benefit from avoiding a wide range of products that are prepared with mammalian-derived constituents, such as gelatin. This review focuses on the nature of the syndrome, common challenges in diagnosis and management, and also gaps in our current knowledge that would benefit from additional investigation. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 Jan 1;8(1):15-23. | Diagnosis and management; primary care physican; allergist; perioperative care; pharmaceutical; pharmacy; pharmacist |
| Platts-Mills TA, Maccallum MH, Wilson JM, Workman L, Erwin EA. | 2024 | Isotype Diversity of Allergen Specific Antibodies in the Context of Allergic Diseases: Eosinophilic Esophagitis (EoE), Asthma, and the Alpha-Gal Syndrome. |
Frontiers in Allergy.;5:1488857. | antibodies; isotypes |
| Platts-Mills TA, Retterer MK, Workman L, Wilson JM. | 2019 | A consistent "shortage" of cases of the alpha-gal syndrome (AS) on the Gulf coast: possible relevance of fire ants as a predator of lone star ticks. RATIONALE: Allergic reactions to red meat in patients with IgE to alpha-gal are common in the southeastern U.S., but appear less common on the Gulf coast and into much of Texas. This contrasts with the reported distribution of A americanum (lone star tick). In addition, it has been known for many years that fire ants can kill ticks. METHODS: We carried out a survey of the prevalence of AS in allergy practices in areas where the fire ant has been present since 1974 (n510), compared to areas of the Southeast without fire ants in 2000 (n523). In a subset of clinics we additionally assessed reports of fire ant anaphylaxis (FAA). RESULTS: In keeping with the reported area of fire ants, few cases of FAA were reported in VA, KY, MO, OK, or northern AR. By contrast, there was a progressive increase in FAA cases through TN to the Gulf coast. A clinic in Montgomery, AL reported 100 cases of FAA and no cases of AS. A similar trend in reported FAA was identified in a north-south gradient from MO to TX. Cases of AS were much more common in clinics outside of the reported fire ant zone (x2 10.5, P50.001). CONCLUSIONS: The geographic distribution of cases of FAA coincided with the known distribution of fire ants and the unexpectedly low incidence of AS. The likely explanation is that the fire ants have decreased the population of lone star ticks so that tick bites and sensitization to alpha-gal are no longer common in these areas |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB278. | |
| Platts-Mills TA, Schuyler AJ, Commins SP, Merritt TK, McGintee EE, James H, Workman LJ, Wilson JM. | 2018 | Characterizing the Geographic Distribution of the Alpha-gal Syndrome: Relevance to Lone Star Ticks (Amblyomma americanum) and Rickettsia. RATIONALE: Allergic reactions in patients with IgE to galactose-alpha1, 3-galactose, known as alpha-gal syndrome (AS), are well recognized in the southeastern USA. The original recognition of the relevance of A.americanum tick bites came from the apparent similar area of Rocky Mountain Spotted Fever (RMSF) cases. However, severe cases of RMSF are rare in this area, and in addition Rickettsia rickettsii is uncommonly identified in humans or A.americanum. METHODS: Using a modified snowball design, we interviewed ;100 allergists starting in areas with high prevalence of AS. The questionnaire related to the number of confirmed cases, the response to an avoidance diet and the relationship to tick bites. The incidence of AS was compared to recent publications from the CDC describing the geographic distribution of A.americanum and tick-borne infections. RESULTS: Large numbers of cases, i.e. 50-200, were reported by many allergists in the southeast, but also in Long Island, NYand to a lesser extent in northern Minnesota. The CDC reported high prevalence of RMSF in the southeast as late as 2015, however abundant evidence now suggests that spotted fever group Rickettsia (SFG), but not RMSF, are the culprit. The established range of A.americanum largely corresponds with the incidence of AS, but the agreement is stronger when also considering incidence of tick-borne organisms such as SFG or Ehrlichia. CONCLUSIONS: The geographic relationship between the established range of A.americanum and incidence of AS is strong. However, the possibility exists that alpha-gal sensitization relates to a Rickettsia in the context of tick saliva. |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB147. | United States; U.S.; prevalence; Rickettsia; vector of sensitization |
| Platts-Mills TA, Schuyler AJ, Erwin EA, Commins SP, Woodfolk JA. | 2016 | IgE in the diagnosis and treatment of allergic disease. Traditionally, the concept of allergy implied an abnormal response to an otherwise benign agent (eg, pollen or food), with an easily identifiable relationship between exposure and disease. However, there are syndromes in which the relationship between exposure to the relevant allergen and the ``allergic'' disease is not clear. In these cases, the presence of specific IgE antibodies can play an important role in identifying the relevant allergen and provide a guide to therapy. Good examples include chronic asthma and exposure to perennial indoor allergens and asthma related to fungal infection. Finally, we are increasingly aware of forms of food allergy in which the relationship between exposure and the disease is delayed by 3 to 6 hours or longer. Three forms of food allergy with distinct clinical features are now well recognized. These are (1) anaphylactic sensitivity to peanut, (2) eosinophilic esophagitis related to cow's milk, and (3) delayed anaphylaxis to red meat. In these syndromes the immunology of the response is dramatically different. Peanut and galactose alpha-1,3-galactose (alpha-gal) are characterized by high- or very high- titer IgE antibodies for Ara h 2 and alpha-gal, respectively. By contrast, eosinophilic esophagitis is characterized by low levels of IgE specific for milk proteins with high- or very high- titer IgG(4) to the same proteins. The recent finding is that patients with alpha-gal syndrome do not have detectable IgG(4) to the oligosaccharide. Thus the serum results not only identify relevant antigens but also provide a guide to the nature of the immune response. |
Journal of Allergy and Clinical Immunology. 2016 Jun 1;137(6):1662-70. | |
| Platts-Mills TA, Schuyler AJ, Hoyt AE, Commins SP. | 2015 | Delayed Anaphylaxis Involving IgE to Galactose-alpha-1,3-galactose. Hypersensitivity in the allergic setting refers to immune reactions, stimulated by soluble antigens that can be rapidly progressing and, in the case of anaphylaxis, are occasionally fatal. As the number of known exposures associated with anaphylaxis is limited, identification of novel causative agents is important in facilitating both education and other allergen-specific approaches that are crucial to long-term risk management. Within the last 10 years, several seemingly separate observations were recognized to be related, all of which resulted from the development of antibodies to a carbohydrate moiety on proteins where exposure differed from airborne allergens but which were nevertheless capable of producing anaphylactic and hypersensitivity reactions. Our recent work has identified these responses as being due to a novel IgE antibody directed against a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal). This review will present the history and biology of alpha-gal and discuss our current approach to management of the mammalian meat allergy and delayed anaphylaxis. |
Current allergy and asthma reports. 2015 Apr 1;15(4):12. | |
| Platts-Mills TA, Schuyler AJ, Tripathi A, Commins SP. | 2015 | Anaphylaxis to the Carbohydrate Side Chain Alpha-gal. In 2007, the monoclonal antibody cetuximab caused severe hypersensitivity reactions during the first infusion in a region of the southeastern United States. Investigation of pretreatment sera established that they contained immunoglobulin (Ig) E against the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal), which is present on the Fab of cetuximab. Alpha-gal is a blood group substance of nonprimate mammals. These IgE antibodies are also associated with delayed anaphylaxis to red meat (ie, to meat or organs of animals that carry this oligosaccharide). Evidence shows that the primary cause of these IgE antibodies is bites from the tick Amblyomma americanum or its larvae. |
Anaphylaxis to the carbohydrate side chain alpha-gal. Immunology and Allergy Clinics. 2015 May 1;35(2):247-60. | |
| Platts-Mills TAE, Commins SP. | 2013 | Emerging antigens involved in allergic responses. New allergic diseases can 'emerge' because of exposure to a novel antigen, because the immune responsiveness of the subject changes, or because of a change in the behavior of the population. Novel antigens have entered the environment as new pests in the home (e.g., Asian lady beetle or stink bugs), in the diet (e.g., prebiotics or wheat isolates), or because of the spread of a biting arthropod (e.g., ticks). Over the last few years, a significant new disease has been identified, which has changed the paradigm for food allergy. Bites of the tick, Amblyomma americanum, are capable of inducing IgE antibodies to galactose-alpha-1,3-galactose, which is associated with two novel forms of anaphylaxis. In a large area of the southeastern United States, the disease of delayed anaphylaxis to mammalian meat is now common. This disease challenges many previous rules about food allergy and provides a striking model of an emerging allergic disease. |
Current opinion in immunology. 2013 Dec 1;25(6):769-74. | |
| Platts-Mills TAE, Commins SP. | 2013 | Tick bite induced IgE antibodies to alpha-gal and delayed anaphylactic reactions to mammalian derived foods. Cross reactive carbohydrate determinants (CCD) on plant proteins are recognized as a target for IgE (immunoglobulin E) responses. However, in most cases IgE specific for these CCD are not associated with symptoms. In 2006, several oncology groups in the USA became aware that cetuximab was causing severe hypersensitivity reactions in a surprising number of patients. Investigating these reactions, we showed that the patients who reacted had IgE specific for an oligosaccharide on the Fab (fragment, antigen binding) portion of the heavy chain. In collaboration with ImClone, it became clear that this epitope was galactose alpha-1, 3-galactose (alpha-gal). This sugar is a well-known blood group substance of the non-primate mammals. Using the assay for IgE to alpha-gal we screened sera from the clinic and identified a group of patients who had repeated episodes of urticaria or anaphylaxis and who also had IgE to alpha-gal. |
Allergo Journal. 2013 Dec 1;22(8):559-61. | |
| Platts‐Mills TA, Hilger C, Jappe U, Hage M, Gadermaier G, Spillner E, Keshavarz B, Aalberse RC, Van Ree R, Goodman RE, Pomés A | 2021 | Carbohydrate Epitopes Currently Recognized as Targets for IgE Antibodies Until recently, glycan epitopes have not been documented by the WHO/IUIS Allergen Nomenclature Sub-Committee. This was in part due to scarce or incomplete information on these oligosaccharides, but also due to the widely held opinion that IgE to these epitopes had little or no relevance to allergic symptoms. Most IgE binding glycans recognized up to 2008 were considered to be "classical" cross-reactive carbohydrate determinants (CCD) that occur in insects, some helminths and throughout the plant kingdom. Since 2008, theprevailing opinion on lack of clinical relevance of IgE binding glycans has been subject to a reevaluation. This was becauseIgE specific for the mammalian disaccharide galactosealpha-1,3-galactose (alpha-gal) was identified as a cause of delayed anaphylaxis to mammalian meat in the U.S.A., an observation that has been confirmed by allergists in many parts of the world. Several experimental studies have shown that oligosaccharides with one or more terminal alpha-gal epitopes can be attached as a hapten to many different mammalian proteins or lipids. The classical CCDs also behave like haptens since they can be expressed on proteins from multiple species. This is the explanation for extensive in vitrocross-reactivity related to CCDs. Because of these developments, theAllergen Nomenclature Sub-Committee recently decided to include glycans as potentially allergenic epitopes in an adjunct section of its website (www.allergen.org). In this article, the features of the mainglycan groups known to be involved in IgE recognition are revisited, and their characteristic structural, functional, and clinical features are discussed. |
Allergy. 2021 Mar 2. | glycans; carbohydrate allergy; glycosylation |
| Platts‐Mills TA, Hilger C, Jappe U, Hage M, Gadermaier G, Spillner E, Keshavarz B, Aalberse RC, Van Ree R, Goodman RE, Pomés A. | 2021 | Carbohydrate Epitopes Currently Recognized as Targets for IgE Antibodies. Allergy |
Allergy. 2021 Mar 2. | Glycan; carbohydrate epitope |
| Plotto A, Narciso JA. | 2006 | Guidelines and Acceptable Postharvest Practices for Organically Grown Produce This presentation summarizes the major points of the National Organic Program for processing and handling, and gives suggestions for postharvest research. Note:this report is included because it documents the legal use of carrageenan on cut fruit labeled "organic" and without disclosure of the presence of carrageenan in the product. |
HortScience. 2006 Apr 1;41(2):287-91. | carrageenan; food; cut fruit; organic |
| Pointreau Y, Commins SP, Calais G, Watier H, Platts-Mills TA. | 2012 | Fatal Infusion Reactions to Cetuximab: Role of Immunoglobulin E-Mediated Anaphylaxis. In Journal of Clinical Oncology, Tronconi et al report a fatal hypersensitivity reaction to cetuximab in a 63-year-old patient with metastatic colon cancer and outlined a 0.1% incidence of death in the literature. ...In the authors’ words, “the pathogenic mechanisms underlying the development of this phenomenon remain to be elucidated.”1 They raise the hypothesis of immunoglobulin E (IgE)–independent mechanisms, even in the context of a paradoxic atopic history. Moreover, Tronconi et al suggest that the field “search for reliable risk factors that can facilitate the safe selection of patients as candidates for cetuximab-based treatment.”1 These comments are quite surprising, because they do not integrate major contributions that have been previously published. Indeed, it has been known for 3 years that anaphylaxis to cetuximab is the result of antidrug IgE antibodies present in patient serum before therapy. ...These comments are quite surprising, because they do not integrate major contributions that have been previously published. Indeed, it has been known for 3 years that anaphylaxis to cetuximab is the result of antidrug IgE antibodies present in patient serum before therapy. |
Journal of clinical oncology: official journal of the American Society of Clinical Oncology. 2012 Jan 20;30(3):334. | |
| Polanco EG, Borowitz S. | 2023 | Delayed Hypersensitivity Reaction to Infliximab Due to Mammalian Meat Allergy. Mammalian meat allergy is a delayed immunoglobulin E (IgE) mediated hypersensitivity reaction to galactose-alpha-1,3-galactose (alpha-gal). Alpha-gal is an oligosaccharide present on glycoproteins and glycolipids of nonprimate mammals as well as biologic agents prepared using mammalian cells including infliximab. We describe a pediatric patient with Crohn’s disease who developed urticaria and pruritus roughly 6 hours after her very first infliximab infusion that progressed to chronic urticaria following subsequent infliximab infusions. She was diagnosed with mammalian meat allergy based on an elevated serum IgE level directed against alpha-gal. Her symptoms resolved once infliximab infusions were discontinued and did not recur after commencing therapy with adalimumab. |
JPGN Reports. 2023 Aug 1;4(3):e322. | pharmaceutical; pharmacy; biologic; monoclonal antibody; CHO; Infliximab; Crohn's |
| Pollack K, Zlotoff BJ, Borish LC, Commins SP, Platts-Mills TA, Wilson JM. | 2019 | α-Gal Syndrome vs Chronic Urticaria Galactose-α-1,3-galactose (α-gal) is an oligosaccharide expressed on glycoproteins and glycolipids of nonprimate mammals and is the causal epitope of an IgE-mediated allergy to mammalian meat.1,2 First reported in 2009, the α-gal syndrome is an increasingly appreciated problem across the southeastern United States and other parts of the world.2 It is clear that tick bites, specifically relating to Amblyomma americanum (lone star tick), are causal in many, if not most, cases of α-gal sensitization in the United States.3 Following sensitization, many individuals will experience allergic symptoms on ingestion of meat or other products (eg, dairy) derived from nonprimate mammals. In contrast to typical IgE-mediated reactions, which occur within minutes of exposure, the α-gal allergy typically has a delayed onset of 2 to 6 hours.2 The severity of the reaction varies from general urticaria to anaphylaxis, and individuals may not react to every exposure. Because of these atypical features, proper diagnosis can prove challenging. An epidemiological investigation of a pediatric population reported that α-gal may be misdiagnosed as recurrent urticaria or idiopathic anaphylaxis.4 While a recent report postulated that α-gal syndrome might represent a novel cause of chronic urticaria, further research failed to find such an association.5,6 Nevertheless, in areas where α-gal sensitization is prevalent, the potential for misdiagnosing cases of α-gal syndrome as chronic urticaria still exists. Here, we report cases labeled as chronic urticaria or chronic idiopathic urticaria within a cohort of patients in central Virginia being evaluated for α-gal syndrome. Methods: Approval from the institutional review board at University of Virginia and patient informed consent were obtained. Medical records were available from 401 patients seen in the University of Virginia Allergy Clinic who were initially enrolled in a study designed to assess a population with IgE antibodies specific to α-gal and to compare their features with those of nonsensitized participants. Data regarding medical history were subsequently extracted. Patients with a history or a previous diagnosis of chronic urticaria or chronic idiopathic urticaria were identified. In this study and the parent study, α-gal syndrome was defined by a clinical history of delayed reactions to mammalian meat (≥2 hours) and detection of IgE antibodies to α-gal of 0.35 IU/mL or more using ImmunoCAP IgE assays (ThermoFisher Scientific) as previously described. Results: Of the 401 participants, 29 (17 female, 12 male; age range at enrollment, 10-78 years) met the final inclusion criteria. Of this group, 20 patients (69%) had detectable serum levels of IgE antibodies against α-gal (Table 1). The geometric mean level of IgE antibodies to α-gal was 8.1 IU/mL (95% CI, 3.7-18.0) and the total IgE level was 259 IU/mL (95% CI, 145-463). Dietary information was available for 15 of 20 patients with detectable levels of IgE antibodies against α-gal; 9 experienced a complete remission of their symptoms after avoidance of mammalian meat or mammalian-derived products. Another 5 patients demonstrated partial improvement (Table 2). Discussion: The delayed reactions to mammalian products experienced by patients with the α-gal syndrome can easily be misdiagnosed as chronic urticaria. Moreover, these 2 entities can also coexist; it is uncertain whether the 5 participants with only partial improvement of their symptoms had incomplete compliance with an avoidance diet or had coexisting chronic urticaria. Nevertheless, testing for IgE antibodies to α-gal involves a simple blood test and, on dietary modification, those with symptoms attributable to the syndrome should experience relief. Because chronic urticaria is a condition that severely affects a patient’s quality of life, it is crucial to recognize potential mimickers or confounders. Though larger studies are needed, we postulate a benefit for screening patients undergoing evaluation for chronic urticaria who have a suggestive dietary history and live in regions where the α-gal syndrome is common. |
JAMA dermatology. 2019 Jan 1;155(1):115-6. | chronic spontaneous urticaria CSU chronic idiopathic urticaria |
| Popa CM, Cherciu Harbiyeli IF, Ciurea AM, Cazacu IM, Ianosi SL, Schenker M, Saftoiu A. | 2024 | A Preliminary Study Examining the Correlation between EGFRI Treatment, Clinic Dermatoscopy Features, and Serum Levels of Anti-Alpha-Galactosyl IgE in Colorectal Cancer Patients. |
Gastroenterology Insights. 2024 Jun 17;15(2):505-18. | Europe; Poland; biologic; monoclonal antibody; cetuximab; cancer; oncology |
| Popescu FD, Cristea OM, Ionicā FE, Vieru M. | 2019 | †* Drug Allergies Due to IgE Sensitization to alpha-Gal. Serum specific IgE antibodies for non-primate mammalian carbohydrate galactose-alpha-1,3-galactose (alpha-Gal) are associated to alpha-Gal syndrome: delayed allergy to red meat manifested as anaphylaxis, angioedema or urticaria after ingestion of beef, pig or lamb meat, immediate-onset anaphylaxis at first parenteral exposure to drugs significantly containing alpha-Gal. IgE-mediated drug allergy in the alpha-Gal syndrome was reported for some therapeutic monoclonal antibodies, such as cetuximab, snake antivenom, and varicella-zoster vaccine, but there are risks also for colloid plasma volume substitutes, vaccines containing gelatin of porcine/bovine animal origin as an excipient, and drugs with porcine pancreatin or bovine-origin magnesium stearate. |
magnesium. 2018;2017:47-8. | Ionica FE; pharmacy; pharmaceutical; review article |
| Posthumus J, James H, Wang X, Commins S, Platts-Mills TA. | 2010 | Correlation of Blood Type with the Presence of IgE Antibodies to Galactose-alpha-1,3-galactose (Alpha-gal): Is there a Protective Effect of Blood Group Substance B? RATIONALE: IgG antibodies to the carbohydrate, galactose-α-1,3-galactose (alpha-gal), are found in sera from all immunocompetent humans. Patients with type B blood have significantly less IgG to alpha-gal. Alpha-gal has recently been described as a novel food allergen and patients with IgE to alpha-gal report delayed anaphylaxis occurring 3-6 hours after eating mammalian meat. We hypothesize that B blood type will be negatively associated with IgE to alpha-gal due to the structural similarity between B blood group substance and the alpha-gal moiety. METHODS: Serum was collected from patients (n=266) from the University of Virginia Allergy Clinic. Immunoassays were performed for IgE to alpha-gal and sera were back-typed with red blood cells. RESULTS: A logistic regression model and Wald Chi-square was used to assess if there was an association between blood types and IgE, and odds ratio was used to quantify the effect of different blood types. A Bonferroni adjustment was employed to adjust for multiple comparisons in blood types. There was a significant difference between blood types and the presence of IgE to alpha-gal (p = 0.012). Subjects with B/AB blood were only 0.11 likely to be IgE positive compared with blood type A subjects (95% CI: 0.02 to 0.60, p = 0.004), and were also 0.11 likely to be IgE positive compared with blood type O subjects (95% CI: 0.02 to 0.59, p = 0.003). CONCLUSIONS: Subjects with B blood group were less likely to develop IgE to alpha-gal. Thus, type B/AB may confer a protective effect on the development of IgE to alpha-gal. |
Journal of Allergy and Clinical Immunology. 2010 Feb 1;125(2):AB203. | blood type |
| Posthumus J, James HR, Lane CJ, Matos LA, Platts-Mills TA, Commins SP. | 2013 | Initial description of pork-cat syndrome in the United States. Despite meat being an important source of protein in Western diets, development of meat allergy is uncommon. For mammalian meat, the extensive homology of proteins across mammalian species decreases the likelihood of creating a specific IgE (sIgE) response. In fact, when clinically relevant reactivity to meats has been demonstrated, the results point to cross-reactivity (eg, serum albumin [SA] and actin) and not to a sensitization with meat-specific epitopes. In keeping with this cross-reactivity, reports of IgE antibodies that bind various mammalian albumins do exist, notably pork-cat syndrome. In this uncommon syndrome patients have an IgE antibody response specific for cat SA that cross-reacts with porcine albumin and can lead to severe or even fatal allergic reactions on occasions when pork is consumed. Interestingly, the reported cases of pork-cat syndrome are largely European. We have recently evaluated numerous patients with suspected “meat allergy”; in so doing, we have found and report here for the first time 8 cases of pork-cat syndrome in the United States. Representative clinical history and evaluations of 2 patients are described, including detailed IgE specificity and a clinical response to elimination diet, both of which strongly suggested the diagnosis. However, confirmatory food challenges were not performed in any of the 8 patients. |
Journal of Allergy and Clinical Immunology. 2013 Mar 1;131(3):923-5. | |
| Posthumus J, Workman LJ, James HR, Pochan SL, Lane CJ, McBride DC, Eapen SS, Matos LA, Commins SP, Platts-Mills TA. | 2012 | In the Pork-Cat Syndrome, Allergic Reactions to Pork Reflect IgE Antibodies to Cat Albumin that Cross-reacts with Other Albumins. Rationale: Pork-Cat syndrome is an IgE-mediated reaction in patients with specific IgE to mammalian serum albumins, most commonly pork and to date these cases have only been reported from Europe. We describe 6 patients with food induced hypersensitivity syndromes ranging from oral pruritus to anaphylaxis. Their serum contained IgE antibodies to albumin from several species and was evaluated for cross-reactivity. Methods: Patients with a history of allergic reactions to meat were enrolled into an IRB approved study with informed consent. IgE antibodies were determined to select mammalian meats and albumins. Values less than 0.35 kU/L were considered negative. Inhibition assays were performed with porcine and feline serum albumin by mixing 100ul of patient serum with 7mg of feline or porcine albumin in PBS and specific IgE assays were repeated. Results: Our 6 patients with allergic reactions to mammalian meat had serum IgE specific for feline and porcine albumin as well as for cat dander and pork. Five of six were negative for IgE specific to galactose-alpha-1,3-galactose. Pork albumin produced complete inhibition of IgE to pork and pork albumin and incomplete inhibition of IgE to cat dander and cat albumin. Cat albumin produced significant inhibition of IgE to pork, cat albumin, and pork serum albumin but not cat dander. Conclusions: Some patients with meat hypersensitivity have IgE to cat albumin. The structure of albumin is highly conserved through mammalian species which likely accounts for the cross-reactivity with pork and other meat albumins. |
Journal of Allergy and Clinical Immunology. 2012 Feb 1;129(2):AB177. | pork-cat syndrome |
| Prescott SL, Pawankar R, Allen KJ, Campbell DE, Sinn JK, Fiocchi A, Ebisawa M, Sampson HA, Beyer K, Lee BW. | 2013 | A global survey of changing patterns of food allergy burden in children. While food allergies and eczema are among the most common chronic non-communicable diseases in children in many countries worldwide, quality data on the burden of these diseases is lacking, particularly in developing countries. This 2012 survey was performed to collect information on existing data on the global patterns and prevalence of food allergy by surveying all the national member societies of the World Allergy Organization, and some of their neighbouring countries. Data were collected from 89 countries, including published data, and changes in the health care burden of food allergy. More than half of the countries surveyed (52/89) did not have any data on food allergy prevalence. Only 10% (9/89) of countries had accurate food allergy prevalence data, based on oral food challenges (OFC). The remaining countries (23/89) had data largely based on parent-reporting of a food allergy diagnosis or symptoms, which is recognised to overestimate the prevalence of food allergy. Based on more accurate measures, the prevalence of clinical (OFC proven) food allergy in preschool children in developed countries is now as high as 10%. In large and rapidly emerging societies of Asia, such as China, where there are documented increases in food allergy, the prevalence of OFC-proven food allergy is now around 7% in pre-schoolers, comparable to the reported prevalence in European regions. While food allergy appears to be increasing in both developed and developing countries in the last 10–15 years, there is a lack of quality comparative data. This survey also highlights inequities in paediatric allergy services, availability of adrenaline auto-injectors and standardised National Anaphylaxis Action plans. In conclusion, there remains a need to gather more accurate data on the prevalence of food allergy in many developed and developing countries to better anticipate and address the rising community and health service burden of food allergy. Note:"Beef allergy is among the most common in Turkish children both <5 years [59] and < 5 years of [45, 57, 59]. The few other regions that report allergies to meats among the five most common allergens include Poland [34], Colombia [39], and Mozambique [37], although data are limited." |
World Allergy Organization Journal. 2013 Dec 1;6(1):1-2. | geographic distribution; prevalence |
| Prose R, Breuner NE, Johnson TL, Eisen RJ, Eisen L. | 2018 | Contact irritancy and toxicity of permethrin-treated clothing for Ixodes scapularis, Amblyomma americanum, and Dermacentor variabilis ticks (Acari: Ixodidae). Clothing treated with the pyrethroid permethrin is available in the United States as consumer products to prevent tick bites. We used tick bioassays to quantify contact irritancy and toxicity of permethrin-treated clothing for three important tick vectors of human pathogens: the blacklegged tick, Ixodes scapularis Say (Acari: Ixodidae); the lone star tick, Amblyomma americanum (L.) (Acari: Ixodidae); and the American dog tick, Dermacentor variabilis (Say) (Acari: Ixodidae). We first demonstrated that field-collected I. scapularis nymphs from Minnesota were as susceptible as laboratory-reared nymphs to a permethrin-treated textile. Field ticks examined in bioassays on the same day they were collected displayed contact irritancy by actively dislodging from a vertically oriented permethrin-treated textile, and a forced 1-min exposure resulted in all ticks being unable to move normally, thus posing no more than minimal risk of biting, 1 h after contact with the treated textile. Moreover, we documented lack of normal movement for laboratory-reared I. scapularis nymphs by 1 h after contact for 1 min with a wide range of permethrin-treated clothing, including garments made from cotton, synthetic materials, and blends. A comparison of the impact of a permethrin-treated textile across tick species and life stages revealed the strongest effect on I. scapularis nymphs (0% with normal movement 1 h after a 1-min exposure), followed by A. americanum nymphs (14.0%), I. scapularis females (38.0%), D. variabilis females (82.0%), and A. americanum females (98.0%). Loss of normal movement for all ticks 1 h after contact with the permethrin-treated textile required exposures of 1 min for I. scapularis nymphs, 2 min for A. americanum nymphs, and 5 min for female I. scapularis, D. variabilis, and A. americanum ticks. We conclude that use of permethrin-treated clothing shows promise to prevent bites by medically important ticks. Further research needs are discussed. |
Journal of medical entomology. 2018 Aug 29;55(5):1217-24. | permethrin; tick avoidance |
| Qi X, Tester RF. | 2020 | Gut associated lymphoid tissue: Carbohydrate interactions within the intestine Carbohydrates play a number of roles in the gut - although their presence and activity reach beyond the gut to other parts of the body. The carbohydrate family are not simply sources of energy and/or dietary fibre but at least some act on the gut associated lymphoid tissue both directly and indirectly (via microorganisms themselves and via products of microbiological fermentation), to elicit immune responses within the gut itself and systemically throughout the body. Prebiotic carbohydrates are used by gut friendly probiotic bacteria as a carbon source for growth - which is reflected in their immuno-supportive roles. The gut associated lymphoid tissue is critical to maintaining normal digestive processes - whilst protecting the gut and body from assault by toxins and pathogenic organisms. This area of physiology is still poorly understood; although gradually a picture is developing of how the immunogenic properties of dietary carbohydrates work within the gut. This review aims to explore this area of immunology and how it might be influenced by diet and specific components of the diet. |
Bioactive Carbohydrates and Dietary Fibre. 2020 Jan 1;21:100210. | carbohydrate allergy; gastrointestinal; intestine; gut associated lymphoid tissue |
| Radhakrishnan S, Nagarajan S, Bechelany M, Kalkura SN. | 2020 | Collagen based biomaterials for tissue engineering applications: A review. In the search for biomaterials that exhibit both versatility and compatibility with human-tissues, considerable interest has been shown in collagen-based biomaterial for the repair and replacement of the body tissues such as tendons, skin, vascular grafts, heart valves, dental and bones. Some of the general properties of collagen which makes it an interesting biomaterial are the high mechanical strength of the fibers, low antigenicity, its suitability as a substrate for cell growth, and its tunable stability by chemical or physical cross-linking. Collagen based composites are used in various biomedical applications as collagen shields in ophthalmology, sponges for burns and wounds, mini-pellets and tablets for protein delivery, gel formulation in combination with liposome for sustained drug delivery, as controlling material for transdermal delivery, basic matrices for cell culture systems, coating material of metal implant for bone replacement and 3-D printed matrix for various tissue engineering applications. For an adequate biomedical application of collagen, basic knowledge about collagen structure, hierarchical structural organisation and the processing technology in combination with understanding of the physico-chemical properties is of vital importance. |
InProcesses and phenomena on the boundary between biogenic and Abiogenic nature 2020 (pp. 3-22). Springer, Cham. | medical products; surgery; collagen |
| Radwan SS, Gill G, Ghazzal A, Malik A, Barnett C. | 2020 | † Plaque Rupture-Induced Myocardial Infarction and Mechanical Circulatory Support in Alpha-Gal Allergy Alpha-gal (AG) allergy is an IgE-mediated allergic reaction to galactose-alpha-1,3-galactose found in mammalian meat. Heparin, being derived from porcine intestinal tissue, may have a degree of cross-reactivity with AG antigen and thus place patients at risk for allergic and even anaphylactic reactions. This is especially important in patients with myocardial infarction (MI) and mechanical circulatory support, such as a left ventricular assist device (LVAD), since anticoagulation is immediately required. Therefore, individualized assessment and preoperative planning is needed regarding the use of heparin vs. nonheparinoid products in such a population. |
Case Reports in Cardiology. 2020 Feb 17;2020. | cardiac; cardiology; cardiothoracic; heparin; pharmacy; pharmaceutical; medication; perioperative care |
| Raghavan RK, Peterson AT, Cobos ME, Ganta R, Foley D. | 2019 | Current and Future Distribution of the Lone Star Tick, Amblyomma americanum (L.) (Acari: Ixodidae) in North America. Acarological surveys in areas outside the currently believed leading edge of the distribution of lone star ticks (Amblyomma americanum), coupled with recent reports of their identification in previously uninvaded areas in the public health literature, suggest that this species is more broadly distributed in North America than currently understood. Therefore, we evaluated the potential geographic extent under present and future conditions using ecological niche modeling approach based on museum records available for this species at the Walter Reed Biosystematics Unit (WRBU). The median prediction of a best fitting model indicated that lone star ticks are currently likely to be present in broader regions across the Eastern Seaboard as well as in the Upper Midwest, where this species could be expanding its range. Further northward and westward expansion of these ticks can be expected as a result of ongoing climate change, under both low- and high-emissions scenarios. |
PLOS ONE 14(1): e0209082. | |
| Raji K, Baucom M. | 2022 | Alpha-Gal (Mammalian Meat) Allergy: Implications for Dermatologic Surgeons. Communication. No abstract available. |
Dermatologic Surgery. 2022 Feb 8. | dermatology; surgery; perioperative |
| Ramasamy R. | 2021 | Mosquito vector proteins homologous to α1-3 galactosyl transferases of tick vectors in the context of protective immunity against malaria and hypersensitivity to vector bites. Background: An epitope, Galα1-3Galβ1-4GlcNAc-R, termed α-gal, is present in glycoconjugates of New World monkeys (platyrrhines) and other mammals but not in hominoids and Old World monkeys (catarrhines). The difference is due to the inactivation of α1-3 galactosyl transferase (α1-3 GT) genes in catarrhines. Natural antibodies to α-gal are therefore developed in catarrhines but not platyrrhines and other mammals. Hypersensitivity reactions are commonly elicited by mosquito and tick vector bites. IgE antibodies against α-gal cause food allergy to red meat in persons who have been exposed to tick bites. Three enzymes synthesising the terminal α1-3-linked galactose in α-gal, that are homologous to mammalian α and β1-4 GTs but not mammalian α1-3 GTs, were recently identified in the tick vector Ixodes scapularis. IgG and IgM antibodies to α-gal are reported to protect against malaria because mosquito-derived sporozoites of malaria parasites express α-gal on their surface. This article explores the possibility that the α-gal in sporozoites are acquired from glycoconjugates synthesised by mosquitoes rather than through de novo synthesis by sporozoites. Methods: The presence of proteins homologous to the three identified tick α1-3 GTs and mammalian α1-3 GTs in two important mosquito vectors, Aedes aegypti and Anopheles gambiae, as well as Plasmodium malaria parasites, was investigated by BLASTp analysis to help clarify the source of the α-gal on sporozoite surfaces. . Results: Anopheles gambiae and Ae. aegypti possessed several different proteins homologous to the three I. scapularis proteins with α1-3 GT activity, but not mammalian α1-3 GTs. The putative mosquito α1-3 GTs possessed conserved protein domains characteristic of glycosyl transferases. However, the genus Plasmodium lacked proteins homologous to the three I. scapularis proteins with α1-3 GT activity and mammalian α1-3 GTs. . Conclusions: The putative α1-3 GTs identified in the two mosquito vectors may synthesise glycoconjugates containing α-gal that can be transferred to sporozoite surfaces before they are inoculated into skin during blood feeding. The findings merit further investigation because of their implications for immunity against malaria, hypersensitivity to mosquito bites, primate evolution, and proposals for immunisation against α-gal. |
Parasites & Vectors. 2021 Dec;14(1):1-6. | Vector; arthropod; mosquito; Anopheles |
| Ramirez DA, Bahna SL. | 2009 | Food hypersensitivity by inhalation. Though not widely recognized, food hypersensitivity by inhalation can cause major morbidity in affected individuals. The exposure is usually more obvious and often substantial in occupational environments but frequently occurs in non-occupational settings, such as homes, schools, restaurants, grocery stores, and commercial flights. The exposure can be trivial, as in mere smelling or being in the vicinity of the food. The clinical manifestations can vary from a benign respiratory or cutaneous reaction to a systemic one that can be life-threatening. In addition to strict avoidance, such highly-sensitive subjects should carry self-injectable epinephrine and wear MedicAlert® identification. Asthma is a strong predisposing factor and should be well-controlled. It is of great significance that food inhalation can cause de novo sensitization. |
Clinical and Molecular Allergy. 2009 Dec;7(1):1-6. | airborne reactions |
| Ramírez-Mateo E, Fernández-Lozano C, De-Andrés-Martín A, González-De-Olano D. | 2024 | A case of transient pork-cat syndrome in a child due to albumin sensitization. |
J Investig Allergol Clin Immunol. Published online November 8, 2023:0. | Europe; Spain; pork-cat syndrome; pediatric |
| Ranasinghe T, Aberathna I, Jayamali J, Nimasha T, Chathurangika H, Peranantharajah D, Colambage H, Malavige GN, Jeewandara C. | 2023 | Sensitization to alpha-gal as a cause of idiopathic anaphylaxis Background: The cause for anaphylaxis cannot be identified after extensive evaluation in a large proportion of patients, who are classified as having ‘idiopathic anaphylaxis’ (IA). As food consumption patterns, genetic background, and environmental factors can lead to differences in allergen sensitization patterns in different regions, we sought to identify the aetiology of IAin cohort of Sri Lankan patients. Methods: Of the patients referred to our clinic following anaphylaxis, 65 were recruited as a cause could not be identified. The events that led to the episode of anaphylaxis, the triggers, the severity of symptoms and treatment received were recorded and skin prick test, ISAC ImmunoCAP test and serum tryptase was carried out. Results: Of the 65 patients, 42/65 (64.6%) were females and 49/65 (75.38%) were adults. 46/65 (70.8%) had grade II anaphylaxis and 34/65 (52.3%) were found to have specific IgE to alpha-gal, with symptoms occurring 0.5 to 6 hours since ingestion of food. Of those who had specific IgE to alpha-gal, 12 (35.3%) had consumed red meat and 10 (29.4%) milk products (3 had consumed fermented buffalo milk), before the episode of anaphylaxis. Difficulty in breathing, swelling of lips and syncope was significantly higher in those who were not sensitized to alpha-gal, while diarrhoea and abdominal pain were more common in those sensitized to alpha-gal, although this was not significant. Conclusion: A large proportion of patients presenting with IA were found to be sensitized to alpha-gal, which was the likely cause of their anaphylaxis. |
Pre-print | Asia; Sri Lanka; prevalence; idiopathic anaphylaxis |
| Rathore A, Malani H. | 2021 | Need for a risk-based control strategy for managing glycosylation profile for biosimilar products. Monoclonal antibodies, though a popular class of therapeutics, are complex molecules that are manufactured using complex processes, making it non-trivial to maintain high level of batch-to-batch consistency in product quality. Glycosylation is a post translation modification that is widely considered a critical quality attribute (CQA) as its variations are known to impact the Fc effector functions of mAbs. With continuing rise of biosimilars, comparability of these products to the reference product with respect to glycosylation is a topic of immense interest. |
Expert Opinion on Biological Therapy. 2021 Nov 2 | Medical products; biologics; monoclonal antibody |
| Ratnayake, S. & Vanessa, Stockdale & Grafton, S. & Munro, Peter & Robinson, A.L. & Pearson, W. & Mcrae, Jacqui & Bacic, A. | 2019 | Carrageenans as heat stabilisers of white wine. Carrageenan addition has been previously shown to remove proteins from wine and to heat stabilise wines, however, many types of carrageenans are now available with potentially different protein‐adsorbing properties. This study investigated a range of commercially available carrageenans added at several stages of winemaking for efficacy of protein removal, heat stability and impact on wine sensory properties. In preliminary screening trials, 11 types of carrageenan were added to a Chardonnay wine and the heat stability of the wine measured with a heat test. Three of the carrageenans successfully heat‐stabilised the wine and were included in large‐scale winemaking trials: sodium‐rich kappa (kN), potassium‐rich kappa (kK) and kappa/iota (90:10, ki) carrageenan. Each carrageenan was added at three stages of winemaking, to juice, during fermentation and to wine. All carrageenans produced heat‐stable wine regardless of time of addition. Addition of kN during fermentation also improved wine recovery compared to bentonite addition, the positive Control, although sodium concentration also significantly increased in the wine. Addition of kK‐carrageenan to either wine or clarified juice was the most effective treatment for producing heat‐stable wine with minimal impact on the sensory profile, wine lees, turbidity and concentration of metal ions compared to that of untreated Control wines. Kappa‐ and kappa‐/iota‐carrageenans can be effective at heat stabilising white wines without negative impact on sensory properties, although the filterability and concentration of metal ions of the wines can vary with carrageenan structure and time of addition. Kappa‐carrageenan, a renewable fining agent, is effective in heat stabilising wines and maybe become a useful alternative to bentonite. |
Australian Journal of Grape and Wine Research. 25. 439-450. | carrageenan; wine |
| Rauschenberg R, Beissert S, Bauer A, Spornraft‐Ragaller P. | 2014 | Intraoperative anaphylactic reaction IV° to gelatin. No abstract available |
JDDG: Journal der Deutschen Dermatologischen Gesellschaft. 2014 Jul 1;7(12):617-8. | † perioperative care; gelatin; gelatine; |
| Reddy S, Yi L, Shields B, Platts-Mills T, Wilson J, Flowers RH. | 2023 | Alpha-gal syndrome: a review for the dermatologist. Alpha-gal syndrome (AGS) is an allergy to “red” meat and other mammalian products due to immunoglobulin E (IgE) antibodies against the sugar moiety galactose-alpha-1,3-galactose (alpha-gal), which is acquired following tick bites. Clinically, AGS presents with urticaria, abdominal pain, nausea, and occasionally anaphylaxis, and has wide inter- and intra-personal variability. Because symptom onset is generally delayed by two to six hours after meat consumption, AGS can be easily confused with other causes of urticaria and anaphylaxis, such as chronic spontaneous urticaria (CSU) and mast cell activation syndrome (MCAS). Diagnosis relies on a combination of clinical history, positive alpha-gal IgE blood testing and improvement on a mammalian-restricted diet. Management of the syndrome centers primarily on avoidance of mammalian meats (and occasionally dairy and other products), as well as acute management of allergic symptoms. Counseling about tick avoidance measures is also important as AGS will wane over time in many patients. |
Journal of the American Academy of Dermatology. 2023 May 5. | dermatology |
| Redouté H, Le Guillou L, Polard E, Dessard S, Pandi AS, Rochefort-Morel C. | 2024 | Anaphylaxie à une Héparine Non fractionnée (HNF). |
Revue Française d'Allergologie. 2024 Apr 1;64:103957. | pharmaceutical; drugs; medical products; heparin |
| Reeder JA, Reynolds TR, Gilbert BW. | 2021 | Successful Use of Aspirin, Apixaban, and Viscoelastography in a Patient with Severe COVID Disease and Allergy to Porcine Products. Coagulation abnormalities are frequently described in patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Common thromboprophylaxis and anticoagulation treatment strategies include the use of heparinoid therapy. We describe a 57-year-old woman with an allergy to porcine products that was started on apixaban for anticoagulation therapy given her allergy profile and need for venous thromboembolism prophylaxis. Apixaban and aspirin therapy were optimized with the support of serial viscoelastography and platelet function assays. Our patient experienced respiratory failure requiring intubation for 7 days but was successfully weaned to room air, tolerated a regular diet, and ultimately discharged to home after a 17-day hospital course. Here we report the safe and successful use of aspirin, apixaban, and viscoelastography for COVID-19-associated coagulopathy. |
Hospital Pharmacy. 2021 Jan 29:0018578721990898. | Pork-cat syndrome; porcine; allergy; anticoagulation therapy; coagulopahty; Covid-19; coronavirus |
| Renaudin J, Jacquenet S, Metz-Favre C, Baudouin E, Engel F, de Blay F, Moneret-Vautrin D. | 2012 | Interest Of Specific Ige Measurement For Galactose-alpha-1,3-galactose In Unexplained Recurrent Urticaria With Angioedema, Predominantly Nocturnal: About 6 Cases. Rationale: Allergy to red meat is commonly due to sensitization to serum albumin. Delayed anaphylaxis after eating beef, pork or lamb's meat was reported due to galactose-alpha-1,3-galactose (alpha-gal) IgE antibodies. Objective: Test for specific IgE (sIgE) against alpha-gal in patients with recurrent urticaria and angioedema occurring frequently at night. . Methods: This study was carried out to these patients included prospectively during 6 months. Patient had skin prick tests (SPTs) with common aeroallergens, food allergens and different raw meats (veal, lamb, rabbit, pork, chicken, turkey, duck), and sIgE measurement against alpha-gal. . Results: Six patients were included: all are male, and 1/3 had atopy (one or more positive SPTs to aeroallaergens). The average length of symptoms was 4.5 years [1-18 y]. The average age was 53.5± 16 years. Urticaria or angiodema occurred most frequently delayed after eating of different mammals, never poultry or fish (average lenght of 5.5 hours after meals). Associated risk factor of anaphylaxis was present in all the cases: alcohol (4 times), effort (3), aspirin and NSAID (3), and ACE inhibitor (2). SPTs were positive to raw mammal's meat but not to chicken, duck or turkey's meat: 5/6 to veal, 5/6 to lamb, 5/6 to rabbit, 4/6 to pork. There was no other food allergy. sIgE to α-gal were positive and elevated (93.11± 62 kU/L) for all patients. A food elimination diet without mammal's meat causes disappearance of chronic urticaria or recurrent angioedema. Conclusions: we report cases of delayed meat allergy revealed by recurrent urticaria or angiodema probably due to α-gal IgE antibodies. |
Journal of Allergy and Clinical Immunology. 2012 Feb 1;129(2):AB177. | |
| Restani P, Ballabio C, Tripodi S, Fiocchi A. | 2009 | Meat Allergy Purpose of review: This review summarizes the scientific evidence on meat allergy, an unusual disorder, whose prevalence in some European countries (such as Italy) may be increasing. Recent findings: Data reported in this review underline some interesting points: in meats rarely consumed, such as kangaroo, whale and seal, the main allergens are only partially correlated to those detected in beef or other usually consumed meats; cross-reactivity and cross-contamination are critical aspects, which should be seriously considered by allergologists. Summary: Meat allergy is normally outgrown during the first years of life, so that it is rare in adults. Beef among mammals and chicken among birds are most frequently involved. The major allergens are serum albumins and immunoglobulins, but there are a few reports of allergies to muscle proteins (actin, myosin and tropomyosin). As meat allergenicity can be reduced by various treatments (heat, homogenization and freeze-drying), the consumption of meat derivatives by children allergic to meat proteins is often permitted. Cross-reactivity has been described between different meats, between meat and milk or eggs and between meat and animal dander. There are some reports of cross-contamination associated with the inadequate cleaning of industrial or butchers' equipment. All these aspects may have serious implications for clinical practice. Note: this review was conducted before alpha-gal syndrome was widely recognized. The focus is on primary meat allergy. |
Frontiers in immunology. 2014 Sep 5;5:427. | review article |
| Retterer MK, Wilson JM, Workman L, Platts-Mills TA. | 2018 | Tick bites and IgE sensitization to the oligosaccharide galactose-alpha-1,3-galactose (alpha-Gal): a Bacterial Hypothesis. RATIONALE: IgE to a-Gal is causal in delayed anaphylaxis to mammalian meat and relates to bites from hard ticks. Though it is unclear whether ticks intrinsically express a-gal, these glycans have been shown to be present in tick saliva. Because gram-negative enteric bacteria are known to express a-Gal, we considered the possibility that the source of a-Gal relates to symbionts in lone star ticks. Of the lone star tick symbionts known to overlap the distribution of a-Gal cases [i.e. Rickettsiae spotted fever group(SFG) and Ehrlichia chaffeensis], Rickettsia amblyommii, which only causes a mild clinical syndrome, is most prevalent. To explore this hypothesis we sought to assess seroprevalance to Rickettsiae SFG and Ehrlichia in subjects sensitized to a-Gal. METHODS: Sera from 369 subjects in central Virginia were available from a large observational study designed to investigate IgE sensitization to a-Gal. IgG to Rickettsiae SFG and Ehrlichia chaffeensis were assayed by commercially available ELISA and micro-immunofluorescence kits, respectively. RESULTS: 280 subjects were positive for IgE to a-Gal (76%). Of these, 21% (59/280) were positive for IgG to Rickettsia. In the 89 subjects not sensitized to a-Gal, 15% (13/89) were positive for IgG to Rickettsia. In preliminary investigation we have observed similar results in the Ehrlichia assays. CONCLUSIONS: Seroprevalence to Rickettsia trends higher (p50.18) in subjects sensitized to a-Gal but nonetheless is absent in nearly 80% of cases. Although the tests used may not be sufficiently sensitive to identify subclinical exposure, the current data do not support a link between tickborne bacteria and a-Gal sensitization. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB155. | Rickettsiae; Rickettsia; Ehrlichia |
| Retterer MK, Workman LJ, Bacon JR, Platts-Mills TA. | 2018 | Specific IgE to gelatin as a cause of anaphylaxis to zoster vaccine. Reading the recent letter from Stone et al reminded us of a subject from our previous galactose-a-1,3-galactose (alphagal) study. Indeed, she may well be the same 76-year-old lady found in the letter (Table E1) who was reported as negative to alpha-gal. Her first reaction to meat started 45 minutes after eating barbecue, only a few months following her recovery from Lyme disease. Since then she has had multiple reactions of varying severity, some of which started less than 1 hour after ingestion of red meat. Although not the average time for the onset of an alpha-gal allergic reaction, which is approximately 3 to 5 hours, her reactions to meat were not immediate either. In 2007, 20 minutes after receiving zoster vaccine, she went into cardiovascular collapse, requiring emergency treatment and an overnight hospital stay. |
Journal of Allergy and Clinical Immunology. 2018 May 1;141(5):1956-7. | pharmaceutical; pharmacy; vaccine |
| Retzinger AC, Retzinger GS. | 2020 | Mites, Ticks, Anaphylaxis and Allergy: The Acari Hypothesis. Anaphylaxis is a poorly understood immune process in which a Th2-/IgE-mediated adaptive response commandeers cellular machinery, typically reserved for defense against multicellular ectoparasites, to activate against otherwise benign molecules. Its clinical manifestations consist of rapid pathophysiological reflexes that target epithelial surfaces. The galactose-α-1,3-galactose (α-gal) hypersensitivity response is a compelling model of anaphylaxis for which causation has been demonstrated. At the core of the model, a tick bite sensitizes a recipient to a tick foodstuff. As proposed herein, the model likely informs on the origin of all allergic inflammation; namely, allergy is not intended to protect against seemingly harmless and irrelevant materials, but is, instead, intended to rid epithelial surfaces of pathogen-bearing Acari, i.e., mites and ticks. The demonstrated adjuvant activity of acarian gastrointestinal secretions, when paired with the polyphagous diet of mites, renders acarians eminently suited to accounting, mechanistically, for many, if not all, human allergies. |
Medical Hypotheses. 2020 Sep 10:110257. | vector; arthropod; acari; tick; mite; evolution |
| Retzinger AC, Retzinger GS. | 2021 | The Acari Hypothesis, II: Interspecies Operability of Pattern Recognition Receptors. Hypersensitivity to galactose-α-1,3-galactose (α-gal) is an informative example of a pathologic IgE-mediated process. By way of their saliva, ticks are able to sensitize humans to tick dietary elements that express α-gal. Mites, which along with ticks constitute the phyletic subclass Acari, feed on proteinaceous foodstuffs that represent most, if not all, human allergens. Given: (1) the gross nature of the pathophysiological reactions of allergy, especially anaphylaxis, (2) the allergenicity of acarian foodstuffs, and (3) the relatedness of ticks and mites, it has been hypothesized that human-acarian interactions are cardinal to the pathogenesis of allergy. In this report, a means by which such interactions contribute to that pathogenesis is proposed. |
Pathogens. 2021 Sep;10(9):1220. | Evolution; mites; ticks; Acari; IgE; food allergy |
| Retzinger AC, Retzinger GS. | 2024 | The Acari Hypothesis, IV: revisiting the role of hygiene in allergy. |
Frontiers in Allergy. 2024 Jul 10;5:1415124. | Evolution; mites; ticks; Acari; IgE; food allergy |
| Ribeiro F, Carrapatoso I, Bartolome B, Luís AS. | 2013 | Mammal’s meat and cow’s milk allergy – case report. Background: The mammalian meat allergy is not very common. When it happens in adults, it may be related to respiratory allergy to mammalian epithelia (e.g. pork-cat syndrome) or to sensitization to the recently discovered IgE antibody to a mammalian oligosaccharide epitope galactose-alpha-1,3-galactose (α-gal). Methods: We present the case of a 66 year-old woman that at age 61 developed recurrent episodes of generalized urticaria and angioedema of the upper airways about 4 hours after the ingestion of ham, bean stew with pork meat and rabbit meat. She tolerated other foods, including other meats, fish and cow's milk. She worked in a meat factory and handled daily with meat, she had contact with various animals, including dogs, cows, pigs, chickens and doves. Two years after the onset of the clinical manifestations she had other episode after the ingestion of cow’s milk. She avoids all mammalian meat and cow’s milk. No history of respiratory allergy was reported. Skin prick tests (SPT) and determination of specific IgE (sIgE) to aeroallergens, meats and epithelia from mammals, cow’s milk and to α-gal and nBos d 6 were carried out. We performed SDS-PAGE immunoblotting assays to mammalian meats. Open oral challenge to cow’s milk was also performed. Results: SPT to aeroallergens were positive to pollen from alder, plantain, mugwort and Parietaria judaica as well as to Alternaria alternata. SPT and sIgE results to allergens other than aeroallergens can be observed in the table. The immunoblotting assays identified an intense IgE-binding band of 60 kDa and some others of high molecular masses. The oral challenge test to cow’s milk was considered positive after a cumulative dose of 200 ml, about 3 hours after last intake. Conclusion: This is a case of a patient with non-immediate anaphylaxis to mammalian meat and cow's milk. The proteins usually involved in type I allergy to mammalian’s meat (serum albumin) and to cow’s milk (casein) were negative. In this case the molecule involved seems to be the oligosaccharide alpha-gal. This may explain allergy reactions to mammalian meats with negative sIgE values to nBos d 6 and allergy to cow’s milk with negative sIgE to milk proteins. |
Clinical and Translational Allergy. 2013 Jul 1;3(S3):P152. | |
| Ribeiro J, Mans BJ. | 2020 | TickSialoFam (TSFam): A database that helps to classify tick salivary proteins, a review on tick salivary protein function and evolution, with considerations on the tick sialome switching phenomenon Tick saliva contains a complex mixture of peptides and non-peptides that counteract their hosts' hemostasis, immunity, and tissue-repair reactions. Recent transcriptomic studies have revealed over one thousand different transcripts coding for secreted polypeptides in a single tick species. Not only do these gene products belong to many expanded families, such as the lipocalins, metalloproteases, Antigen-5, cystatins, and apyrases, but also families that are found exclusively in ticks, such as the evasins, Isac, DAP36, and many others. Phylogenetic analysis of the deduced protein sequences indicate that the salivary genes exhibit an increased rate of evolution due to a lower evolutionary constraint and/or positive selection, allowing for a large diversity of tick salivary proteins. Thus, for each new tick species that has its salivary transcriptome sequenced and assembled, a formidable task of annotation of these transcripts awaits. Currently, as of November 2019, there are over 287 thousand coding sequences deposited at the National Center for Biotechnology Information (NCBI) that are derived from tick salivary gland mRNA. Here, from these 287 thousand sequences we identified 45,264 potential secretory proteins which possess a signal peptide and no transmembrane domains on the mature peptide. By using the psiblast tools, position-specific matrices were constructed and assembled into the TickSialoFam (TSF) database. The TSF is a rpsblastable database that can help with the annotation of tick sialotranscriptomes. The TSA database identified 136 tick salivary secreted protein families, as well as 80 families of endosomal-related products, mostly having a protein modification function. As the number of sequences increases, and new annotation details become available, new releases of the TSF database may become available. |
Frontiers in Cellular and Infection Microbiology. 2020;10:374. | |
| Richards N, Ailsworth S, Patel J, Keshavarz B, Workman L, Platts-Mills T, Wilson J. | 2023 | Longitudinal Alpha-gal IgE Levels in a University of Virginia Employee Cohort. Rationale: The alpha-gal syndrome (AGS) is caused by IgE to galactose-α-1,3-galactose (α-Gal) and is strongly linked to tick bites. To date there have been limited studies on the natural history of AGS and α-Gal sensitization. Here we monitored α-Gal IgE levels over time among sensitized individuals in an employee vaccine cohort unselected for allergic disease. Methods: University of Virginia employees were recruited for an IRB-approved COVID-19 vaccine study. Study subjects provided blood samples and answered a questionnaire capturing medical history including diet and allergy history. α-Gal IgE (cut-off 0.1 kU/L) and total IgE were assayed in banked serum by ImmunoCAP and slopes calculated by linear regression. Results: Of the 266 subjects in the study, 46 (17%) were sensitized to alpha-gal. 38 sensitized subjects had two or more samples separated by at least 100 days. Of these, 68% were female, median age was 55.6 and α-Gal IgE levels dropped over time in 25 (66%). Median rate of decay among subjects with decreasing titers was 53%/year (IQR 46-61). Of the 38 sensitized subjects, 12 (32%) reported interval tick bites over the course of the study. The correlation between α-Gal IgE slopes and total IgE slopes was moderately strong (Pearson’s R = 0.60, P<0.001). . Conclusions: α-Gal IgE levels decrease over time in many subjects, with a median decay rate of 53%/year. Although α-Gal specific IgE is often only a small fraction of total IgE, both track closely with each other over time, likely a reflection of changes in IgE relating to tick bites. |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB92. | Natural history of alpha-gal syndrome; decline in IgE; decay rate |
| Richards N, Keshavarz B, Workman L, Patel J, Platts-Mills T, Wilson J. | 2021 | Prevalence of α-Gal IgE and Mammalian Meat Allergy in a COVID-19 Vaccine Employee Cohort. Rationale: The α-Gal syndrome (AGS) is a tick-acquired allergic disorder caused by IgE to galactose-α-1,3-galactose (α-Gal). To date, most studies on AGS come from case-control studies and there is limited information about the prevalence of alpha-gal sensitization and allergy in the community. Here we addressed these questions in an employee vaccine cohort. Methods: Adults affiliated with the University of Virginia were recruited as part of an IRB-approved COVID-19 antibody study. All participants had received at least one FDA-EUA approved COVID-19 vaccine. Allergic disease was not considered in inclusion or exclusion criteria and subjects provided a blood sample and answered a questionnaire about medical and dietary history. Total IgE and IgE to α-Gal were assayed by ImmunoCAP. Results: Of 232 subjects, median age was 42 (IQR 32-54), 178 (77%) were female, 5 (2.2%) reported mammalian meat allergy and 35 (15.1%) had IgE to α-Gal ≥0.1 kUA/L. Compared to non-sensitized subjects, α-Gal sensitized subjects were older (median age 57 vs 40, p<0.001) and had higher levels of total IgE (GM 49 IU/mL vs 19 IU/mL, p=0.002), but rates of asthma, allergic rhinitis and atopic dermatitis were similar. Of the 35 sensitized subjects, 4 (11%) reported mammalian meat allergy whereas 26 (74%) routinely consumed mammalian meat at least once a week and none reported recurrent hives. Conclusions: In this unselected cohort from central Virginia, the prevalence of α-Gal sIgE was 15.1% but self-reported mammalian meat allergy was 2.2%. Consistent with other reports, many subjects who are sensitized to α-Gal tolerate mammalian meat without obvious allergic symptoms. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB207. | United States, Virginia, prevalence, sensitization vs clinical allergy |
| Richards N, Wilson JM, Platts-Mills T, Richards R. | 2023 | A Retrospective Review of Alpha-gal Syndrome Complicating the Management of Suspected Pancreatic Exocrine Insufficiency in One Gastroenterology Clinic in Central Virginia The alpha-gal mammalian meat allergy, α-gal syndrome, often includes diarrhea, abdominal pain and other gastrointestinal (GI) symptoms. Pancreatic exocrine insufficiency causes similar symptoms. The pancreatic replacement enzymes, referred to here as pancreatic enzymes, used to treat pancreatic insufficiency are porcine products and contain α-gal. Patients with pancreatic insufficiency who also have α-gal syndrome may be intolerant of mammalian products in their diet and of α-gal in pancreatic enzymes. Here we describe 40 patients of one GI clinic in central Virginia with suspected pancreatic insufficiency and elevated α-gal IgE titers. Over 50% of these patients had some clinical improvement with stopping mammalian products in the diet. Most patients could tolerate pancreatic enzymes, 10% could not due to suspected allergy symptoms, but none developed anaphylaxis. An understanding that α-gal syndrome can be superimposed upon pancreatic exocrine insufficiency and exacerbate symptoms, and that treatment with pancreatic enzymes may increase GI and/or allergy symptoms in this group, will lead to improved medical management of this complex patient population. |
Frontiers in Gastroenterology.;2:1162109. | gastroenterology; pancreatic; GI phenotype; GI variant; pharmacy; pharmaceutical; medical products; pancreatic enzyme replacement |
| Richards NE, Ailsworth SM, Workman LJ, Bortz PS, Patel J, MacCallum M, Canderan G, Murphy D, Muehling L, McGowan E, Woodfolk JA. | 2024 | Mammalian Meat Allergy and IgE to Alpha-gal in in Central Virginia: findings from a COVID-19 vaccine and patient cohort. |
The Journal of Allergy and Clinical Immunology: In Practice. 2024 Jun 27. | United States, Virginia, prevalence, sensitization vs clinical allergy |
| Richards NE, Makin T, Smith A, Platts-Mills TA, Richards RD, Wilson JM | 2021 | S537 The α-Gal Mammalian Meat Allergy Manifesting With Isolated Gastrointestinal Symptoms. Introduction: A syndrome of delayed-onset mammalian meat allergy, mediated by IgE antibodies specific for the oligosaccharide galactose-α-1,3-galactose (α-Gal), was first described in 2009. Bites from Amblyomma americanum (the lone star tick) are a dominant cause of α-Gal IgE sensitization, which explains the high prevalence of the “α-Gal syndrome” (AGS) in the southeastern USA. Urticaria and pruritus are classic manifestations of AGS, however many patients also develop gastrointestinal (GI) symptoms. Increasingly we are aware of patients with AGS who present only with GI symptoms. Here we sought to describe the characteristics of these patients. Methods: Retrospective chart review was carried out to identify patients with the following characteristics: i) isolated GI symptoms in the absence of urticaria, severe pruritus or anaphylaxis, ii) evidence of α-Gal IgE sensitization, iii) subjective improvement on a mammalian avoidance diet. The review was performed at an academic allergy clinic and a private GI clinic in central Virginia spanning from September 2019 to June 2021. Results: Thirty five cases were identified in the Allergy practice and 40 in the GI practice. Median age was 63 years and 64% were women. The dominant presentation involved GI pain (83%), often described as cramping. The majority also reported diarrhea (53%), with nausea (33%) and vomiting (9%) being less frequent. The majority of patients did not recognize mammalian meat as a culprit prior to diagnosis. When comparing patients who presented to the GI clinic, patients seen in the Allergy clinic were more likely to report: i) episodes of GI pain/cramping (94% vs 73%), ii) symptoms occurring within 6hrs of eating mammalian meat (51% vs 13%) and iii) history of tick bites (97% vs 53%). Collectively, levels of IgE to α-Gal in these patients were lower than in a previously described cohort of patients with AGS who had urticaria and/or anaphylaxis (GM 1.5 kU/L [95%CI 1.1-2.2] vs GM 16.8 kU/L [13.8-20.5], p< 0.001). Conclusion: Here we present 75 cases of “GI-variant AGS”. These patients presented without classic IgE-mediated symptoms, but were found to be sensitized to α-Gal and reported improvement on a mammal-restricted diet. GI and allergy practitioners in the Southeast and other areas where lone star ticks are endemic should be aware that AGS can present with isolated GI symptoms. Most patients respond to diet of mammalian meat avoidance, but some also benefit from dairy avoidance. |
Official journal of the American College of Gastroenterology| ACG. 2021 Oct 1;116:S244-5. | Gastroenterology; gastrointestinal symptoms; GI variant |
| Richards NE, Richards Jr RD. | 2021 | Alpha-Gal Allergy as a Cause of Intestinal Symptoms in a Gastroenterology Community Practice. Objectives: Immunoglobulin E (IgE) to galactose-α-1,3-galactose (alpha-gal) is a recently appreciated cause of allergic reactions to mammalian meat and dairy. In eastern North America Lone Star tick bites are the dominant mode of sensitization. Classically the alpha-gal syndrome manifests with urticaria, gastrointestinal symptoms, and/or anaphylaxis, but increasingly there are reports of isolated gastrointestinal symptoms without other common allergic manifestations. The objective of this retrospective study was to determine the frequency of IgE to alpha-gal in patients presenting with unexplained gastrointestinal symptoms to a community gastroenterology practice, and to evaluate the symptom response to the removal of mammalian products from the diet in alphagal–positive individuals. Methods: An electronic medical record database was used to identify patients with alpha-gal IgE laboratory testing performed within the past 4 years. These charts were reviewed for alpha-gal test results, abdominal pain, diarrhea, nausea and vomiting, hives, bronchospasm, diagnosis of irritable bowel syndrome, postprandial exacerbation of symptoms, meat exacerbation of symptoms, patient recall of tick bite, other simultaneous gastrointestinal tract diagnoses, and clinical improvement with mammalian food product avoidance. Results: A total of 1112 adult patients underwent alpha-gal IgE testing and 359 (32.3%) were positive. Gastrointestinal symptoms were similar in those positive and negative for alpha-gal seroreactivity. Of the 359 alpha-gal–positive patients, 122 had follow-up data available and 82.0% of these improved on a diet free of mammalian products. Few patients reported hives (3.9%) or bronchospasm (2.2%). Serum alpha-gal IgE titers ranged from 0.1 to >100 kU/L, with an average of 3.43 kU/L and a median of 0.94 kU/L. Conclusions: Clinicians practicing in the region of the Lone Star tick habitat need to be aware that patients with IgE to alpha-gal can manifest with isolated abdominal pain and diarrhea, and these patients respond well to dietary exclusion of mammalian products. |
Southern Medical Journal. 2021 Mar 1;114(3):169-73. | Gastroenterology; gastrointestinal symptoms; GI variant |
| Richards SL, Langley R, Apperson CS, Watson E. | 2017 | Do Tick Attachment Times Vary between Different Tick-Pathogen Systems? Improvements to risk assessments are needed to enhance our understanding of tick-borne disease epidemiology. We review tick vectors and duration of tick attachment required for pathogen transmission for the following pathogens/toxins and diseases: (1) Anaplasma phagocytophilum (anaplasmosis); (2) Babesia microti (babesiosis); (3) Borrelia burgdorferi (Lyme disease); (4) Southern tick-associated rash illness; (5) Borrelia hermsii (tick-borne relapsing fever); (6) Borrelia parkeri (tick-borne relapsing fever); (7) Borrelia turicatae (tick-borne relapsing fever); (8) Borrelia mayonii; (9) Borrelia miyamotoi; (10) Coxiella burnetii (Query fever); (11) Ehrlichia chaffeensis (ehrlichiosis); (12) Ehrlichia ewingii (ehrlichiosis); (13) Ehrlichia muris; (14) Francisella tularensis (tularemia); (15) Rickettsia 364D; (16) Rickettsia montanensis; (17) Rickettsia parkeri (American boutonneuse fever, American tick bite fever); (18) Rickettsia ricketsii (Rocky Mountain spotted fever); (19) Colorado tick fever virus (Colorado tick fever); (20) Heartland virus; (21) Powassan virus (Powassan disease); (22) tick paralysis neurotoxin; and (23) Galactose-alpha-1,3-galactose (Mammalian Meat Allergy-alpha-gal syndrome). Published studies for 12 of the 23 pathogens/diseases showed tick attachment times. Reported tick attachment times varied (<1 h to seven days) between pathogen/toxin type and tick vector. Not all studies were designed to detect the duration of attachment required for transmission. Knowledge of this important aspect of vector competence is lacking and impairs risk assessment for some tick-borne pathogens. |
Environments. 2017 Jun;4(2):37. | |
| Rispens T, Derksen NI, Commins SP, Platts-Mills TA, Aalberse RC. | 2013 | IgE Production to α-Gal Is Accompanied by Elevated Levels of Specific IgG1 Antibodies and Low Amounts of IgE to Blood Group B. IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG and IgE responses to both α-gal and the related blood group B antigen. Contradicting previous reports, antibodies to α-gal were found to be significantly less abundant in individuals with blood group B or AB. Importantly, we established a connection between IgE and IgG responses to α-gal: elevated titers of IgG anti-α-gal were found in IgE-positive subjects. In particular, proportionally more IgG1 anti-α-gal was found in IgE-positive subjects against a background of IgG2 production specific for α-gal. Thus, two types of immune response to α-gal epitopes can be distinguished: a ‘typical’ IgG2 response, presumably in response to gut bacteria, and an ‘atypical’, Th2-like response leading to IgG1 and IgE in addition to IgG2. These results suggest that IgE to a carbohydrate antigen can be formed (probably as part of a glycoprotein or glycolipid) even against a background of bacterial immune stimulation with essentially the same antigen. |
PloS one. 2013 Feb 4;8(2):e55566. | |
| Rispens T. | 2014 | IgE antibodies specific to alpha-gal: an example of clinically relevant cross-reactive anti-carbohydrate antibodies. Correspondence This is a comment on "IgE antibodies to alpha-gal in the general adult population: relationship with tick bites, atopy, and cat ownership." Clin Exp Allergy. 2014 Aug;44(8):1061-8. Red meat allergy is an unusual, novel form of allergy with delayed onset of reactions (anaphylaxis, angioedema or urticaria) several hours after meat consumption and is thought to be primarily mediated by IgE antibodies to gal-α-1, 3-gal-b-1, 4-GlcNAc (α-gal)[1–4]. The α-gal epitope is a carbohydrate structure that is abundantly expressed on many proteins and cellular structures of many mammalian species. Notable exceptions are humans as well as several other primates that lost the ability to express α-gal. |
Clinical & Experimental Allergy. 2014 Aug;44(8):1008-11. | |
| Ristivojević MK, Grundström J, Tran TA, Apostolovic D, Radoi V, Starkhammar M, Vukojević V, Veličković TĆ, Hamsten C, van Hage M. | 2018 | α-Gal on the protein surface affects uptake and degradation in immature monocyte derived dendritic cells. Red meat allergy is characterized by an IgE response against the carbohydrate galactose-alpha-1,3-galactose (alpha-Gal), which is abundantly expressed on glycoproteins from non-primate mammals. The mechanisms of how alpha-Gal is processed and presented to the immune system to initiate an allergic reaction are still unknown. The aim of this study was to reveal whether the presence of alpha-Gal epitopes on the protein surface influence antigen uptake and processing in immature monocyte-derived dendritic cells (iMDDCs). Immature MDDCs were prepared from healthy blood donors and red meat allergic patients. We found an increased internalization of alpha-Gal carrying proteins over time in iMDDCs by flow cytometric analysis, which was independent of the donor allergic status. The uptake of alpha-Gal carrying proteins was significantly higher than the uptake of non-alpha-Gal carrying proteins. Confocal microscopy revealed alpha-Gal carrying proteins scattered around the cytoplasm in most iMDDCs while detection of proteins not carrying alpha-Gal was negligible. Fluorescent detection of protein on SDS-PAGE showed that degradation of alpha-Gal carrying proteins was slower than degradation of non-alpha-Gal carrying proteins. Thus, the presence of alpha-Gal on the protein surface affects both uptake and degradation of the protein, and the results add new knowledge of alpha-Gal as a clinically relevant food allergen. |
Scientific reports. 2018 Aug 23;8(1):1-7. | Europe; Sweden; |
| Ritaccio G, Muratore A, Kakadiya P, McGill S. | 2024 | S109 Itching for Therapy: Alpha-Gal Syndrome as a Cause of Anaphylaxis to Ustekinumab. |
Official journal of the American College of Gastroenterology| ACG. 2024 Dec 1;119(12S):S29. | biologic; monoclonal antibody; ustekinumab; stelara |
| Rizer J, Brill K, Charlton N, King J. | 2017 | † Acute hypersensitivity reaction to Crotalidae polyvalent immune Fab (CroFab) as initial presentation of galactose-α-1,3-galactose (α-gal) allergy. Crotalidae polyvalent immune Fab antivenom (CroFab), commonly used for the treatment of clinically significant North American crotalinae envenomation, is generally well-tolerated. A novel form of anaphylaxis due to an IgE antibody response to the mammalian oligosaccharide galactose-α-1,3-galactose (α-gal) has been established following red-meat consumption as well as IV administration of cetuximab, which contain the α-gal epitope. We present a case of α-gal allergy discovered after acute hypersensitivity reaction to FabAV. A 61-year-old healthy female was bitten on her left ankle by Agkistrodon contortrix. Given the patient's rapid progression of pain and swelling, she was given FabAV. During infusion of FabAV, she developed diffuse hives over her entire body and itching, but denied respiratory or gastrointestinal symptoms and her vital signs remained stable. The FabAV was immediately discontinued and she received intravenous diphenhydramine and famotidine with gradual resolution of symptoms. On further discussion, she denied a history of α-gal or papaya allergy but rarely ate red meat and endorsed sustaining frequent tick bites. Subsequent antibody testing was significant for an galactose-α-1,3-galactose IgE concentration of 45,000U/L (normal <3500U/L), confirming α-gal allergy. To our knowledge, this is the first report of FabAV hypersensitivity associated with an underlying α-gal allergy. |
Clinical Toxicology. 2017 Aug 9;55(7):668-9. | Pharmacy; pharmaceutical; antivenom; antivenin |
| Robison SW. | 2017 | Tick Bites And Delayed Anaphylaxis To Red Meat: Rare Alpha-Gal Allergy In Florida. Accurate identification of a dietary trigger for anaphylaxis can have a dramatic, life saving impact for a patient. Galactose alpha-1,3-galactose is an oligosaccharide found in non-primate mammals, so an allergy to this antigen causes an allergic reaction to mammalian meat and milk products. Diagnosis can be difficult because the allergic reaction is delayed, occurring 3-6 hours after the meal. A 65-year-old gentleman presented to the allergy and immunology clinic for an evaluation of episodes of “spontaneous” anaphylaxis. Per the patient’s report, the episodes began about 10 years ago. They vary in severity: sometimes he only develops urticaria, but other times he develops severe hypotension and is taken to the emergency department. The episodes occur more frequently at night, and he has them a few times per week. They do not occur while eating or directly after eating. He lives in a rural, wooded area in central Florida and has sustained many tick bites, mosquito bites, and bee stings over his life and has not had a reaction associated with insect bites. Allergy skin prick testing to common food allergens done in the office was negative. He had an elevated serum IgE level. Based on the history of tick bites and the possibility of delayed anaphylaxis after meals, he was tested for alpha gal allergy. He was positive for IgE alpha galactose 1,3. He was advised to avoid all mammalian meat products including beef, pork, lamb, and milk. Alpha-gal allergy is a serious allergic reaction (urticaria, angioedema, and/or anaphylaxis) to a specific oligosaccharide, galactose alpha-1,3-galactose, which is a major blood group substance in non-primate mammals. Epidemiologic studies show the highest prevalence in the United States is in the Midwestern and Southeastern states. These states also have the highest prevalence of rickettsial diseases transmitted by the Lone Star Tick or Amblyomma americanum. The proposed mechanism of sensitization is through tick saliva. Interestingly, allergic reactions are typically delayed, occurring 3-6 hours after consuming the animal product. The reason for this is unknown but may be related to lipid absorption. This patient was thought to have “spontaneous” anaphylaxis, but episodes of delayed allergic reaction should be considered. There are not many causes of delayed allergic reaction. Even though Florida has a low prevalence of Lone Star Tick-associated disease, the geographic distribution of this tick is expanding. An accurate diagnosis led to significant diet modifications for this patient which may be life saving. |
ASTHMA AND ALLERGY: CASE SERIES AND REPORTS. 2017 May; A5325-A5325. | |
| Robles J, Motheral L. | 2014 | Hypersensitivity reaction after inhalation of a lactose-containing dry powder inhaler. Milk protein allergy–induced reactions from lactose-containing dry powder inhalers (DPIs) have not been widely described in the literature. Lactose is a common inactive ingredient in many pharmaceutical products that is used to enhance the stability of active substances in medicinal products, including asthma medications. Contamination of lactose with milk proteins has been identified in reports of inhaled corticosteroid product lot testing. Serious respiratory sequelae may follow after the inhalation of a DPI corticosteroid in a patient with milk protein allergy because DPIs that contain lactose may be contaminated with milk proteins. Lactose-containing DPIs are contraindicated in patients with milk protein allergy. Although manufacturers identify this contraindication in product package inserts, some drug references may not include this information and health care professionals may lack awareness. Clinicians should consider reviewing multiple medication resources for warnings and contraindications of medications to prevent complications. We describe a refractory asthma exacerbation secondary to a hypersensitivity reaction following administration of a lactose-containing DPI corticosteroid and long-acting β2 agonist combination in a child with a milk protein allergy. |
The Journal of Pediatric Pharmacology and Therapeutics. 2014;19(3):206-11. | lactose; airborne reactions; inhaler; drugs; medical products |
| Rochlin I, Egizi A, Lindström A. | 2022 | The Original Scientific Description of the Lone Star Tick (Amblyomma americanum, Acari: Ixodidae) and Implications for the Species’ Past and Future Geographic Distributions Amblyomma americanum L. is an important vector in North America originally described by Linnaeus based on Pehr Kalm's 1754 report. While Kalm's 'Travels into North America' is well known, his 1754 report remains obscure. Some authors were skeptical that Kalm referred to A. americanum because he encountered them at sites farther north outside of the species' range. However, the details in 1754 report leave no doubt that Kalm described lone star ticks. In this historical review, we provide support for Kalm's identification using a modern translation of his 1754 report and other sources. We also delineate distributional changes of lone star ticks from the pre-colonization era to the present and interpret them in the context of large-scale anthropogenic changes in the landscape. In this framework, the lone star tick's current northward expansion is a recolonization of their former range. Extensive deforestation and extirpation of their principal host species, white-tailed deer, led to A. americanum's disappearance from the northern parts of its range by the 20th century. Subsequent recolonization by second-growth forest and increases in white-tailed deer populations by the mid-20th century is now allowing A. americanum to reclaim its former range. These changes in the land appear to be the driving force behind A. americanum's present expansion. Understanding this species' history and the factors contributing to its current expansion will enable better predictions about its future distribution and potential to transmit human pathogens. |
Journal of Medical Entomology. 2022 Jan 13. | vector; tick; Amblyomma americanum; geography; distribution |
| Rodenas M, Cuervo-Pardo L, Guarderas JC. | 2019 | Increased Alpha-Gal Allergy In The Northern Florida Region: A Descriptive Cohort. RATIONALE: Prevalence of alpha-gal allergy due to meat allergy is unknown. Tick borne diseases have been reported to be on the rise in Florida. Despite presence of the Amblyomma americanum tick in the region, there is only one case report of alpha-gal allergy in Florida. We provide the clinical profile of a cohort of patients with alpha-gal allergy seen at our tertiary center. METHODS: We performed a retrospective chart review of adult patients with both, meat specific IgE, and detectable alpha-gal IgE evaluated from May 2016 to August 2018. Age, sex, total IgE, alpha-gal IgE as well as available specific IgE against meats or skin test results were collected. Presenting symptoms and presence of atopic disorders were noted. . RESULTS: Twelve patients between ages 25-72 years of age were found to be sensitized to alpha-gal. Average alpha-gal IgE was 20 kU/L. Total IgE ranged from 15-478 kU/L. Most common presenting symptom was hives (n57). Other symptoms included: anaphylaxis, angioedema and GI symptoms. Sensitization to beef and pork was present in 75% of the patients. Sensitization to lamb was less common. While allergic rhinitis was present in 58% of patients, none reported a history of eosinophilic esophagitis or cetuximab treatment. . CONCLUSIONS: Even though meat allergy has been thought to be uncommon, our findings highlight the increased incidence for this condition. Our report stresses the importance of considering alpha-gal sensitization especially when hives is the presenting symptom. We provide the first clinical description of a cohort of patients with alpha-gal sensitization associated with meat allergy in Florida. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB158. | Florida |
| Roenneberg S, Böhner A, Brockow K, Arnold A, Darsow U, Eberlein B, Biedermann T. | 2016 | α-Gal-a new clue for anaphylaxis in mastocytosis. Anaphylactic reactions based on food allergy in patients with systemic mastocytosis have been rarely described. Here, we present the first case of galactose-α-1,3-galactose-associated anaphylaxis in a patient with co-occurring indolent systemic mastocytosis. |
The Journal of Allergy and Clinical immunology. In Practice. 2016 Jan 12;4(3):531-2. | Bohner; "alpha-Gal-a new clue for anaphylaxis in mastocytosis." |
| Román‐Carrasco P, Hemmer W, Klug C, Friedrich A, Stoll P, Focke‐Tejkl M, Altmann F, Quirce S, Swoboda I. | 2020 | Individuals with IgE antibodies to α‐Gal and CCD show specific IgG subclass responses different from subjects non‐sensitized to oligosaccharides. Letter to the editor Two kinds of IgE antibody responses to protein‐linked carbohydrates are known: IgE responses against cross‐reactive carbohydrate determinants (CCDs) present in plants and insect venoms and IgE responses against galactose‐containing determinants occurring in all non‐primate mammals and in New World monkeys.1 Both oligosaccharides are N‐glycans, asparagine‐linked carbohydrate moieties. The major CCD epitope has been defined as core α‐1,3‐linked fucose and the galactose‐containing epitope as galactose‐α‐1,3‐galactose (α‐Gal). There is a striking difference in the IgE antibody responses against these two kinds of carbohydrate moieties: whereas IgE antibodies directed against CCDs appear to lack clinical relevance,2 anti–α‐Gal IgE antibodies trigger delayed allergic reactions after consumption of mammalian meat and/or innards or induce immediate anaphylactic reactions to a recombinant anti‐cancer antibody.1 However, the two anti‐carbohydrate IgE responses also share similarities: whereas the primary cause of sensitization to the α‐Gal epitope is tick bites, by which the carbohydrate is transferred to the patients,1 in individuals with antibodies to CCDs, insect stings seem to be important inducers of anti‐carbohydrate IgE responses.2 Thus, both kinds of anti‐glycan sensitization can be initiated by percutaneous arthropod antigen exposure. To gain a better understanding of the anti‐carbohydrate immune responses, we analysed IgG subclass responses to α‐Gal and CCDs by ELISA in the following groups of patients: (a) patients with IgE antibodies to α‐Gal who reported delayed episodes of urticaria, angioedema, diarrhoea or anaphylaxis after consumption of red meat (n = 22; Table 1), (b) patients with IgE to CCDs (n = 22; Table S1), and (c) fish‐allergic patients without IgE antibodies to carbohydrate moieties, who served as a control group (n = 25) for patients with a protein‐based food allergy. ELISA plates were either coated with α‐Gal coupled to human serum albumin (HSA) to investigate antibody responses to the α‐Gal epitope or with the bromelain N‐glycan MUXF3 coupled to HSA (MUXF3) to study antibody responses to the CCD epitope. MUXF3 was chosen for the experiments, because it contains the N‐glycan structures known to be involved in IgE binding to CCDs (namely α‐1,3‐fucose and β‐1,2‐xylose) and it represents a well‐characterized model CCD, recognized by the vast majority of CCD‐positive patients. To compare the anti‐carbohydrate responses with antibody responses to an allergenic protein, ELISAs were also performed with the recombinant major salmon allergen, rSal s 1. Details on the generation of rSal s 1 and on the performance of the ELISA can be found in the online Supporting Information. ...In summary, the similarities in the IgG1 subclass response between α‐Gal and CCD sensitized patients suggest that some individuals might have a certain predisposition to develop T cell–mediated antibody immune responses against carbohydrates. Class‐switch recombination might then be triggered in these predisposed individuals by additional factors present in the tick saliva or insect venom, which might act as adjuvants, stimulating the production of anti‐carbohydrate IgE antibodies. |
Clinical & Experimental Allergy. 2020 Jun 23. | Roman‐Carrasco, P; cross-reactive carbohydrate determinant; Immunoglobulin; IgG; vector; arthropod; insect; tick; glycan antigen; carbohydrate |
| Román‐Carrasco P, Klug C, Hemmer W, Focke‐Tejkl M, Raith M, Grosinger I, Stoll P, Quirce S, Sanchez‐Jareño M, Martínez‐Blanco M, Molina E. | 2023 | Bos d 13, A Novel Heat-Stable Beef Allergen |
Molecular Nutrition & Food Research. 2023 May 12:2200601. | mammalian meat allergy; red meat allergy; beef allergy; Bos d 13; differential diagnosis |
| Román‐Carrasco P, Lieder B, Somoza V, Ponce M, Szépfalusi Z, Martin D, Hemmer W, Swoboda I. | 2019 | Only alpha-Gal bound to lipids, but not to proteins, is transported across enterocytes as an IgE-reactive molecule that can induce effector cell activation. Background: The oligosaccharide galactose‐α‐1,3‐galactose (α‐Gal), present in mammalian proteins and lipids, causes an unusual delayed allergic reaction 3 to 6 hours after ingestion of mammalian meat in individuals with IgE antibodies against α‐Gal. To better understand the delayed onset of allergic symptoms and investigate whether protein‐bound or lipid‐bound α‐Gal causes these symptoms, we analysed the capacity of α‐Gal conjugated proteins and lipids to cross a monolayer of intestinal cells. Methods: Extracts of proteins and lipids from beef were prepared, subjected to in vitro digestions and added to Caco‐2 cells grown on permeable supports. The presence of α‐Gal in the basolateral medium was investigated by immunoblotting, thin‐layer chromatography with immunostaining and ELISA and its allergenic activity was analysed in a basophil activation test. Results: After addition of beef proteins to the apical side of Caco‐2 cells, α‐Gal containing peptides were not detected in the basolateral medium. Those peptides that crossed the Caco‐2 monolayer did not activate basophils from an α‐Gal allergic patient. Instead, when Caco‐2 cells were incubated with lipids extracted from beef, α‐Gal was detected in the basolateral medium. Furthermore, these α‐Gal lipids were able to activate the basophils of an α‐Gal allergic patient in a dose‐dependent manner. Conclusion: Only α‐Gal bound to lipids, but not to proteins, is able to cross the intestinal monolayer and trigger an allergic reaction. This suggests that the slower digestion and absorption of lipids might be responsible for the unusual delayed allergic reactions in α‐Gal allergic patients and identifies glycolipids as potential allergenic molecules. |
Allergy. 2019 Oct;74(10):1956-68. | Roman‐Carrasco P, Szepfalusi Z, |
| Romeiser JL, Jusko N, Williams AA. | 2024 | Emerging Trends in Information-Seeking Behavior for Alpha-Gal Syndrome: Infodemiology Study Using Time Series and Content Analysis. > |
Journal of Medical Internet Research. 2024 May 8;26:e49928. | trends; Google trends; search patterns |
| Rørvik SD, Alnæs MB, Vikenes BC, Kristiansen T. | 2024 | Anaphylaxis triggered by alpha-gal allergy. |
Tidsskrift for Den norske legeforening. 2024 Jun 17. | Europe; Norway |
| Roster K, Mulvihill H, Lakhi N. | 2023 | A Missed Diagnosis of Alpha-gal Allergy in the Northern United States: A Case Report. |
SKIN The Journal of Cutaneous Medicine. | Minnesota; dermatology; misdiagnosis; tick-borne disease |
| Rowane M, Valencia R, Stewart-Bates B, Casselman J, Hostoffer Jr R. | 2019 | No Bull: A Case of Alpha-Gal Syndrome Associated With Buffalo Meat Sensitivity. Introduction: Alpha (⍺)-gal syndrome (AGS) is an immunoglobulin E (IgE) antibody response against the glycoprotein carbohydrate galactose-⍺-1,3-galactose-β-1-(3)4-N-acetylglucosamine-R (Gal⍺-1,3Galβ1-(3)4GlcNAc-R or ⍺-gal) that is present in Ixodida (tick) saliva and noncatarrhine mammals as well as cetuximab, antivenom, and the zoster vaccine. The most frequently observed anaphylactic reactions in AGS are observed after beef, pork, lamb, and deer meat consumption. We present the first case of anaphylaxis to buffalo meat. Case Report: A 55-year-old man presented with a history of recurrent urticaria that only developed approximately 7 hours after buffalo consumption. The patient denied history of Ixodidae bites but admitted to frequent hiking outdoors. Anti-⍺-1,3-gal IgE was positive (30.80 kU/L). The patient was advised to strictly avoid red meat. . Discussion: The prevalence of AGS has been increased in all continents in the past decade, and several Ixodidae species have been associated with this hypersensitivity. The list of IgE-mediated reactions to various types of meat has expanded to kangaroo, whale, seal, and crocodile, although these have not been associated with AGS. van Nunen only cautioned against consumption of exotic meats, such as buffalo, but no published case report describes AGS associated with anaphylaxis to this type of meat. . Conclusion: AGS is a mammalian meat allergy that has been increasingly prevalent worldwide, especially in Ixodidae endemic regions of Australia and the United States. Multiple AGS case reports published in the past decade demonstrate rapidly increasing understanding of underlying mechanisms provoking ongoing sensitization to help devise management strategies and dietary information. We offer the first case report of delayed anaphylaxis to buffalo meat. |
Allergy & Rhinology. 2019 Dec;10:2152656719893366. | |
| Rubin R. | 2018 | Red Meat Allergy Associated With Coronary Artery Plaque. Funded by the National Heart, Lung, and Blood Institute (NHLBI), scientists from the University of Virginia Health System studied 118 patients who underwent intravascular ultrasound along with cardiac catheterization. The researchers analyzed blood samples from study participants to screen for antibodies to galactose-α-1,3-galactose (alpha-Gal), a complex sugar that is the main allergen in red meat. |
Jama. 2018 Jul 24;320(4):331. | cardiac; cardiology; cardiothoracic surgery; atherosclerosis; cardiovascular; CAD coronary artery disease |
| Ruland KL, Kirzhner M. | 2022 | ENDURAGen graft durability in α-Gal disease. Purpose: We present a case of eyelid reconstruction using ENDURAGen, a porcine-derived acellular collagen graft, complicated by dissolution of the graft in a patient recently diagnosed with α-Gal disease. Observations: A 33-year-old female status post enucleation of the left eye at age 7 struggling with malposition of her prosthesis due to lower lid retraction and laxity underwent eyelid reconstruction with ENDURAGen. She did well post-operatively for 9 months, but then began having issues with prosthesis dislodgement and rotation. Around that time, the patient was diagnosed with α-Gal disease. Repeat eyelid reconstruction was performed, this time with an ear cartilage graft, and dissolution of the original ENDURAGen graft was confirmed. Conclusions and importance: This case highlights the need for evaluation of the durability of ENDURAGen in patients with α-Gal and for caution in choosing porcine or bovine-derived implants for tissue reconstruction in this population. |
American Journal of Ophthalmology Case Reports. 2022 Jun 30:101637. | Ophthalmology |
| Rutherford ME, Stone Jr CA, Kahwash BM, Brazil MS, Siegrist KK. | 2024 | Successful implementation of a multidisciplinary safety protocol in patients with alpha-gal syndrome receiving parenteral anticoagulation: A case series. |
JCA Advances. 2024 Nov 2:100074. | |
| Rutkowski K, Sowa P, Mroczko B, Pancewicz S, Rutkowski R, Czupryna P, Groblewska M, Łukaszewicz-Zając M, Moniuszko-Malinowska A. | 2022 | Sensitisation and allergic reactions to alpha-1, 3-galactose in Podlasie, Poland, an area endemic for tick-borne infections. PURPOSE: Ticks transmit several pathogens and seem implicated in the production of specific IgE antibodies to alpha-1,3-galactose (α-gal sIgE). They cause delayed and immediate allergy to mammalian meat and medication including antivenoms, vaccines and monoclonal antibodies. METHODS: We assessed the prevalence of α-gal sIgE in forest workers and healthy controls in the Podlasie voivodeship, north-eastern Poland; the relationship between α-gal sIgE and allergy to α-gal-containing products; the correlation between α-gal sIgE and anti-Borrelia burgdorferi and anti-tick-borne encephalitis virus (TBEV) antibodies; the relationship between α-gal sIgE and markers of infection with lesser-known pathogens transmitted by ticks such as Anaplasma phagocytophilum. . RESULTS: Production of α-gal sIgE was closely related to tick bites. The odds ratio for detectable α-gal sIgE was 9.31 times higher among people with a history of tick bites (OR 9.3; p < .05). There was no correlation with the history of TBE, Lyme disease or human granulocytic anaplasmosis. However, serum α-gal sIgE correlated with anti-TBEV IgM antibodies in CSF. There was a strong correlation between α-gal sIgE and total IgE and sIgE to pork and beef. . CONCLUSIONS: Our data support the link between I.ricinus ticks and the production of α-gal sIgE and confirm that the pathogens carried by ticks we examined for do not seem implicated in this immune response. |
Infectious Diseases. 2022 Apr 5:1-8. | Europe; Poland; Flavivirus; Flaviviridae; asymptomatic |
| Rutkowski K, Wagner A, Rutkowski R, Sowa P, Pancewicz S, Moniuszko‐Malinowska A. | 2020 | § Alpha‐gal syndrome: an emerging cause of food and drug allergy. Alpha‐gal syndrome (AGS) describes a wide spectrum of hypersensitivity reactions mediated by specific IgE to the α‐gal epitope (galactose‐α‐1,3‐galactose) ubiquitously expressed on glycolipids/glycoproteins of most mammals. This fascinating new entity has completely changed the paradigms of allergy as allergic response is directed against an oligosaccharide and the reactions can be both immediate and delayed. They appear to be stimulated only by tick bites which induce production of α‐gal specific IgE antibodies that lead to (at times fatal) hypersensitivity response. AGS is completely different to previously described anaphylaxis to tick saliva. It provides unique insight into the interplay between different arms of the immune system and the role of ectoparasites in the development of anaphylaxis to food and medication in patients at risk of tick bites including travellers. This review summarises recent advances in our understanding of its clinical presentation, pathomechanism and role of various tick species in the development of AGS. |
Clinical & Experimental Allergy. 2020 Aug;50(8):894-903. | review article |
| Saadalla A, Jacela J, Poll R, Slev P. | 2024 | Immunoassay Testing of Alpha-Gal Specific Immunoglobulin-E: Data from a National Reference Laboratory. |
The Journal of Applied Laboratory Medicine. 2024 Mar;9(2):262-72. | surveillance; epidemiology; blood; immunoassay |
| Safaie P, Ham M, Kuang P, Mehta AS, Wang M, Cheifetz AS, Robson S, Lau D, Block TM, Moss AC. | 2013 | Lectin-reactive Anti-α-Gal in Patients with Crohn's Disease: Correlation with Clinical Phenotypes. Background: Patients with inflammatory bowel disease have higher proportions of immunoglobulin G (IgG) antibodies lacking N-galactose, also called agalactosyl IgG, in their serum. Such agalactosyl IgGs have been associated with disease activity and the immunogenicity of biologics. The aim was to describe the relationship between circulating levels of a subset of agalactosyl IgGs (anti-α-Gal) and Crohn's disease (CD) phenotypes. . Methods: Prospectively collected serum samples of a well-characterized cohort of patients with inflammatory bowel disease and controls were used. Serum anti-α-Gal levels were measured by a high-affinity enzyme-linked immunosorbent assay and referenced to a standard control. . Results: Serum samples from 167 subjects were tested; 62 with CD, 76 with ulcerative colitis, and 29 controls. Agalactosyl anti-α-Gal levels were significantly higher in active CD than in active ulcerative colitis (P = 0.0043) or healthy controls (P < 0.0001). Among patients with CD, agalactosyl anti-α-Gal levels were significantly higher in those with a history of arthritis, than those without (P = 0.0002), but lower in those taking immunomodulators (P = 0.03). There was no correlation between agalactosyl anti-α-Gal levels and indices of Crohn's severity, including C-reactive protein levels or Harvey–Bradshaw index. Patients who were primary or secondary nonresponders to infliximab had similar agalactosyl anti-α-Gal levels to clinical responders. . Conclusions: Patients with CD have greater amounts of agalactosylated anti-α-Gal antibodies in their serum, particularly in those with associated joint disease. This increase seems to be independent of indices of disease activity, but is influenced by immunomodulator use. |
Inflammatory bowel diseases. 2013 Dec 1;19(13):2796-800. | autoimmune disease; inflammatory bowel disease; IBD; Crohn's; ulcerative colitis; joint disease |
| Saleem M, Nilsson C. | 2021 | A pediatric case of tick‐bite–Induced meat allergy and recall urticaria. Alpha‐gal syndrome should be suspected also in children in case of typical allergic symptoms in the evening or night during tick seasons and the event of recall urticaria. It is, however, still a challenge for both patients and clinicians. |
Clinical Case Reports. 2021 Sep;9(9):e04773. | |
| Saleh FM, Chandra PK, Lin D, Robinson JE, Izadpanah R, Mondal D, Bollensdorff C, Alt EU, Zhu Q, Marasco WA, Braun SE. | 2020 | A new humanized mouse model mimics humans in lacking α-Gal epitopes and secreting anti-gal antibodies. Mice have been used as accepted tools for investigating complex human diseases and new drug therapies because of their shared genetics and anatomical characteristics with humans. However, the tissues in mice are different from humans in that human cells have a natural mutation in the α1,3 galactosyltransferase (α1,3GT) gene and lack α-Gal epitopes on glycosylated proteins, whereas mice and other nonprimate mammals express this epitope. The lack of α-Gal epitopes in humans results in the loss of immune tolerance to this epitope and production of abundant natural anti-Gal Abs. These natural anti-Gal Abs can be used as an adjuvant to enhance processing of vaccine epitopes to APCs. However, wild-type mice and all existing humanized mouse models cannot be used to test the efficacy of vaccines expressing α-Gal epitopes because they express α-Gal epitopes and lack anti-Gal Abs. Therefore, in an effort to bridge the gap between the mouse models and humans, we developed a new humanized mouse model that mimics humans in that it lacks α-Gal epitopes and secretes human anti-Gal Abs. The new humanized mouse model (Hu-NSG/α-Galnull) is designed to be used for preclinical evaluations of viral and tumor vaccines based on α-Gal epitopes, human-specific immune responses, xenotransplantation studies, and in vivo biomaterials evaluation. To our knowledge, our new Hu-NSG/α-Galnull is the first available humanized mouse model with such features. |
J Immunol. 2020;204(7):1998-2005. | animal model; mouse |
| Saleh H, Embry S, Nauli A, Atyia S, Krishnaswamy G. | 2012 | Anaphylactic reactions to oligosaccharides in red meat: a syndrome in evolution. Objective: While most allergic responses to food are directed against protein epitopes and occur within 30 minutes of ingesting the allergen, recent studies suggest that delayed reactions may occur, sometimes mediated by IgE antibodies directed against carbohydrate moieties. The objective of this review is to summarize the clinical features and management of delayed hypersensitivity reactions to mammalian meat mediated by IgE antibodies to galactose-alpha 1,3-galactose (alpha-gal), an oligosaccharide. Methods: A PubMed search was conducted with MeSH terms: galactosyl-(1,3) galactose, oligosaccharides, cetuximab, allergy/hypersensitivity, and anaphylaxis. Reported cases with alpha-gal-mediated reactions were reviewed. This research study was approved by the Institutional Review Board of East Tennessee State University. Results: Thirty-two cases of adults presenting with red-meat induced allergy thought to be related to oligosaccharides have been reported in the literature so far, making this a rare and evolving syndrome. Most of these patients demonstrated delayed reactions to beef, as was seen in the case reported by us in this manuscript. IgE specific to alpha-gal was identified in most patients with variable response to skin testing with beef and pork. Inhibition studies in some cases showed that the IgE antibodies to beef were directed towards alpha-gal in the meat rather than the protein. The patients often reported history of tick bites, the significance of which is unclear at present. Reactions to cetuximab, a monoclonal antibody, are mediated by a similar mechanism, with IgE antibodies directed against an alpha-gal moiety incorporated in the drug structure. Conclusion: Alpha-gal is an oligosaccharide recently incriminated in delayed anaphylactic reactions to mammalian meats such as to beef, pork, and lamb. It appears that anaphylactic reactions to the anti-cancer biological agent, cetuximab, may be linked mechanistically to the same process. More studies are required to understand the underlying molecular basis for these delayed reactions in specific, and their broader implications for host defense in general. |
Clinical and Molecular Allergy. 2012 Dec 1;10(1):5. | |
| Saleh HS, Chi D, Krishnaswamy G. | 2011 | Anaphylactic Reactions to Oligosaccharides: A New and Evolving Syndrome. RATIONALE: Allergic responses have traditionally been considered as secondary to IgE responses to protein antigens. However, Chung et al recently reported on anaphylactic reactions to cetuximab, related to IgE response directed towards galactose-alpha-1,3-galactose (alpha-gal), an oligosaccharide also present in beef, pork and lamb. In many cases, historical evidence of tick/chigger bites has been reported. Here we report on a 48-year old Caucasian male with presumed anaphylactic reactions to alpha-gal. METHODS: The patient records were reviewed, and laboratory data collected. A PubMed search was conducted with MeSH terms: Beef, pork, allergy, anaphylaxis and galactose-(α1,3) galactose. RESULTS: The patient presented with 2-year history of delayed recurrent urticarial eruptions and dyspnea after red meat ingestion, requiring steroids. These historically followed tick/chigger bites. Total IgE was elevated at 208 U/mL (N=<100). RAST demonstrated low-level positivity to pork and beef (surprisingly) but showed strong reactions to lamb, peanut, soy and alpha-gal (33.00 IU/mL, with normal <0.35: 4+). Tryptase levels were in the normal range. The patient now avoids red meat products, and his symptoms seem to be well controlled. A review of the world literature demonstrated 24 reported cases in the United States and 49 other cases elsewhere. CONCLUSIONS: This patient represents a true case of anaphylactic reactions to beef mediated predominantly by IgE to alpha-gal, an oligosaccharide. Uniquely our patient had low levels of specific IgE to beef and pork, foods responsible for most of his allergic symptoms. This suggests that a population of allergic individuals might respond to alpha-gal rather than meat proteins. |
Journal of Allergy and Clinical Immunology. 2011 Feb 1;127(2):AB245. | Tennessee |
| Saleh MN, Allen KE, Lineberry MW, Little SE, Reichard MV. | 2021 | Ticks infesting dogs and cats in North America: Biology, geographic distribution, and pathogen transmission. |
Veterinary Parasitology. Veterinary Parasitology. | North America; vector; tick'; Ambylomma americanuum; Ixodes scapularis; lone star tick; black-legged tick; dog; cat |
| Salzer J, Binder A, Jones E, Biggerstaff B, Armstrong P, Heitman KN, Choudhary S, Beard C, Petersen L, Commins S, Kersh G. | 2022 | Association Between Tick Bites and Alpha-gal Syndrome: A Case-Control Study. Rationale: Alpha-gal syndrome (AGS) is an immunoglobulin-E (IgE)-mediated allergy to galactose-alpha-1,3-galactose (alpha-gal), found in mammalian meat and products. In the United States, reports suggest exposure to lone star ticks predisposes to AGS, but epidemiological evidence is lacking. Methods: We performed a case-control study with patients aged ≥18 years presenting for diagnosis or management of AGS at an allergy clinic in North Carolina during 2018–2020 and compared them to controls enrolled at a nearby internal medicine clinic. An interviewer-administered questionnaire gathered epidemiologic and tick exposure data in the year prior to AGS onset (case-patients) or time of enrollment (controls), and blood was obtained for alpha-gal-specific IgE (sIgE) testing. Results: Eighty-two case-patients (98% positive for alpha-gal sIgE ≥0.1 kU/L positive) and 191 controls (33% positive for alpha-gal sIgE) were enrolled; they did not differ by age or sex, but case-patients were less likely to report Black race (2% vs.14%; OR [95% CI]: 0.2 [0.04–0.6]). Nearly all case-patients (94%) reported tick bite in the year before AGS onset compared to 54% of controls (OR [95% CI]: 12.7 [5.0–32.0]); 71% of case-patients reported AGS-associated anaphylaxis. Conclusions: This is the first comparative study to quantify the association of tick bites with AGS. We found a strong association of self-reported tick bite with AGS, and observed a high percentage of controls with alpha-gal sIgE antibodies. People experiencing tick bites could be at risk for developing this potentially severe allergy. Understanding factors leading to AGS versus asymptomatic sensitization may reveal mechanisms governing IgE responses and food allergy broadly. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB206. | pathology; natural history; tick bites; prevalence; anaphylaxis |
| Samavedam UK, Khodoun M, Wu D, Hogan SP, Finkelman FD. | 2016 | Saturated fatty acids promote allergic (Th2) cytokine responses by activation of unfolded protein response (UPR) and ER stress. Endoplasmic reticulum (ER) stress and an unfolded protein response (UPR) are stimulated by saturated, but not unsaturated fatty acids. We previously showed that saturated medium chain triglycerides (MCT) promote food allergy induction and increase epithelial cell expression of 3 pro-Th2 cytokines, TSLP, IL-25 and IL-33, which stimulate a Th2 cytokine response. These observations led us to hypothesize that the high concentrations of saturated triglycerides in two common food allergens, cow’s milk and chicken eggs, promote food allergy by inducing an epithelial cell UPR response, which in turn, causes these cells to express pro-Th2 cytokines. Indeed, studies with transformed human intestinal epithelial CACO2 cells demonstrated that MCT, egg yolk plasma (the liquid, triglyceride fraction of eggs) and cow’s milk cream each increase expression of the UPR-associated PERK, BiP, CHOP, XBP1 and/or XBP1s genes after 6 hours, followed by increased expression of all 3 pro-Th2 cytokine genes after 24 hours. Each of these stimuli, but not but not protein-rich, lipid-poor egg white, also increase epithelial permeability. Further, the increases in pro-Th2 cytokine expression are blocked by each of 3 UPR inhibitors: metformin, 4PBA and TUCDA, and the egg yolk plasma-induced increase in epithelial permeability is blocked by the only UPR inhibitor tested (metformin). Additionally, monoclonal antibodies (mAbs) to IL-25, IL-33 and TSLP each individually block the induction of egg white food allergy by a combination of egg white and MCTs, and a combination of these mAbs strongly suppress established egg white food allergy. These observations support our hypothesis and provide an explanation for the strong allergenicity of cow’s milk and chicken eggs. |
J Immunology 2016 May 1; 196(1 Supplement): 123.9 | saturated fat allergenicity unfolded protein response UPR fat-induced allergy |
| Samavedam UK, Morris SC, Khodoun M, Wu D, Potter C, Hogan SP, Finkelman FD. | 2018 | Saturated fat-induced food allergy: A paradigm for unfolded protein response (UPR)-mediated allergic inflammation. Murine food allergy induction and maintenance is promoted by increased epithelial permeability and requires the pro-Th2 cytokines: IL-25, IL-33, and TSLP, but how allergens increase permeability and induce pro-Th2 cytokines is unknown. Saturated fats increase intestinal permeability, promote intestinal epithelial pro-Th2 cytokine expression and induce the UPR in several cell types. Two common food allergens, milk and eggs, contain considerable saturated fat. These observations suggested that saturated fats in food might promote allergy by inducing the UPR, which in turn, induces the pro-Th2 cytokines. To test this, quantitative PCR was used to evaluate the ability of heavy cream and egg yolk plasma (EYP, the fat-containing fraction of egg) to induce UPR-associated and pro-Th2 cytokine gene expression in transformed human intestinal epithelial CACO2 cells. Metformin, 4-PBA and TUDCA were used to block the UPR. EYP and cream, but not protein-rich, lipid-poor egg white, increased CACO2 cell UPR-associated gene expression, followed by increased pro-Th2 cytokine expression. This was blocked by the UPR antagonists and by a lipase antagonist that prevents fat absorption. EYP and cream, but not egg white, also increased epithelial permeability; this was blocked by metformin. In BALB/c mice, food allergy (detected as hypothermia and diarrhea) was induced by skin sensitization with egg white + EYP, followed by oral gavage with egg white + EYP. Metformin and TUDCA each prevented food allergy development and strongly suppressed established food allergy. These observations support our hypothesis and suggest that the saturated fat content of egg and milk contributes to their allergenicity. |
J Immunology 2018; 200 (1 Supplement) 104.14. | saturated fat allergenicity unfolded protein response UPR fat-induced allergy |
| Samraj AN, Pearce OM, Läubli H, Crittenden AN, Bergfeld AK, Banda K, Gregg CJ, Bingman AE, Secrest P, Diaz SL, Varki NM. | 2015 | A red meat-derived glycan promotes inflammation and cancer progression. Significance: We present an unusual mechanism for the well-known association between red meat consumption and carcinoma risk involving the nonhuman sialic acid N-glycolylneuraminic acid (Neu5Gc). We first evaluate the Neu5Gc content of various foods to show that red meats are particularly rich in orally bioavailable Neu5Gc and then investigate human-like Neu5Gc-deficient mice fed this form of Neu5Gc. When such mice were challenged with anti-Neu5Gc antibodies, they developed evidence of systemic inflammation. Long-term exposure to this combination resulted in a significantly higher incidence of carcinomas (five-fold increase) and an association with Neu5Gc accumulation in the tumors. Similar mechanisms may contribute to the association of red meat consumption with other diseases, such as atherosclerosis and type 2 diabetes, which are also exacerbated by inflammation. Abstract A well-known, epidemiologically reproducible risk factor for human carcinomas is the long-term consumption of “red meat” of mammalian origin. Although multiple theories have attempted to explain this human-specific association, none have been conclusively proven. We used an improved method to survey common foods for free and glycosidically bound forms of the nonhuman sialic acid N-glycolylneuraminic acid (Neu5Gc), showing that it is highly and selectively enriched in red meat. The bound form of Neu5Gc is bioavailable, undergoing metabolic incorporation into human tissues, despite being a foreign antigen. Interactions of this antigen with circulating anti-Neu5Gc antibodies could potentially incite inflammation. Indeed, when human-like Neu5Gc-deficient mice were fed bioavailable Neu5Gc and challenged with anti-Neu5Gc antibodies, they developed evidence of systemic inflammation. Such mice are already prone to develop occasional tumors of the liver, an organ that can incorporate dietary Neu5Gc. Neu5Gc-deficient mice immunized against Neu5Gc and fed bioavailable Neu5Gc developed a much higher incidence of hepatocellular carcinomas, with evidence of Neu5Gc accumulation. Taken together, our data provide an unusual mechanistic explanation for the epidemiological association between red meat consumption and carcinoma risk. This mechanism might also contribute to other chronic inflammatory processes epidemiologically associated with red meat consumption. |
Proceedings of the National Academy of Sciences. 2015 Jan 13;112(2):542-7. | glycan antigen; glycan antibody; sialic acid; Neu5Gc; cancer; carcinoma; chronic inflammation; cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Sánchez AG, Alonso-Llamazares A, García-González F, Matala-Ahmed B, Melgar-Reyes CS, Antepara-Ercoreca I. | 2023 | Diagnostic Validity of Specific Immunoglobulin E Levels to alpha-gal in Alpha-gal Syndrome: A Cross-Sectional Analysis. |
Research Square. This is a preprint; it has not been peer-reviewed or published by a journal. | testing; diagnosis; blood test; Ige test; threshold |
| Sangalho I, Palma-Carlos S, Pinto PL, Bartolomé B. | 2023 | Pork-cat syndrome as cause of anaphylactic reaction to well-cooked meat. |
Arq. Asma, Alerg. Imunol. 2023:109-13. | pork-cat syndrome |
| Saretta F, Giovannini M, Mori F, Arasi S, Liotti L, Pecoraro L, Barni S, Castagnoli R, Mastrorilli C, Caminiti L, Marseglia GL. | 2021 | Alpha-Gal Syndrome in Children: Peculiarities of a “Tick-Borne” Allergic Disease. The alpha-gal syndrome is an allergic syndrome that comprises two clinical pictures: an immediate hypersensitivity to drugs containing alpha-gal and a delayed hypersensitivity to the ingestion of red mammalian meat. This allergic syndrome is often under-recognized, and patients are mislabeled with diagnosis as spontaneous urticaria or idiopathic anaphylaxis. Even though less frequently, children could also be of interest, especially in tick-endemic areas. In most cases, a positive anamnesis for tick bites months before the onset of symptoms is recorded. The clinical manifestations could range from asymptomatic cases to severe anaphylaxis. The most frequently used diagnostic test is the determination of specific IgE for alpha-gal. Oral provocation test is usually reserved to unclear cases or to verify tolerance after diet. No long-term follow-up studies have been published, although an elimination diet could lead to a decrease of specific IgE for alpha-gal and a possible reintroduction of some avoided foods. This paper provides a literature review, focused on pediatric age, and an evaluation of available diagnostic tests. We analyze the correlation between tick bites and symptom onset and unfold the different clinical pictures to help clinicians to promptly recognized this syndrome. Lastly, we address unmet needs in this specific allergy. |
Frontiers in pediatrics. 2021;9. | Pediatric; children; Europe; Italy |
| Saretta F, Giovannini M, Mori F, Arasi S, Pecoraro L, Liotti L, Barni S, Castagnoli R, Mastrorilli C, Caminiti L, Novembre E. | 2021 | La sindrome da alpha-gal nell’adulto e nel bambino. La sindrome da alpha-gal (AGS) è una sindrome allergica determinata dalla produzione di IgE specifiche contro l’oligosaccaride galattosio-α-1,3-galattosio. La AGS comprende due quadri clinici distinti: un’ipersensibilità immediata all’esposizione a farmaci contenenti alpha-gal e un’ipersensibilità ritardata dovuta all’ingestione di carne rossa di mammiferi non primati. Nella maggior parte dei casi si registra un’anamnesi positiva per punture di zecca nei mesi precedenti l’insorgenza dei sintomi, con una maggiore incidenza nell’area endemica delle zecche. Le peculiari caratteristiche della AGS determinano spesso un ritardo diagnostico, in particolare nella forma di tipo ritardato. è importante ricordarsi di escludere sempre la AGS in tutti i casi di anafilassi idiopatiche o in caso di reazioni allergiche poco chiare. Le manifestazioni cliniche possono variare da casi asintomatici a gravi quadri di anafilassi. Il test diagnostico più utilizzato è la determinazione delle IgE specifiche per alpha-gal e il rapporto tra IgE specifiche alpha-gal e IgE totali. Il test di attivazione dei basofili sembra possa essere un test utile per discriminare i sensibilizzati dagli allergici sintomatici. Il test di provocazione orale è solitamente riservato a casi poco dubbi o per verificare la tolleranza acquisita nel tempo. Non sono stati finora pubblicati studi di follow-up a lungo termine, anche se una dieta di eliminazione potrebbe portare a una diminuzione delle IgE specifiche per alpha-gal e una possibile reintroduzione di cibi evitati. |
Rivista di Immunologia e Allergologia. 2021; Fascicolo 3 – Anno 2021 | Pediatric; children; Europe; Italy |
| Saunders E, Zychowski D, Pickle EO, Alvarez C, Vorobiov J, Nolan M, Nelson A, Commins S. | 2024 | Alpha-gal Seropositivity Among Screened Cohorts In NC and SC. |
Journal of Allergy and Clinical Immunology. 2024 Feb 1;153(2):AB46. | prevalence NC SC |
| Saunders EF, Sohail H, Myles DJ, Charnetzky D, Ayres BN Nicholson WL, et al. | 2025 | Alpha-gal syndrome after Ixodes scapularis tick bite and statewide surveillance, Maine, USA, 2014–2023. |
Emerg Infect Dis. 2025 Apr [date cited]. | North America; United States; vector; Ixodes scapularis |
| Saunders M, Rival C, Mandal M, Cramton K, Rad LM, Janczak KW, Williams LA, Angadi AR, O'Konek JJ, Shea LD, Erickson LD. | 2024 | Immunotherapy with Biodegradable Nanoparticles Encapsulating the Oligosaccharide Galactose-Alpha-1, 3-Galactose Enhances Immune Tolerance Against Alpha-Gal Sensitization in a Murine Model of Alpha-Gal Syndrome. |
Frontiers in Allergy.;5:1437523. | therapy; management; treatment |
| Schimmel J, Fawaz B, Renzi M, Heymann WR, van Nunen S, Manders S. | 2020 | Mammalian meat allergy-beyond urticaria? Correspondence Herein, we report the case of a patient with MMA presenting with exfoliative erythroderma, which, to our knowledge, has not been previously described. |
Int J Dermatol 2020, 59: e312-e314. | dermatology; skin; rash; erythroderma |
| Schmidle P, Brockow K, Darsow U, Biedermann T, Eberlein B. | 2019 | Strongly positive basophil activation with gelatin-containing vaccines for varicella, zoster, measles, mumps and rubella in patients with alpha-gal syndrome. Background: The alpha-gal syndrome, a new type I allergy entity to the carbohydrate epitope galactose-α-1,3-galactose (α-gal), was first described in 2009. High concentrations of alpha-gal are mainly found in mammalian food products (e.g., beef, pork and venison). Apart from meat products alpha-galcan also be found in products containing gelatin of bovine or porcine origin. Recent case reports pointed to severe anaphylaxis in patients suffering from alpha-gal syndrome after vaccination with vaccines containing hydrolyzed gelatin. It was the objective of this study to evaluate if basophil activation tests (BAT) performed with such vaccines were positive in patients with alpha-gal syndrome. Method: BAT was performed with different dilutions of gelatin-containing vaccines (attenuated varicella-zoster vaccine (VZ vaccine), attenuated varicella vaccine (V vaccine), MMR Sanofi Pasteur MSD, France; measles, mumps and rubella live vaccine (MMR vaccine), Chiron Behring, Germany) in two patients (2 females, 81 and 68 years old) with confirmed alpha-gal syndrome (patient A: anaphylactic reaction to 1.5 g cooked pork kidney in oral provocation test (OPT) and patient B: anaphylactic reaction to 18 g cooked pork kidney in OPT). Additionally, two healthy individuals without any previous medical history for allergies were tested. Results: Patient A (highest basophil activation: 92.1% CD63 expression with undiluted VZ vaccine; 87.3% CD63 expression at a dilution of 1:25 for vaccine; 88.7% CD63 expression at a dilution of 1:125 for MMR vaccine) and B (highest basophil activation: 51.3% CD63 expression at a dilution of 1:5 for VZ vaccine; 62.5% CD63 expression at a dilution of 1:5 for V vaccine; 61.2 % CD63 expression at a dilution of 1:5 for MMR vaccine) both showed positive results for all tested vaccines. The two healthy controls did not show any basophil activation. Conclusion: Both patients with confirmed alpha-gal syndrome showed strongly positive basophil activation for all tested vaccines whereas healthy controls remained negative. Although this test does not prove clinical relevance in real-life situations, these vaccines should be administered with caution in patients with alpha-gal syndrome. It has been postulated that gelatin or other nonprimate mammal-derived products are the triggers. Missing information on the exact amount of gelatin in vaccines might be useful for better risk stratification. Also, BAT might be a useful additional diagnostic tool when it comes to screen for potential patients at risk. |
Allergy. 2019 Aug 1; 74:85-86. | medical products; gelatin; vaccine; vaccination |
| Schmidle P, Mehlich J, Brockow K, Darsow U, Biedermann T, Eberlein B. | 2021 | Gelatin-Containing Vaccines for Varicella, Zoster, Measles, Mumps, and Rubella Induce Basophil Activation in Patients with Alpha-Gal Syndrome. Background: The alpha-gal syndrome (AGS) describes a new type I allergy entity to the carbohydrate epitope galactose-α-1,3-galactose (alpha-gal), which is mainly found in mammalian food products (e.g., beef, pork, and venison). Apart from meat products, alpha-gal can also be found in products containing gelatin of bovine or porcine origin. Recent case reports pointed to severe anaphylaxis in patients suffering from AGS after vaccination with vaccines containing hydrolyzed gelatin. It was the objective of this study to evaluate if basophil activation tests (BATs) performed with such vaccines were positive in patients with AGS. Methods: BAT was performed with different dilutions of a gelatin-containing measles, mumps, and rubella (MMR) live vaccine; an attenuated varicella (V) vaccine; an attenuated V-zoster (VZ) vaccine; a MMR live vaccine not containing gelatin (non-gelatin MMR vaccine) in 2 patients with confirmed AGS, 2 patients highly suspicious for AGS, and 2 healthy individuals without any previous medical history for allergies. Results: All patients showed strongly positive results for all gelatin-containing vaccines (MMR vaccine, V vaccine, and VZ vaccine). Non-gelatin MMR vaccine was negative. The 2 healthy controls did not show any basophil activation. Conclusions: Gelatin-containing vaccines should be administered with caution or avoided in patients with AGS because of their high potential to activate basophils indicating a risk for anaphylaxis. Also, BAT is a useful additional tool when it comes to screening for potentially high-risk alpha-gal-containing drugs. |
International Archives of Allergy and Immunology. 2021;182(8):716-22. | Pharmacology; pharmaceuticals; pharmacy; medical products; vaccine, MMR |
| Schmidle P, Reidenbach K, Kugler C, Eberlein B, Biedermann T, Darsow U. | 2018 | Recall-Urticaria in two patients with Tick-bite Alpha-gal Syndrome. | JOURNAL DER DEUTSCHEN DERMATOLOGISCHEN GESELLSCHAFT 2018 Mar 1; 16: 2-2. | |
| Schmidle P, Reidenbach K, Kugler C, Eberlein B, Biedermann T, Darsow U. | 2019 | Recall urticaria-A new clinical sign in the diagnosis of alpha-gal syndrome. Diagnosis of alpha-gal syndrome remains difficult. Thus, clinical signs such as recall urticaria at the location of previous tick bites may be helpful diagnostic tools, not only as symptoms in clinical history but also for evaluating the results of oral provocation tests. |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 Feb 1;7(2):685-6. | |
| Schuyler AJ, James HR, Rispens T, Workman LJ, Perzanowski MS, Ronmark E, Commins SP, Platts-Mills TA. | 2015 | Quantitative Binding Assay for Measuring Specific IgG Antibodies to Alpha-Gal Using the Neoglycoprotein Gal-alpha-1,3-Gal-beta-1,4-Glcnac-Human Serum Albumin. RATIONALE: Tick bites are known to induce IgE production to alphagal. Elevated alpha-gal IgG1 compared to natural alpha-gal IgG2 production has been reported in alpha-gal IgE+ subjects. We here report further investigation of the relationship between alpha-gal IgG and both reactions to red meat and exposure to ticks. METHODS: IgG from serum was absorbed onto recombinant Protein GSepharose and incubated with radiolabeled allergen. The radioactivity of bound allergen was measured using a gamma counter. A control curve was generated in parallel to assign unitage. Additional testing of serum immunoglobulins was performed via ImmunoCAP and nephelometry. RESULTS: Alpha-gal IgG was measured in a Northern Sweden cohort and in subjects presenting to allergy clinics in Virginia with delayed reactions to red meat. Alpha-gal IgG was significantly higher in alpha-gal IgE+ subjects versus alpha-gal IgE- subjects, and longitudinal serology in several alpha-gal IgE+ subjects demonstrates parallel alpha-gal IgE and IgG response trends. Among the alpha-gal IgE+ subjects, alpha-gal IgG was higher in those with alpha-gal IgE:total IgE ratios >25%, but was not related to reported severity to red meat. Compared to the alpha-gal IgE- subjects in Virginia, alpha-gal IgG was lower in the group from Northern Sweden, where alpha-gal IgEmediated hypersensitivity is absent and ticks are rare. CONCLUSIONS: Alpha-gal IgG is strongly related to alpha-gal IgE and is significantly lower in prevalence and titer in subjects without tick exposure. The absence of a relationship between alpha-gal IgG and severity of reactions to red meat suggests that the alpha-gal syndrome may not be a suitable candidate for conventional immunotherapy. |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB188. | |
| Seddon I, Venincasa M, Farber N, Sridhar J. | 2020 | Alpha-Gal Syndrome in Ophthalmology and Medicine.><br> |
International Ophthalmology Clinics. 2020 Oct 1;60(4):61-75. | Ophthalmology; eye; surgery; perioperative |
| Sekiya K, Fukutomi Y, Nakazawa T, Taniguchi M, Akiyama K. | 2012 | Delayed anaphylactic reaction to mammalian meat. No abstract available |
Journal of investigational allergology & clinical immunology. 2012;22(6):446. | |
| Seko A, Kitajima K, Iwasaki M, Inoue S, Inoue Y. | 1989 | Structural studies of fertilization-associated carbohydrate-rich glycoproteins (hyosophorin) isolated from the fertilized and unfertilized eggs of flounder, Paralichthys olivaceus. Presence of a novel penta-antennary N-linked glycan chain in the tandem repeating glycopeptide unit of hyosophorin. |
Journal of Biological Chemistry. 1989 Sep 25;264(27):15922-9. | fish eggs; fish roe; flounder roe; Olive Flounder; Paralichthys olivaceous; hirame |
| Sell-Dottin, K., Sola, Michael and Caransos, Tomas G. | 2017 | Impact of Newly Emerging Alpha-Gal Allergies on Cardiac Surgery: A Case Series. The influence of alpha-gal allergies on cardiothoracic surgery is largely unknown. Allergic responses to galactose-alpha-1, 3-galactose, or “alpha-gal”, are due to antibodies against non-primate mammalian proteins and are mediated by IgE. This allergy has only recently been discovered and is increasingly prevalent, upwards of 20%-25% of the general population in the southeast United States is sensitized to alpha-gal. Due to the exposure of patients to significant amounts of alpha-gal containing heparin during the course of cardiopulmonary bypass, this allergy may have significant implications for patients undergoing cardiac surgery. We provide a four case series from a single institution detailing successful cardiac surgery in four patients with known alpha gal allergies. These cases demonstrate that pre-treatment with diphenhydramine and steroids may help attenuate serious allergic reactions and allow cardiac surgery to be performed more safely. |
Clin Surg. 2017;2:1477. | cardiac surgery; cardiothoracic surgery; perioperative care; anesthesiology; anesthesia; pharmaceutical; pharmacy; heparin; hemostatic agent; albumin |
| Senage T, Paul A, Le Tourneau T, Fellah-Hebia I, Vadori M, Bashir S, Galiñanes M, Bottio T, Gerosa G, Evangelista A, Badano LP. | 2022 | The role of antibody responses against glycans in bioprosthetic heart valve calcification and deterioration. Bioprosthetic heart valves (BHVs) are commonly used to replace severely diseased heart valves but their susceptibility to structural valve degeneration (SVD) limits their use in young patients. We hypothesized that antibodies against immunogenic glycans present on BHVs, particularly antibodies against the xenoantigens galactose-α1,3-galactose (αGal) and N-glycolylneuraminic acid (Neu5Gc), could mediate their deterioration through calcification. We established a large longitudinal prospective international cohort of patients (n = 1668, 34 ± 43 months of follow-up (0.1–182); 4,998 blood samples) to investigate the hemodynamics and immune responses associated with BHVs up to 15 years after aortic valve replacement. Early signs of SVD appeared in <5% of BHV recipients within 2 years. The levels of both anti-αGal and anti-Neu5Gc IgGs significantly increased one month after BHV implantation. The levels of these IgGs declined thereafter but anti-αGal IgG levels declined significantly faster in control patients compared to BHV recipients. Neu5Gc, anti-Neu5Gc IgG and complement deposition were found in calcified BHVs at much higher levels than in calcified native aortic valves. Moreover, in mice, anti-Neu5Gc antibodies were unable to promote calcium deposition on subcutaneously implanted BHV tissue engineered to lack αGal and Neu5Gc antigens. These results indicate that BHVs manufactured using donor tissues deficient in αGal and Neu5Gc could be less prone to immune-mediated deterioration and have improved durability. |
Nature Medicine. 2022 Feb 17:1-2. | cardiac surgery; cardiothoracic surgery; perioperative care; anesthesiology; anesthesia; pharmaceutical; pharmacy; bioprosthetic heart valve; anti-gal; Neu5Gc |
| Serrier J, Davy JB, Dupont B, Clarisse B, Parienti JJ, Petit G, Khoy K, Ollivier Y, Gervais R, Mariotte D, Le Mauff B. | 2023 | Validation of an anti-α-Gal IgE fluoroenzyme-immunoassay for the screening of patients at risk of severe anaphylaxis to cetuximab |
BMC cancer. 2023 Dec;23(1):1-9. | Cancer; oncology; cetuximab; testing; |
| Serrier J, Khoy K, Ollivier Y, Gervais R, Le Moel G, Lafosse M, Johnson A, Le Mauff B, Mariotte D. | 2021 | Recurrent anaphylaxis to a gelatin-based colloid plasma substitute and to cetuximab following sensitisation to galactose-alpha-1, 3-galactose. Editor—Galactose-alpha-1-3-galactose (α-Gal) is a ubiquitous epitope, part of many mammalian glycoproteins and glycolipids found in food and in some animal-derived drugs (e.g. gelatin-based colloids) or in α-Gal glycosylated chimeric monoclonal antibodies, such as cetuximab, used for treatment of metastatic colorectal cancer or head and neck squamous cell carcinoma. 1 Pre-existing immunoglobulin E (IgE) directed against the α-Gal epitope has been linked to severe immediate hypersensitivity reactions to cetuximab, 1 ,2 and severe allergic reactions to red meat (α-Gal syndrome) 3 and to gelatin, including gelatin-based colloid plasma substitute. 4 We report a case of a patient who developed three severe reactions to gelatin-based colloid plasma substitute and cetuximab (with the patient's consent). A 43-yr-old man, with no history of allergy, underwent pharyngolaryngectomy in July 2014 for laryngeal squamous cell carcinoma. The anaesthesia protocol included i.v. remifentanil, propofol, ketamine, succinylcholine, lidocaine, cefotaxime, hydrocortisone, atracurium, phenylephrine, norepinephrine, cefuroxime, and trimethoprim–sulphamethoxazol. Gelatin-based colloid plasma substitute (Gelofusine®, Braun Melsungen AG) was infused to correct hypovolaemia, followed 10 min later by major arterial hypotension (57/27 mm Hg), tachycardia, circulatory shock, and oxygen desaturation with cyanosis. He was treated with epinephrine and i.v. fluid therapy with a favourable outcome. High plasma concentrations of tryptase (ThermoFisher, Phadia AB, Uppsala Sweden; increased value ≥1.2 × basal value+2 μg L−1) 5 were measured: 16.1 μg L−1; basal value: 1.8 μg L−1. Histamine concentration also increased at 553 nmol L−1 (Beckman Coulter Immunotech, Marseille, France; threshold >10 nmol L−1). Specific IgE to succinylcholine and quaternary ammonium morphine (ImmunoCAP®; ThermoFisher, Phadia SAS; normal value <0.1 kilo units of allergen [kUA] L−1) were negative. Skin tests performed 3 months later with all the administered drugs and latex were negative except for Gelofusine with a positive prick test and intradermal tests (1:1000 to 1:10 diluted solutions). The allergist concluded anaphylaxis to Gelofusine |
British Journal of Anaesthesia. 2021 Jun 1;126(6):e200-2. | Pharmacy; pharmaceutical; drug; medical product; monoclonal antibody; cetuximab; plasma volume expander; Gelofusine; anesthesia; perioperative |
| Shah K, George R, Srivastava P, Lum MD, Vorkas CK, Navetta-Modrov B, Marcos LA. | 2025 | P-2242. Tick-borne Illness Seroprevalence and Meat Allergy (Alpha-Gal Syndrome): A Series of 15 Cases in Long Island, NY. |
InOpen Forum Infectious Diseases 2025 Jan 29 (Vol. 12, No. Suppl 1, pp. ofae631-2395). | ratio alpha-gal IgE to total IgE; testing; severity; NY; Long Island |
| Shah R, Schwartz RA. | 2022 | Meat Allergy: A Ticking Time Bomb. Food allergies are relatively prevalent, but mammalian meat allergy remains uncommon and represents an important, potentially acute healthcare risk. This risk is partly because both clinicians and the public lack awareness of this serious allergy, which is unique in three important ways: it incurs a delayed reaction, it is induced by a carbohydrate rather than a protein, and it is linked to tick bites. Although various symptoms are possible, its unique presentation means that mammalian meat allergy is often presented to the dermatologist. We review this challenging subject, which is particularly salient considering the unique connection between ticks and mammalian meat allergy, the expanding tick territory, and the dependency by so many on meat products, not only in the diet but also in medications and medical devices. |
American Journal of Clinical Dermatology. 2022 May 16:1-7. | dermatology |
| Shaker M, Abrams EM, Oppenheimer J, Anagnostou A, Codispoti CD, Golden DB, Greenhawt M, Stukus D, Moore-Clingenpeel M, Hughes SW, Mack DP. | 2024 | Food sensitization and cardiovascular mortality: An intriguing association in need of further study. |
Journal of Allergy and Clinical Immunology. 2024 Jan 22. | atherosclerosis; cardiovascular disease; CVD |
| Shan Y, Xu L, Ke L, Lu Y, Shao A, Zhang N, Zeng B. | 2015 | Assessment Method of Remnant alpha-1, 3-galactosyle Epitopes in Animal Tissue-derived Biomaterials. The aim of this study was to establish an assessment method for determining alpha-Gal (alpha-1, 3-galactosyle) epitopes contained in animal tissue or animal tissue-derived biological materials with ELISA inhibition assay. Firstly, a 96 well plate was coated with Gal alpha-1, 3-Gal/bovine serum albumin (BSA) as a solid phase antigen and meanwhile, the anti-alpha-Gal M86 was used to react with alpha-Gal antigens which contained in the test materials. Then, the residual antibodies (M86) in the supernatant of M86-Gal reaction mixture were measured using ELISA inhibition assay by the alpha-Gal coating plate. The inhibition curve of the ELISA inhibition assay, the R2 = 0.999, was well established. Checking using both alpha-Gal positive materials (rat liver tissues) and alpha-Gal negative materials (human placenta tissues) showed a good sensitivity and specificity. Based on the presently established method, the alpha-Gal expression profile of rat tissues, decellular animal tissue-derived biological materials and porcine dermal before and after decellular treatment were determined. The M86 ELISA inhibition assay method, which can quantitatively determine the alpha-Gal antigens contained in animal tissues or animal tissue-derived biomaterials, was refined. This M86 specific antibody based-ELISA inhibition assay established in the present study has good sensitivity and specificity and could be a useful method for determining remnant alpha-1, 3Gal antigens in animal tissue-derived biomaterials. |
Journal of biomedical engineering. 2015 Jun 1; 32(3):662-8. | |
| Shao Y, Yu Y, Pei CG, Qu Y, Gao GP, Yang JL, Zhou Q, Yang L, Liu QP. | 2012 | The expression and distribution of α-Gal gene in various species ocular surface tissue. AIMTo examine the α-Gal gene expression and distribution in the different species/genus and developing phase animal ocular surface tissue. METHODSα-Gal binding assay were carried out on various animal eye sections. Photograph, slit-lamp observation on various eye showed normal corneal transparence. RESULTSA strong α-Gal expression in invertebrates and some vertebrates ocular tissue, but no α-Gal binding in birds, fish and mammal. α-Gal expression change in the development of mice ocular surface tissue (except sclera) and display genus dependency in the different murine ocular surface tissue. CONCLUSIONThis study identified specific α-Gal epitopes binding area in the ocular surface of several species and may solve the problem that naive ocular surface may be used as natural α-Gal gene knockout model/high risk immunologic rejection model or ocular surface scaffold material. |
International journal of ophthalmology. 2012;5(5):543. | reptile; amphibian; fish |
| Sharma R, Cozens DW, Armstrong PM, Brackney DE. | 2021 | Vector competence of human-biting ticks Ixodes scapularis, Amblyomma americanum and Dermacentor variabilis for Powassan virus. |
Parasites & Vectors. 2021 Dec;14(1):1-8. | Tickborne disease; tick borne disease; powassan virus; powassan fever; Amblyomma americanum; lone star tick; differential |
| Sharma SR, Choudhary SK, Vorobiov J, Commins SP, Karim S. | 2024 | Tick bite-induced alpha-gal syndrome and immunologic responses in an alpha-gal deficient murine model. |
Frontiers in Immunology. 2024 Feb 8;14:1336883. | vector; tick; Amblyomma americanum; Amblyomma maculatum; mechanism; pathogenesis |
| Sharma SR, Crispell GP, Mohamed A, Cox C, Lange J, Choudhary SK, Commins SP, Karim S. | 2021 | Alpha-Gal Syndrome: Involvement of Amblyomma americanum α-D-galactosidase and β-1, 4 Galactosyltransferase enzymes in α-gal metabolism. Alpha-Gal Syndrome (AGS) is an IgE-mediated delayed-type hypersensitivity reaction to the oligosaccharide galactose-α-1,3-galactose (α-gal) injected into humans from the lone star tick (Amblyomma americanum) bite. This study aims at the functional characterization of two tick enzymes, α-D-galactosidase (ADGal) and α-1,4 galactosyltransferase (β-1,4GalT) in α-gal metabolism. The ADGal enzyme cleaves terminal α-galactose moieties from glycoproteins and glycolipids, whereas β-1,4GalT transfers α-galactose to a β1,4 terminal linkage acceptor sugars: GlcNAc, Glc, and Xyl in various processes of glycoconjugate synthesis. An RNA interference approach was utilized to silence ADGal and β-1,4GalT in Am. americanum to examine their functional role in α-gal metabolism and AGS onset. Silencing of ADGal led to the significant down regulation of genes involved in galactose metabolism and transport in Am. americanum. Immunoblot and N-glycan analysis of the Am. americanum salivary glands showed a significant reduction in α-gal levels in silenced tissues. However, there was no significant difference in the level of α-gal in β-1,4GalT silenced tick salivary glands. A basophil-activation test showed a decrease in the frequency of activated basophil by ADGal silenced salivary glands. These results provide an insight into the role of α-D galactosidase & β-1,4GalT in tick biology and the probable involvement in the onset of AGS. |
bioRxiv. 2021 Jan 1. | |
| Sharma SR, Hussain S, Choudhary SK, Commins SP, Karim S. | 2024 | Identification of Alpha-Gal conjugated Lipids in Saliva of Lone-Star Tick (Amblyomma americanum). | bioRxiv. 2024:2024-02. | |
| Sharma SR, Karim S. | 2021 | Tick saliva and the alpha-gal syndrome: finding a needle in a haystack. Ticks and tick-borne diseases are significant public health concerns. Bioactive molecules in tick saliva facilitate prolonged blood-feeding and transmission of tick-borne pathogens to the vertebrate host. Alpha-gal syndrome (AGS), a newly reported food allergy, is believed to be induced by saliva proteins decorated with a sugar molecule, the oligosaccharide galactose-⍺-1,3-galactose (α-gal). This syndrome is characterized by an IgE antibody-directed hypersensitivity against α-gal. The α-gal antigen was discovered in the salivary glands and saliva of various tick species including, the Lone Star tick (Amblyomma americanum). The underlying immune mechanisms linking tick bites with α-gal-specific IgE production are poorly understood and are crucial to identify and establish novel treatments for this disease. This article reviews the current understanding of AGS and its involvement with tick species. |
Frontiers in Cellular and Infection Microbiology. 2021;11:658. | Tick; saliva |
| Sharma SR. | 2023 | CHARACTERIZATION OF TICK AND HOST-ASSOCIATED FACTORS LINKED TO INDUCTION OF ALPHA-GAL SYNDROME. |
Dissertation | ticks; tick saliva; cause |
| Shepherd M, Kewin P, Christogiani K, Carmichael J. | 2020 | P048 Increasing incidence of mammalian meat allergy over 10 years mirrors the rising deer tick population in Scotland Objectives: Mammalian meat allergy (MMA) is rare in the UK. Recent evidence linking MMA to arthropod saliva exposure, suggests a relationship with deer tick numbers in Scotland. Scottish tick populations have risen over the past 20 years through changing land use and warming climate. We hypothesised that this rise would be mirrored by an increasing incidence of MMA and that this would be mediated by specific IgE directed to galactose-alpha-1,3-galactose residues (alpha-gal). Method: We conducted a retrospective analysis of adults with food allergy using records of specific IgE requests between 2005–07 and 2015–17. We identified MMA-specific IgE requests and used chicken meat allergy as a non-vector transmitted control. We compared clinical and demographic details of MMA- and CMA-positive cases examining rurality, recreational pursuits and nature of incident reaction. Meat allergy was diagnosed by a compatible history, positive sIgEs and skin tests to meat. Results: In West central Scotland we identified 2 cases of MMA between 2005–07 and 9 cases between 2015–17, (4-5 fold increase). In contrast, CMA rose from 2 cases to 4 cases while the case load for the adult allergy service rose by 27%. Eight MMA cases were alpha-gal-positive; 7 reported regular recreation or employment in rural regions of Scotland and all recalled receiving tick bites. All 8 alpha-gal-positive cases reported > 2.5-hour delay between meat consumption and symptom onset while 6 described allergy co-factor exposure. The earlier MMA cases described a delay in clinical onset typical of the alpha-gal MMA syndrome. Conclusions: In conclusion, we find that MMA allergy remains a rare but increasing problem in Scotland. This change is closely related to tick exposure. Changing land use for deer farming and recreation means that both rural and urban populations are at risk. Alcohol and exercise are significantly related to severity of reaction in our patients |
BRITISH SOCIETY FOR ALLERGY AND CLINICAL IMMUNOLOGY, ABSTRACTS OF THE 2019 ANNUAL MEETING, ORAL PRESENTATIONS, CATEGORY ADULT CLINICAL | Europe; UK; Scotland; prevalence |
| Shiratsuki R, Chinuki Y, Fukushiro S, Morita E. | 2020 | A Case of Pork-cat Syndrome That Developed as Food-dependent Exercise-induced Anaphylaxis. No abstract available |
Acta Dermato-venereologica. 2020 Jul 3. | |
| SHOJI H, TAKAHASHI N, NOMOTO H, ISHIKAWA M, SHIMADA I, ARATA Y, HAYASHI K. | 1992 | Detailed structural analysis of asparagine‐linked oligosaccharides of the nicotinic acetylcholine receptor from Torpedo californica. |
European journal of biochemistry. 1992 Jul;207(2):631-41. | Non-mammalian; fish; cartilaginous fish; Torpedo; ray; nicotinic acetylcholine receptor |
| Shroba J, Rath N, Barnes C. | 2018 | Possible Role of Environmental Factors in the Development of Food Allergies. The development of food allergies is thought to involve multiple factors, and it is unclear which conveys the most risk regarding this process. Since food allergy is a chronic disease without a cure at this time, understanding its development could provide an avenue for preventive practices and development of a curative treatment. Both historical and current data implicate maternal factors, genetics, and environmental exposures as major risk factors in the development of food allergy. An immature gut of the infant has been hypothesized as a possible route of sensitization. Breastfeeding until at least 6 months of age has been shown to have protective factors for the newborn and may possibly improve gut permeability. Newer studies such as the LEAP and EAT investigations also looked at early exposure and prevention of food allergies; their long-term results are critical in understanding early introduction and tolerance. Cutaneous exposure, oral exposure, and food protein exposure in house dust with their relation to the food allergy course are also a path of interest. Current research has shown sensitization can occur through impaired skin such as those with eczema and a filaggrin mutation. Tropomyosin and alpha-gal also are related to the complicated immunomodulatory factors involved in food allergy and allergic response. Cross-reactivity with plant allergens, sensitization to house dust mite and cockroach, and lone star tick bites can also induce food allergens in children and adults. Together, these factors provide a cohesive beginning to understanding how food allergies can occur and can influence further investigation into prevention, treatment, and eventual cure of food allergies. |
Clinical reviews in allergy & immunology. 2014 Jun 1;46(3):225-40. | |
| Sicherer SH, Sampson HA. | 2014 | Food allergy: Epidemiology, pathogenesis, diagnosis, and treatment. This review focuses on advances and updates in the epidemiology, pathogenesis, diagnosis, and treatment of food allergy over the past 3 years since our last comprehensive review. On the basis of numerous studies, food allergy likely affects nearly 5% of adults and 8% of children, with growing evidence of an increase in prevalence. Potentially rectifiable risk factors include vitamin D insufficiency, unhealthful dietary fat, obesity, increased hygiene, and the timing of exposure to foods, but genetics and other lifestyle issues play a role as well. Interesting clinical insights into pathogenesis include discoveries regarding gene-environment interactions and an increasing understanding of the role of nonoral sensitizing exposures causing food allergy, such as delayed allergic reactions to carbohydrate moieties in mammalian meats caused by sensitization from homologous substances transferred during tick bites. Component-resolved diagnosis is being rapidly incorporated into clinical use, and sophisticated diagnostic tests that indicate severity and prognosis are on the horizon. Current management relies heavily on avoidance and emergency preparedness, and recent studies, guidelines, and resources provide insight into improving the safety and well-being of patients and their families. Incorporation of extensively heated (heat-denatured) forms of milk and egg into the diets of children who tolerate these foods, rather than strict avoidance, represents a significant shift in clinical approach. Recommendations about the prevention of food allergy and atopic disease through diet have changed radically, with rescinding of many recommendations about extensive and prolonged allergen avoidance. Numerous therapies have reached clinical trials, with some showing promise to dramatically alter treatment. Ongoing studies will elucidate improved prevention, diagnosis, and treatment. |
Journal of Allergy and Clinical Immunology. 2014 Feb 1;133(2):291-307. | general allergy review article |
| Silbernagel TJ, Bullard ZT. | 2024 | Alpha-Gal Syndrome: A Growing Health Care Concern. |
Critical Care Nursing Quarterly. 2025 Jan 1;48(1):2-7. | nursing; review |
| Sim DW, Lee JS, Park KH, Jeong KY, Ye YM, Lee JH, Park JW. | 2017 | Accurate assessment of alpha-gal syndrome using cetuximab and bovine thyroglobulin-specific IgE. Scope: IgE against galactose‐α‐1,3‐galactose (α‐Gal) causes alpha‐gal syndrome. Bovine thyroglobulin (BTG) and cetuximab share this epitope. We aimed to determine the utility of specific IgE (sIgE) against cetuximab as compared to BTG for diagnosing alpha‐gal syndrome. Methods and results: Twelve patients with alpha‐gal syndrome, 11 patients with immediate beef or pork allergy, 18 asymptomatic individuals with meat sensitization, and 10 non‐atopic subjects were enrolled. We checked the levels of sIgE against BTG and cetuximab using the streptavidin CAP assay. Additionally, IgE reactivity to BTG and cetuximab was assessed by immunoblotting. All alpha‐gal syndrome patients had a high concentration of sIgE against BTG, and cetuximab. In contrast to alpha‐gal syndrome, patients with immediate allergic reactions to meat consumption and those with asymptomatic sensitization had significantly lower concentration of BTG and cetuximab sIgE, and a high prevalence of sIgE against bovine or porcine serum albumin. Although the concentration of sIgE against alpha‐gal was lower in individuals with asymptomatic sensitization, IgE immunoblotting showed the presence of sIgE against α‐Gal in this group. Conclusion: Differentiation of alpha‐gal syndrome from patients with immediate allergy to meat consumption or asymptomatic sensitization requires quantification of cetuximab‐ or BTG‐induced sIgE via detection of IgE for α‐gal. |
Molecular nutrition & food research. 2017 Oct;61(10):1601046. | test |
| Singh S, Thompson JA, Weis S, Sobral D, Truglio M, Yilmaz B, Rebelo S, Cardoso S, Gjini E, Nuñez G, Soares MP. | 2020 | A trade-off between resistance to infection and reproduction in primate evolution. Most mammals express a functional GGTA1 gene encoding the N-acetyllactosaminide α-1,3-galactosyltransferase enzyme, which synthesizes Galα1-3Galβ1-4GlcNAc (αGal) and are thus tolerant to this self-expressed glycan epitope. Old World primates including humans, however, carry GGTA1 loss-of-function mutations and lack αGal. Presumably, fixation of such mutations was propelled by natural selection, favoring the emergence of αGal-specific immunity, which conferred resistance to αGal-expressing pathogens. Here we show that loss of Ggta1 function in mice enhances resistance to bacterial sepsis, irrespectively of αGal-specific immunity. Rather, the absence of αGal from IgG-associated glycans increases IgG effector function, via a mechanism associated with enhanced IgG-Fc gamma receptor (FcγR) binding. The ensuing survival advantage against sepsis comes alongside a cost of earlier onset of reproductive senescence. Mathematical modeling of this trade-off shows that under conditions of high exposure to virulent pathogens, selective pressure can fix GGTA1 loss-of-function mutations, as likely occurred during the evolution of primates towards humans. |
bioRxiv. 2020 Jan 1. | GGTA1 inactivation; evolution; IgG |
| Slayden TA, Bauer EM, Shakir MK, Hoang TD. | 2020 | Alpha Gal Allergy in a Hypothyroid Patient. Background: The IgE-mediated allergy to galactose-alpha-1,3-galactose (alpha-gal), a carbohydrate expressed on nonprimate mammalian proteins, has gained more clinical significance as it can present with serious, potentially fatal anaphylaxis or angioedema. In general, recognizing a specific allergy is the first step in prescribing avoidance; but with delayed symptoms, uncertain prevalence, and unclear diagnostic approach, alpha-gal allergies are difficult to recognize and prevent. To further complicate the clinical picture, some patients can tolerate small portions of nonprimate mammalian meat or tolerate one kind of meat over another. We hereby present a case that highlights the lack of guidance and resources currently available to treat a patient with alpha-gal allergy and hypothyroidism. Case Presentation: A 45-year-old woman with a history of an alpha-gal allergy and follicular thyroid neoplasm status post right hemithyroidectomy presented with postoperative hypothyroidism. After the surgery, she had undetectable serum thyroglobulin levels; her thyroid stimulating hormone (TSH) levels were ranging 5–6 µIU/mL (not on thyroid replacement). The goal was to prescribe thyroid replacement to initiate cancer suppressive strategy. The American Thyroid Association (ATA) recommends a TSH of 0.5-to-2 mcIU/mL in low risk patients postoperatively. The standard treatment of choice for correcting hypothyroidism is synthetic thyroxine (T4, levothyroxine). Commercially available levothyroxine, liothyronine, combo, and desiccated thyroid formulations - whether brand name, generic, tablet, soft gel capsule, or liquid - all contain meat byproducts and can be a concern for anaphylaxis or angioedema if one has an alpha gal allergy. Because of the possible reactions with all common formulations of thyroid hormone replacement in this patient, choosing a safe option was complicated and involved a multidisciplinary team, including allergy and immunology consultation. Daily parenteral synthetic thyroid hormone therapy was considered; however, it is not practical and was not feasible for the patient. She was eventually prescribed pure Levothyroxine, with a plant-based filler and vegetarian capsule. She tolerated this pure levothyroxine well without any adverse reactions, and the TSH goal was achieved. Conclusion: This case emphasizes the importance of recognizing various risk factors and common drugs associated with the alpha-gal allergy. Further research and pharmaceutical attention to this allergy is needed |
AACE Clinical Case Reports. 2020 May; 6(3): e101-4. | medication; pharmacy; pharmaceutical; endocrinology |
| Slayden TA, Shakir MK, Hoang TD. | 2020 | A BULL IN A PILL SHOP: ALPHA-GAL ALLERGY COMPLICATING TREATMENT OPTIONS FOR POSTPROCEDURAL HYPOTHYROIDISM. Objective: The galactose-alpha-1,3-galactose (alpha-gal) allergy, an IgE-mediated response to nonprimate meat, has a singular pathogenesis linked to tick bites and a delayed allergic presentation, which makes it especially cumbersome to diagnose and manage. As a large array of enteral medications contain ingredients derived from meat byproducts, this can affect the care of alpha-gal patients across multiple medical disciplines. Our objective is to present a patient with an alpha-gal allergy, which can complicate hypothyroidism treatment selection. Methods: In this case of difficulty tailoring thyroid replacement therapy secondary to the alpha-gal allergy, the diagnostic studies included IgE immunoassays for alpha-gal as well as thyroid function tests. . Results: A 45-year-old woman with postoperative hypothyroidism and a history of an alpha-gal allergy (diagnosed after an anaphylactic reaction to beef) could not be immediately started on any common thyroid hormone replacement formulation because of our concern regarding the possible presence of nonprimate mammalian meat byproduct components in the thyroid hormone medication. After consulting allergy and immunology specialists and compounding pharmacists and contacting multiple drug companies in an effort to confirm the nature of the inactive ingredients in their thyroid hormone products, she was prescribed a plant-based compounded levothyroxine preparation with good clinical results. . Conclusion: This case emphasizes the importance of recognizing various risk factors and common drugs which may be associated with the alpha-gal allergy. It is not known how to best tailor enteral medications for patients with an alpha-gal allergy. Further research and pharmaceutical attention to this allergy are needed. . |
AACE Clinical Case Reports. 2020 May;6(3):e101-4. | medication; pharmacy; pharmaceutical; endocrinology; thyroid; hypothyroid |
| Socaciu MI, Semeniuc CA, Vodnar DC. | 2018 | Edible films and coatings for fresh fish packaging: Focus on quality changes and shelf-life extension. | Coatings. 2018 Oct;8(10):366. | Seafood; fish; gelatin; whey; carrageenan |
| Soemantri SP, Höxtermann S, Holz-Larose R, Altmeyer P, Dickel H. | 2015 | Delayed anaphylaxis after ingestion of meat. Carbohydrate epitope galactose-alpha-1,3-galactose as cause of severe anaphylactic reactions. The correlation between anaphylaxis after consumption of meat and the carbohydrate epitope galactose-alpha-1,3-galactose (alpha-Gal) was first described in oncologic patients treated with cetuximab. An association with tick bites and parasitosis is suspected. We report on a healthy patient who developed sudden anaphylactic reactions after the ingestion of meat. Serologic and skin tests confirmed sensitization to alpha-Gal. Avoiding the consumption of mammalian meat led to a complete absence of symptoms. |
Zeitschrift fur Dermatologie, Venerologie, und verwandte Gebiete. 2015 Feb;66(2):117-20. | Hoxtermann |
| Soh JY, Huang CH, Lee BW. | 2015 | Carbohydrates as food allergens. The literature supports the notion that carbohydrate epitopes, on their own, do not contribute significantly to the induction of allergic reactions. They bind weakly to IgE antibodies and have been termed as cross-reactive carbohydrate determinants. These epitopes cause confusion in in vitro IgE testing through nonspecific cross-reactivity. Coincident with the rising trends in food allergy prevalence, there has recently been reports of anaphylaxis induced by carbohydrate epitopes. There are two distinct groups, each with unique characteristics and geographical distribution. Anaphylaxis and acute allergic reactions related to the carbohydrate galactose-alpha-1,3-galactose (alpha-Gal) epitope that are present in the monoclonal antibody, cetuximab and red meat have been described in the United States and Europe populations where tick bites have been found to be the primary sensitizer. Another carbohydrate inducing anaphylaxis is galacto-oligosaccharides in commercial milk formula which has been described in the several Asian populations including Singapore. The latter is unique in that the allergen is a pure carbohydrate. We summarize the current literature on carbohydrate-induced food allergy, and evaluate the two new groups of carbohydrate allergy that have defied previous findings on carbohydrates and their role. |
Annual review of biochemistry. 2004 Jul;73(1):491-537. | |
| Sokolova E, Jouanneau D, Chevenier A, Jam M, Desban N, Colas P, Ficko-Blean E, Michel G. | 2023 | Enzymatically-derived oligo-carrageenans interact with α-Gal antibodies and Galectin-3. Carrageenans are linear sulfated galactans synthesized in the Gigartinales, Rhodophyceae species with a varied range of biological properties that are of value to the pharmaceutical and cosmetic sectors. It is unknown how the fine structure of carrageenans dictates their capacity to affect molecular and cellular responses important to wound healing, or the ability to mitigate oxidative, hemostatic and inflammatory processes. Here we use specific endo-carrageenases, from the marine bacterium Zobellia galactanivorans, to produce enzymatically defined neo-series oligosaccharides from carrageenans with 3,6-anhydro-D-galactose on the non-reducing end. Further enzymatic modification of the oligosaccharides was done by treating with the 3,6-anhydro-D-galactosidases from the same bacterium which hydrolyze non-reducing end 3,6-anhydro-D-galactose moieties from neo-carrageenan oligosaccharides. Using the enzymatically produced oligosaccharides, we demonstrate binding to natural human serum antibodies and a monoclonal anti-αGal Ab (m86). The significant interactions with the Galα(1,3)Gal reactive antibodies produced by humans makes them potential potent inducers of complement-dependent reactions and attractive for therapeutic applications. We also demonstrate modulation of the galectin selectivity for the Gal-3 Carbohydrate Recognition Domain (CRD) relative to Gal-1 which has implications to targeting specific biological pathways regulated by the galectins. |
Carbohydrate Polymers. 2023 Nov 6:121563. | carrageenan |
| Solduzian M, Anvari S, Taghvaye Masoumi H, Shahi F, Jahangard-Rafsanjani Z. | 2018 | Successful desensitization of a patient with cetuximab hypersensitivity: A case report Background: Severe hypersensitivity reaction is a dangerous adverse drug reaction in patients receiving cetuximab. It requires drug discontinuation and medical management.Case description: A 48-year-old man, previously diagnosed with metastatic colorectal cancer, was admitted for therapy continuation. During the first infusion of cetuximab, the patient experienced acute signs of hypersensitivity reactions. The treatment team decided to administer cetuximab employing the desensitization protocol.Conclusions: This study reports a severe hypersensitivity reaction to cetuximab in an adult patient with colorectal cancer. This patient was successfully managed with a new safe and rapid desensitization protocol. |
Case reports in immunology. 2015 Jan 1;2015. | cetuximab |
| Solène RO, SICARD L, PERARNAUD J, AGNIEL R, BARDONNET R, CHAUSSAIN C, BOISSIERE M, PAUTHE E, GORIN C. | 2025 | Purified bone xenografts: a novel and efficient animal bone substitute derived from an optimized supercritical CO2 treatment. |
Materials Today Bio. 2025 Mar 3:101619. | |
| Son FS, Wolfe A, Nguyen YT, Uchi J. | 2023 | Patient Experience With Pharmaceutical Medical Information Centers To Identify Animal-Free Medications. Introduction: Many consumers do not consume medications that contain animal-derived ingredients. Nearly 6% of U.S. consumers claim to be vegan, a six fold increase compared to the 1% reported in 2014. In addition to vegans, those with certain religious beliefs, allergies (e.g. alpha-gal allergy), animal lovers and climate change activists also contribute to the increasing demand for animal-free products. This was a process improvement and discovery pilot project evaluating the accuracy of information and the patient experience around identifying the presence of animal-derived ingredients in medications. Methods: Phone call inquiries were made to medical information (MI) departments at the top 20 pharmaceutical companies. The patient experience was then measured by the accuracy of responses received from the MI departments, the number of interactions needed to obtain an answer and the average duration for each interaction. Results: Overall, 60% of the companies were able to provide an accurate response, and 45% of the companies provided an accurate response without any prompting. Pharmacists were not able to determine the animal-free status for 33% of the medications. Overall, 50% of the companies required more than one interaction to receive a final response with the average time for all the interactions being 13 minutes ± 5 minutes. Conclusion: A high percentage of companies were unable to provide accurate information regarding the source of animal-derived ingredients in medications. MI departments are encouraged to train in-house representatives on this topic or seek external independent certification to optimize the patient experience, provide accurate information and increase satisfaction. |
Journal of Contemporary Pharmacy Practice. 2023 Mar 1;70(2a):8-11. | pharmacy; pharmaceutical; drugs; medical products |
| Son JH, Choi YW, Cho YS, Byun YS, Chung BY, Cho HJ, Kim HO, Park CW. | 2016 | Prevalence of Pork Allergy in Korea. BACKGROUND: Pork is one of the most widely consumed meats in Korea. With increased consumption of pork, it has become one of the most common causes of food allergy in Korea. However, actual data on the prevalence of pork allergy in Korea are limited. OBJECTIVE: The aim of this study was to estimate the prevalence of pork allergy in Korea. METHODS: The outpatient attendees of the dermatology department of Kangnam Sacred Heart Hospital were randomly screened and assessed for a self-reported history of pork allergy through face-to-face interviews and self-administered questionnaires. Blood samples were taken from the patients to measure serum pork-specific IgE. Based on their history and laboratory results, patients were further examined by skin prick test (SPT) and open oral food challenge (OFC) tests. RESULTS: Five-hundred participants answered the screening questionnaire. Among all participants, nine (1.8%) participants claimed to have experienced adverse reactions to pork previously. Among 100 participants who underwent blood sampling, five (5%) participants had elevated level of serum IgE specific to pork. However, among nine participants with self-reported pork allergy, two participants (0.22%) showed a positive reaction on the open OFC test. CONCLUSION: Some participants claimed to have a history of adverse reaction related to pork intake; however, few of them showed positive results in allergy tests. We therefore conclude that the prevalence of pork allergy is extremely low in Korea. |
Korean Journal of Dermatology. 2015; 54(10): 796-802. | Asia; Korea; pork allergy; prevalence |
| Sonenshine DE. | 2018 | Range Expansion of Tick Disease Vectors in North America: Implications for Spread of Tick-Borne Disease. Ticks are the major vectors of most disease-causing agents to humans, companion animals and wildlife. Moreover, ticks transmit a greater variety of pathogenic agents than any other blood-feeding arthropod. Ticks have been expanding their geographic ranges in recent decades largely due to climate change. Furthermore, tick populations in many areas of their past and even newly established localities have increased in abundance. These dynamic changes present new and increasing severe public health threats to humans, livestock and companion animals in areas where they were previously unknown or were considered to be of minor importance. Here in this review, the geographic status of four representative tick species are discussed in relation to these public health concerns, namely, the American dog tick, Dermacentor variabilis, the lone star tick, Amblyomma americanum, the Gulf Coast Tick, Amblyomma maculatum and the black-legged tick, Ixodes scapularis. Both biotic and abiotic factors that may influence future range expansion and successful colony formation in new habitats are discussed. |
International journal of environmental research and public health. 2018 Mar;15(3):478. | |
| Springer YP, Eisen L, Beati L, James AM, Eisen RJ. | 2014 | Spatial distribution of counties in the continental United States with records of occurrence of Amblyomma americanum (Ixodida: Ixodidae). In addition to being a major nuisance biter, the lone star tick, Amblyomma americanum (L.), is increasingly recognized as an important vector of pathogens affecting humans, domestic animals, and wildlife. Despite its notoriety, efforts have been lacking to define the spatial occurrence of A. americanum in the continental United States with precision beyond that conveyed in continental-scale distribution maps. Here we present a county-level distribution map for A. americanum generated by compiling collection records obtained from a search of the published literature and databases managed by the USDA, U.S. National Tick Collection, and Walter Reed Biosystematics Unit. Our decadal and cumulative maps, which visually summarize 18,121 collections made between 1898 and 2012, show that A. americanum is either established (≥six ticks or ≥two life stages) or reported (<six ticks of a single life stage or number of ticks not specified) in 1,300 counties distributed among 39 states and the District of Columbia. Our cumulative map depicts a species with a core distributional area in the southern part of the eastern United States, but that also occurs further north, especially along the Atlantic Coast and into the Midwest. Although our decadal maps suggest a northward shift in the tick's distribution in recent decades, the lack of systematic tick surveillance makes this difficult to confirm. The data presented herein should aid in identifying areas posing risk for A. americanum-associated illnesses and environmental correlates that define the tick's distributional limits. |
Journal of medical entomology. 2014 Mar 1;51(2):342-51. | vector; lone star tick |
| Stankus T. | 2019 | Reviews of Science for Science Librarians: Alpha-Gal: The Curious Case of Ticks Whose Bite Induces Red Meat Allergies in Humans. A growing number of tick species have now been demonstrated to induce red meat allergies through biting humans. During the course of the bite, Galactose alpha-1,3-Galactose, commonly abbreviated as alpha-Gal, a carbohydrate not found in humans, but common in four-legged mammals, makes its way through to the bloodstream, triggering antibody production. Subsequent consumption of red meat by bite victims sets off a peculiarly delayed immunological reaction that may range from hives through to anaphylaxis. This paper documents the discovery of its linkage with tick bites. The spread of this syndrome worldwide warrants the attention of scientific and clinical librarians serving allergists, immunologists, dieticians, and entomologists. |
Science & Technology Libraries. 2019 Oct 2;38(4):349-59. | Review; library science |
| Stein D, Schuyler A, Commins S, Behm B, Chitnavis M. | 2016 | P-002 YI First Dose IgE-Mediated Allergy to Infliximab Due to Galactose-α-1,3-Galactose Allergy. Background: Mammalian meat allergy is an IgE antibody-mediated response to a mammalian oligosaccharide epitope galactose-[alpha]-1,3-galactose (alpha-gal). Anaphylaxis may occur after patients bitten by a lone star tick develop IgE antibodies to alpha-gal and are re-exposed to the same epitope following ingestion of mammalian products such as beef, pork, and lamb. Severe anaphylaxis to monoclonal antibodies glycosylated with alpha-gal (i.e., cetuximab) has been reported in this patient population. We present a case of first dose IgE-mediated allergic reaction to infliximab in a woman with mammalian meat allergy. A 53-year-old woman with a history of Crohn's disease was initiated on infliximab. She developed diffuse urticaria and wheezing during the first infusion, indicative of a pre-formed IgE response. She was pre-treated with corticosteroids and diphenhydramine for a second treatment, but developed a similar reaction and therapy was discontinued. Subsequent therapy with vedolizumab was initiated without recurrence of symptoms. Separately, she was confirmed to have mammalian meat allergy mediated by IgE antibody to galactose-[alpha]-1,3-galactose. Methods: Patient serum was collected and compared to serum from 3 other individuals with known mammalian meat allergy (mediated by IgE to galactose-[alpha]-1,3-galactose) and 2 controls. Total and specific IgE antibodies to monoclonal antibodies derived from cell lines that glycosylate with galactose-[alpha]-1,3-galactose (cetuximab, infliximab, and natalizumab) as well as non-glycosylated monoclonal antibodies (rituximab and vedolizumab) were measured with the use of either ImmunoCAP (Phadia U.S.) or a modified assay with streptavidin-coated ImmunoCAP. Each monoclonal Ab was biotinylated, and approximately 5 [mu]g was added to each streptavidin-coated ImmunoCAP before serum was added. The assays were performed with the ImmunoCAP250 instrument. The threshold value for a positive reaction was 0.35 IU per milliliter. . Results: Positive reactions were seen with monoclonal antibodies from cell lines that glycosylate with galactose-[alpha]-1,3-galactose (infliximab, natalizumab, and cetuximab) in our patient and the 3 individuals with known galactose-[alpha]-1,3-galactose allergy, but not in the 2 controls. No reaction was seen to the non-glycosylated monoclonal antibodies (rituximab or vedolizumab) in any of the samples. Conclusions: First-dose allergic reactions to infliximab are rare. We describe evidence for a potential allergic mechanism through IgE-mediated reaction to galactose-[alpha]-1,3-galactose. Immediate anaphylaxis has previously been described in patients with first exposure to intravenous cetuximab, in which galactose-[alpha]-1,3-galactose is present on the FAb portion of the heavy chain, but similar reactions to infliximab have not previously been described to our knowledge. Care should be taken in patients with known mammalian meat allergy prior to use of infliximab. |
Inflammatory Bowel Diseases. 2016 Mar 1;22:S9-10. | |
| Steinke JW, Platts-Mills TA, Commins SP. | 2015 | The alpha-gal story: Lessons learned from connecting the dots. Anaphylaxis is a severe allergic reaction that can be rapidly progressing and fatal, and therefore establishing its cause is pivotal to long-term risk management. Our recent work has identified a novel IgE antibody response to a mammalian oligosaccharide epitope, galactose-alpha-1,3-galactose (alpha-gal). IgE to alpha-gal has been associated with 2 distinct forms of anaphylaxis: (1) immediate-onset anaphylaxis during first exposure to intravenous cetuximab and (2) delayed-onset anaphylaxis 3 to 6 hours after ingestion of mammalian food products (eg, beef and pork). Results of our studies and those of others strongly suggest that tick bites are a cause, if not the only significant cause, of IgE antibody responses to alpha-gal in the southern, eastern, and central United States; Europe; Australia; and parts of Asia. Typical immune responses to carbohydrates are considered to be T-cell independent, whereas IgE antibody production is thought to involve sequential class-switching that requires input from T cells. Therefore, establishing the mechanism of the specific IgE antibody response to alpha-gal will be an important aspect to address as this area of research continues. |
Journal of Allergy and Clinical Immunology. 2015 Mar 1;135(3):589-96. | |
| Steinke JW, Platts-Mills TAE, Schuyler A, Commins SP. | 2015 | Reply to Tobacman: The common food additive carrageenan and the alpha-gal epitope. Letter to the editor Dr Tobacman1 raises an interesting point regarding potential galactose-a-1,3-galactose (alpha-gal) epitopes in food additives, including carrageenan and other products not derived from red meat. Although of interest, caution must be exercised in equating the presence of structures similar to alpha-gal on foods or food additives with the ability to bind IgE and mediate allergic reactions. To our knowledge, there have not been any proper studies demonstrating binding of IgE directed against alpha-gal to carrageenan or food additives containing such residues. It is also unknown whether the alpha-gal–containing structures from the food additives remain intact as they pass through the digestive system. What is clear is that the reactions to red meat almost always take 2 hours or more, which likely reflects a complex digestive tract process, before the relevant form of the alpha-gal epitope is present in the circulation.2,3 Although the true nature of the events that occur over time are not yet clear, the most likely explanation is the formation of low-density lipoproteins. |
The Journal of Allergy and Clinical Immunology. 2015 Dec 1;136(6):1709-10. | carrageenan |
| Steinke JW, Pochan SL, James HR, Platts-Mills TA, Commins SP. | 2016 | Altered metabolic profile in patients with IgE to galactose-alpha-1, 3-galactose following in vivo food challenge. Letter to the editor Over the past few years, a large number of patients have been identified who experience delayed anaphylaxis or urticaria following eating red meat and who have IgE antibodies to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal).1Patients with this alpha-gal syndrome had tolerated mammalian products before onset of the disease and in many cases recall tick bites before sensitization. Many anecdotal reports suggest that glycolipids may be as important as glycoproteins in the clinical episodes. Furthermore, delayed absorption and processing of glycolipids could provide a rational explanation for the delay in onset of symptoms. ...In summary, metabolomic analysis of subjects with red meat allergy related to high levels of IgE to alpha-gal identified basal and food-induced differences following challenge with red meat that were not observed in healthy subjects. These observations suggest that meat allergy is accompanied by disruptions in amino acid catabolism, lipid and carbohydrate metabolism, and synthesis of bile acids, which may reflect differences in the microbiome and nutrient absorption. These metabolic changes are likely to contribute to symptoms through alterations of components of the allergic response. |
Journal of Allergy and Clinical Immunology. 2016 Nov 1;138(5):1465-7. | |
| Steinke M, Fiocchi A, Kirchlechner V, Ballmer-Weber B, Brockow K, Hischenhuber C, Dutta M, Ring J, Urbanek R, Terracciano L, Wezel R. | 2007 | Perceived food allergy in children in 10 European nations. Background: Food allergy is targeted as a public health priority by the European Union Commission. Parental perception of food allergy in their offspring is a proxy measure of the potential demand for allergy medicine services in the paediatric population. Methods: A representative sample of the general population was contacted by a randomised telephone survey in Austria, Belgium, Denmark, Finland, Germany, Greece, Italy, Poland, Slovenia and Switzerland. A standardised questionnaire was administered regarding parentally perceived food allergy reports, symptoms, foods and medical service use by their live-in children. Results: 40,246 adults were polled, yielding data on 8,825 children. Parentally perceived food allergy prevalence was 4.7% (90% CI 4.2–5.2%). The most affected age group was 2- to 3-year olds (7.2%). Single-country incidence ranged between 1.7% (Austria) to 11.7% (Finland). Milk (38.5%), fruits (29.5%), eggs (19.0%) and vegetables (13.5%) were most often implicated, although with significant age-linked variations. Medical treatment was needed by 75.7% of affected children because of a food reaction. This translates into a proxy measure for food allergy prevalence of 3.75%. Skin symptoms were widespread (71.5%), followed by gastrointestinal (27.6%) and respiratory (18.5%) symptoms. Discussion: We provide the first point prevalence of parentally perceived food allergy in the general paediatric population across the European Union. Parental reports confirm the public health significance of adverse reactions to some foods in specified age groups. Our data may inform intervention planning, cost of illness assessments and quality-of-life-enhancing public health measures. |
International archives of allergy and immunology. 2007;143(4):290-5. | Europe; Poland; meat allergy; prevalence |
| Stenger F, Seidel P, Schricker T, Volc S, Fischer J. | 2022 | Could cat flea bites contribute to alpha-gal serum IgE levels in humans?. No abstract available |
Journal of Investigational Allergology & Clinical Immunology. 2022 Jan 24:0-. | vectors of sensitization; fleas |
| Stern RG. | 2024 | Another New Disease. (Editorial) |
The American Journal of Medicine. 2024 May 25. | Gastroenterology; GI variant; GI phenotype. Arizona. |
| Stewart PH, McMullan KL, LeBlanc SB. | 2015 | Delayed red meat allergy: clinical ramifications of galactose-alpha-1,3-galactose sensitization. A 42-year-old man with hypertension, allergic rhinitis, and anaphylaxis to penicillin presents after 2 episodes of worsening pruritic rash, with the most recent episode progressing to anaphylaxis. |
Ann Allergy Asthma Immunol. 2015 Oct 1;115(4):260-4. | |
| Stockdale V | 2016 | Guidelines for using carrageenans to heat stabilise wine |
Special report: Chemical Weekly. Sunita Hydrocolloids, Pte Ltd. 2009. | carrageenan; wine; juice |
| Stoltz LP, Cristiano LM, Dowling AP, Wilson JM, Platts-Mills TA, Traister RS. | 2019 | Could chiggers be contributing to the prevalence of galactose-alpha-1,3-galactose sensitization and mammalian meat allergy? Letter to the editor Patients may report “chigger” bites before galactose-alpha-1,3-galactose sensitization. It remains unclear whether mammalian meat allergy can be caused by the bites of true chiggers, which are red, or if the bites are actually due to the often confused larval “seed ticks.” |
The journal of allergy and clinical immunology. In practice. 2019 Feb;7(2):664. | non-tick vectors; Trombiculidae; chigger; mite; |
| Stone CA, Commins SP, Choudhary S, Vethody C, Heavrin JL, Wingerter J, Hemler JA, Babe K, Phillips EJ, Norton AE. | 2019 | Anaphylaxis after vaccination in a pediatric patient: further implicating alpha-gal allergy. We report a pediatric patient with preexisting alpha-gal allergy who developed anaphylaxis immediately after receiving his routine 5-year vaccinations. Further investigation implicates alpha-gal allergy as another mechanism in pediatric anaphylaxis to gelatin-containing vaccines. |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 Jan 1;7(1):322-4. | gelatin; gelatine; vaccination; vaccine |
| Stone CA, Hemler JA, Commins SP, Schuyler AJ, Phillips EJ, Peebles RS, Fahrenholz JM. | 2017 | Anaphylaxis after zoster vaccine: Implicating alpha-gal allergy as a possible mechanism. …A patient in our clinic with a documented history of red meat allergy since November 2008 required emergency department treatment and epinephrine administration on receipt of live attenuated herpes zoster vaccine containing the Oka varicella zoster virus strain in September 2014. Within minutes of vaccine administration in a local pharmacy, she had a sensation of mental clouding progressing to lightheadedness, wheezing, and throat tightness, and she self-administered 50 mg of diphenhydramine 5 minutes after symptom onset. She sought emergency care 30 minutes after vaccine receipt, at which point she was documented to be dyspneic and flushed, with facial, oral, and uvular angioedema and bilateral conjunctival injections with stable vital signs and blood pressure of 149/83 mm Hg but without documented wheezing on pulmonary examination. She was started on oxygen and administered an additional 25 mg of diphenhydramine, 8 mg of intramuscular dexamethasone, 20 mg of famotidine, nebulized albuterol, and 0.3 mg of intramuscular epinephrine for her respiratory distress, angioedema, and cutaneous signs.5 Her symptoms resolved within 20 to 30 minutes, and she was discharged uneventfully after 3 hours of observation. |
Journal of Allergy and Clinical Immunology. 2017 May 1;139(5):1710-3. | gelatin; gelatine; vaccination; vaccine |
| Stone Jr CA, Choudhary S, Patterson MF, Rukasin CR, Coleman DT, Phillips EJ, Commins SP. | 2020 | *‡ Tolerance of porcine pancreatic enzymes despite positive skin testing in alpha-gal allergy Clinical Communications Patients with galactose-alpha-1,3-galactose syndrome can have positive skin testing to porcine pancreatic enzyme replacement. We report 2 patients with drug tolerance despite positive skin testing, identifying that at least in some circumstances these drugs do not elicit a reaction. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 May 1;8(5):1728-32. | pharmacy; pharmaceutica; mdication; pancreatic enzyme; Creon; pancrelipase; Viokase; Zenpep; Pertyze; Gelfoam; Surgifoam; heparin |
| Stone Jr CA, Garvey LH, Nasser S, Lever C, Triggiani M, Parente R, Phillips E. | 2023 | Identifying and managing those at risk for vaccine related allergy and anaphylaxis. |
The Journal of Allergy and Clinical Immunology: In Practice. 2023 May 12. | medical products; vaccine; gelatin |
| Straesser M, Keshavarz B, Borish L, Khokhar D, Holian A, Charlton N, Platts-Mills TA, Wilson JM. | 2020 | α-Gal on Crotalidae-polyvalent Fab antivenom (CroFab): investigating the relevance to immediate hypersensitivity reactions. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 Oct 27. | Medical products; antivenom; antivenin; Crofab |
| Streightiff S. | 2023 | Complex Narratives of Individuals Living with Alpha-gal syndrome (AGS). A mixed-methods investigation: examined through self-reported data, in-person interviews, and a group body mapping art therapy intervention. |
Masters thesis | Psychology; trauma; art therapy; acceptance and commitment therapy |
| Strickler J. | 2017 | Mammalian meat allergy: Unexpected danger. IT'S EARLY MORNING when Mr. M, 40, presents to the ED via ambulance after experiencing a possible allergic reaction at home. Treated immediately in the ED, he responded well to I.M. epinephrine, I.V. diphenhydramine, and I.V. methylprednisolone.1 He's now awake, alert, and oriented and in no obvious distress. His vital signs are stable and his signs and symptoms have resolved. He denies any known allergies, prescribed or over-the-counter medications, nutritional or herbal supplement use, or pertinent health history. Mr. M states that he was awakened at about 0400 because of severe back “itching” and his wife stated his back “was covered in hives.” When he became short of breath and dizzy, she called the ambulance. On further questioning, the patient denies exposure to any obvious agents that could trigger an allergic reaction. However, when asked about recent meals, he says that he'd eaten a hamburger for dinner at about 1900. Given the absence of other likely allergens, the ED physician begins to suspect mammalian meat allergy. The patient is referred to an allergist who, based on this presentation, also suspects mammalian meat allergy, formally called galactose-alpha-1,3-galactose (alpha-gal) sensitization.2 Skin testing is done to rule out other more common allergens. After serum confirmation testing, the patient is ultimately diagnosed with this unique allergy. This article discusses how to assess patients who may be experiencing this disorder and how they're managed. |
Nursing Management 2017; 47(8): 48-51. | nursing |
| Sukkanon C, Chareonviriyaphap T, Doggett SL. | 2019 | Topical and spatial repellent bioassays against the Australian paralysis tick, Ixodes holocyclus (Acari: Ixodidae). The Australian paralysis tick, Ixodes holocyclus, is the cause of significant human morbidity. Bites from the tick may result in paralysis, allergic reactions that can include anaphylaxis and death, mammalian meat allergies and the transmission of infectious agents. In recent years, there have been a number of papers published on the microbiome of the species, but to date, there is no published research on I. holocyclus management or personal protection options to prevent the bite from the species. The study herein focused on the latter; the use of repellents for the prevention of bites from I. holocyclus. Five personal repellents were tested along with coconut oil, and a citronella patch and wristband. These were all tested for repellency in a laboratory assay over the time intervals of 15 min, 1, 2, 3 and 4 h post application. The personal repellents included the active ingredients of picaridin (9.3%), DEET (11.5%), lemon eucalyptus (36.0%), a combined formulation of citronella and tea tree oil (28.4%) and an extract of Andrographis paniculata (30% w/v). The coconut oil was 30% v/v. The citronella patch contained 120 mg/patch, whereas the citronella wristband contained 750 mg/band. Two spatial repellents were also tested in the laboratory for repellency and toxicity against I. holocyclus and tested for toxicity in the field. These included OFF!® Clip‐On™ (metofluthrin 312 g/kg) and Thermacell® (allethrin 219.7 g/kg). For the personal repellents at 4 h, there was no statistical difference in repellency between the formulations of picaridin, DEET and lemon eucalyptus, with over 84% repellency recorded for all. Thus, these would be the personal repellents recommended for preventing tick bites. The citronella patch produced 100% repellency over 4 h; however, as this type of product is known to only provide protection close to the patch, it is not recommended for routine use. For the spatial repellents, both produced significant repellency and toxicity in the laboratory, but failed to produce any tick mortality in the field, and their use cannot be recommended. This is the first published study investigating personal and spatial repellents for the prevention of tick bite from I. holocyclus. |
Austral Entomology. 2019 Nov;58(4):866-74. | Australia; tick management; Ixodes holocyclus |
| Sulieman M and Bailes J. | 2024 | A Pediatric Case Study: Alpha-Gal Sensitivity, Tick Exposure,and Meat Aversion in Southern West Virginia (Abstract) |
2023 West Virginia Rural Health Conference Abstracts. Marshall Journal of Medicine. 2024;10(2):6. | pediatric; West Virginia |
| Swiontek K, Fischer J, Hedin F, Revets D, Riel D, Chakrapani N, Mackenstedt U, Biedermann T, Kuehn A, Cosma A, Ollert M. | 2024 | Longitudinal Follow-up Reveals Peripheral Immunological Changes Upon Tick Bite in a-Gal-Sensitized Individuals. |
Journal of investigational allergology & clinical immunology. 2025:0. | |
| Swiontek K, Morisset M, Codreanu-Morel F, Fischer J, Mehlich J, Darsow U, Petitpain N, Biedermann T, Ollert M, Eberlein B, Hilger C. | 2019 | Drugs of porcine origin—A risk for patients with α-gal syndrome? Letter to the editor The a-gal syndrome is characterized by a delayed allergic reaction to mammalian meat associated with the presence of specific IgE antibodies to galactose-a-1,3-galactose.1 Sensitized patients are at risk upon ingestion of red meat, in particular pork kidney and innards.2 However, diverse other products of mammalian origin have been shown to carry the a-gal epitope and to trigger allergic symptoms, for example, therapeutic mAbs of rodent origin, bovine-derived gelatin colloids, as well as gelatin contained in drugs and sweets.3 Polyclonal antibody preparations such as antivenoms derived from horses have been shown to carry the a-gal epitope,4 and a case of hypersensitivity has been reported recently in an a-galesensitized patient.5 The high gelatin content of some vaccines has been attributed to anaphylaxis upon vaccination in 2 a-galeallergic patients,6,7 and the premature degradation of bioprosthetic heart valves has been associated with the presence of specific IgE in 2 patients. In the present study, we wanted to analyze the potential allergenicity of the porcine-derived drugs Creon (AbbVie, Inc, North Chicago, Ill), also known as pancrelipase or pancreatin, and Enzynorm f (Nordmark, Uetersen, Germany). Creon is a pancreas extract containing amylases, lipases, and proteases. It is used in the treatment of exocrine pancreatic insufficiency in the context of cystic fibrosis, pancreatitis, and pancreatic cancer. Pancreatin is also marketed under a number of different brand names such as Pancreaze and Zenpep. Enzynorm f contains pepsin as the main ingredient as well as hydrolyzed bovine blood proteins, and it is freely available in drug stores as support for gastric malfunction. Pepsin is approved by the Food and Drug Administration as an over-the-counter drug to support digestion, and it is available either as a single ingredient preparation in a few countries (Canada and Poland) or as a multi-ingredient preparation in many countries in the world. |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 May 1;7(5):1687-90. | Pharmacy; pharmaceutical; medication; vaccine |
| Symons J, Burk M, Cross B, Owen A, Duong K, Boettiger D, Ratchford A, van Nunen S. | 2024 | P57: TICK-INDUCED MAMMALIAN MEAT ALLERGY: RISK FACTORS AND CLINICAL FEATURES IN A LARGE AUSTRALIAN COHORT. |
P57: TICK-INDUCED MAMMALIAN MEAT ALLERGY: RISK FACTORS AND CLINICAL FEATURES IN A LARGE AUSTRALIAN COHORT. Victoria.;17(5):5. | Australia |
| Szymonik J, Szopa S. | 2024 | Alpha-gal syndrome: exploring the link between tick bites and red meat allergy. |
Quality in Sport. 2024 May 1;17:50774-. | Europe; Poland |
| Taguchi T, Kitajima K, Muto Y, Inoue S, Khoo KH, Morris HR, Dell A, Wallace RA, Selman K, Inoue Y. | 1995 | A precise structural analysis of a fertilization-associated carbohydrate-rich glycopeptide isolated from the fertilized eggs of euryhaline killi fish (Fundulus heteroclitus). Novel penta-antennary N-glycan chains with a bisecting N-acetylglucosaminyl residue. A novel carbohydrate-rich sialoglycopeptide of apparent molecular mass $$$6 kDa was isolated from the fertilized eggs of Fundulus heteroclitus (euryhaline killi fish). This glycopeptide is a member of the L-hyosophorin family, characterized by its high content of carbohydrate (80–90% by weight) and formed by depolymerization of the precursor glycopolyprotein (H-hyosophorin) upon fertilization. The structures of the N-glycan chains were unambiguously established by a combination of compositional analysis, methylation analysis, selective chemical degradation (periodate oxidation-Smith degradation and hydrazinolysis-nitrous acid deamination), enzymatic (peptide:N-g]ycosidase F, several β-galactosidases, (β-hexosaminidase and α-galactosidase) digestions and instrumental analyses (1H-NMR and fast atom bombardment mass spectrometry) to have the novel and unique carbohydrate sequences, Galα1→3(Galβ1→4)Ga1β1→4GlcNAcβ1→ and Galα1→3(±GalNAcβ1→4GlcNAcβ1→3Galβ1→4)Gal-β1→4GlcNAcβ1→. This study represents the first detailed investigation of the nature of bulky complex asparagine-linked penta-antennary glycans with a bisecting GlcNAc residue in glycoproteins. Expression of such bulky multiantennary glycan units on proteins may be essential during early embryogenesis. |
Glycobiology. 1995 Sep 1;5(6):611-24. | fish eggs; fish roe |
| Taira K, Kanade R, Yammine M, Tannous H, Kumar S. | 2024 | Alpha gal syndrome, a relative not absolute contraindication to the use of bovine pericardium to close an intracardiac septal defect: a case report. |
Journal of Cardiothoracic Surgery. 2024 Apr 16;19(1):221. | perioperative; medical products; cardiology; cardiac surgery; bovine pericardium |
| Takahashi H, Chinuki Y, Tanaka A, Morita E. | 2014 | Laminin gamma-1 and collagen alpha-1 (VI) chain are galactose-alpha-1,3-galactose-bound allergens in beef. Background: Sensitization to the carbohydrate galactose‐α‐1,3‐galactose (α‐Gal) has been reported in patients with beef allergy. However, the proteins responsible for this allergy have not yet been identified. This study aimed to identify beef proteins that predominantly react with serum IgE in Japanese patients with beef allergy. Methods: Sera were collected from 29 patients with beef allergy who had allergic reaction(s) such as urticaria, abdominal pain, vomiting, and anaphylactic shock after ingestion of beef and pork; the sera tested positive for IgE against beef and pork. IgE‐binding proteins were detected by immunoblotting sera from the patients and identified using a combination of two‐dimensional gel electrophoresis and peptide mass fingerprinting techniques. The involvement of carbohydrate in the binding of IgE to allergens was examined by periodate treatment and an inhibition assay with cetuximab by immunoblotting. Specific IgE binding to cetuximab was measured using the CAP ‐fluorescent enzyme immunoassay. Results: Two IgE‐binding proteins (240 kD a and 140 kD a) were detected in beef extract and identified as laminin γ‐1 and the collagen α‐1 (VI) chain from B os taurus , respectively. Periodate treatment or the inhibition assay resulted in the loss of IgE binding to these proteins. Immunoblotting with anti‐α‐Gal antibody revealed the presence of α‐Gal on the 240‐ and 140‐kD a beef proteins. The amount of IgE bound to cetuximab was significantly correlated with that to beef in the patients with beef allergy. Conclusion : The carbohydrate moiety (α‐Gal) on laminin γ‐1 and collagen α‐1 (VI ) chain are possibly common IgE‐reactive proteins in the Japanese patients with beef allergy. |
Allergy. 2014 Feb;69(2):199-207. | |
| Takewa R, Chinuki Y, Harada Y, Nakamura M, Hayashi S, Taniuchi S. | 2025 | PORK-CAT SYNDROME WITH ALLERGIC SYMPTOMS DUE TO THE INGESTION OF COW'S MILK. |
Arerugi=[Allergy]. 2025;74(2):89-93. | Asia; Japan; pork-cat syndrome |
| Tanemura M, Ogawa H, Yin DP, Chen ZC, DiSesa VJ, Galili U. | 2002 | Elimination of anti-Gal B cells by α-Gal ricin1. Background: A major barrier in pig to human organ transplantation is the binding of human anti-Gal to α-gal epitopes (Galα1-3Galβ1-4GlcNAc-R) on pig cells, resulting in hyperacute and acute vascular rejection of pig xenografts. Moreover, the immune system in xenograft recipients is activated by these epitopes to produce high affinity anti-Gal, which is also detrimental to xenografts. Production of anti-Gal can be prevented by specific elimination of anti-Gal B cells. This was achieved with the toxin ricin A, coupled to human α1-acid glycoprotein modified to carry α-gal epitopes. This complex, designated α-gal ricin, is targeted in vivo to anti-Gal B cells by interaction with the immunoglobulin molecules (i.e., B cell receptors) on these cells. Methods: Carbohydrate chains on α1-acid glycoprotein were converted to carry α-gal epitopes by enzymatic treatment with recombinant α1,3 galactosyltransferase (α1,3GT). This molecule and ricin A were biotinylated and coupled by avidin to generate α-gal ricin. The efficacy of α-gal ricin in eliminating anti-Gal B cells was studied in the experimental model of α1,3GT knockout (KO) mice. These mice produce large amounts of anti-Gal immunoglobulin G when immunized with pig kidney membranes, as measured by ELISA with α-gal epitopes linked to bovine serum albumin (BSA). In the absence of anti-Gal B cells, these mice lack the ability to produce anti-Gal. Results: Repeated administration of α-gal ricin into α1,3GT KO mice resulted in elimination of anti-Gal B cells, thereby preventing production of anti-Gal immunoglobulin G after immunization with pig kidney membranes. This prevention of anti-Gal production occurred with doses of α-gal ricin that were not toxic to the mice and did not affect production of antibodies with other specificities. Conclusions: Administration of α-gal ricin results in specific elimination of anti-Gal B cells in α1,3GT KO mice. The elimination of these B cells may prove to be helpful in attempts to achieve immune tolerance to α-gal epitopes in primates. |
Transplantation. 2002 Jun 27;73(12):1859-68. | |
| Tankersley M, DeJarnatt A, DeJarnatt R. | 2016 | Alpha-Gal Hypersensitivity: A Case Series from Good Ol' Rocky Top Tennessee. RATIONALE: Galactose-alpha-1,3-galactose hypersensitivity (alphagal) is a recently reported condition associated with the production of specific IgE to this oligosaccharide found in mammalian meat. A registry was maintained of alpha-gal patients to more fully understand this condition in our patient population. METHODS: A retrospective chart review of a single-site Allergy practice in Tennessee was conducted of the clinic’s alpha-gal registry of patients seen from 2010-2015. RESULTS: There were 38 patients diagnosed with alpha-gal hypersensitivity over a five-year period (2010-2015). Patient characteristics included: mean age at diagnosis 50.7 years (range 14-74 years), 44.7% were male (17/38), mean alpha-gal IgE 29.7 kU/L (range 1.1-97.3; two patients excluded from mean with levels >100). Four patients had followup alpha-gal levels which had all decreased: patient 1 (6.2 to 1.9 kU/L after 42 months), patient 2 (23.2 to 8.7 kU/L after 42 months), patient 3 (82.3 to 58.7 kU/L after 34 months) and patient 4 (95.2 to 1.3 kU/L after 48 months). Signs and symptoms included cutaneous pruritus, urticaria, angioedema, hoarseness, dyspnea, nausea, vomiting, diarrhea, lightheadedness, hypotension, and syncope. Culprit foods included beef, pork, venison, cow’s milk, and lamb. Time between onset of signs and symptoms to diagnosis was 1 month-15 years. Time between ingestion and signs/ symptoms was 1-6 hours. CONCLUSIONS: Alpha-gal hypersensitivity is not an uncommon food hypersensitivity as demonstrated by the 38 patients diagnosed in this single-site clinic in Tennessee over a 5-year period. All medical care providers should maintain a high index of suspicion of this condition in patients presenting with anaphylaxis in the absence of an immediate allergen association. |
Journal of Allergy and Clinical Immunology. 2016 Feb 1;137(2):AB55. | case series; symptoms |
| Tarlo SM, Dolovich J, Listgarten C. | 1995 | Anaphylaxis to carrageenan: A pseudo–latex allergy Background: Anaphylactic reactions during a barium enema have been attributed to allergy to latex on the barium enema device. The observation of anaphylaxis during barium enema without latex exposure or latex allergy led to the performance of an allergy skin test to the barium enema solution. Methods: Individual components of the barium enema solution were obtained for double-blind skin testing. A RAST to identify specific IgE antibodies to the skin test active agent was established. . Results: Carrageenan, a component of the barium enema solution, produced positive reactions to allergy skin test and RAST. Gastrointestinal symptoms for which the patient was being investigated by the barium enema subsequently disappeared with a diet free of carrageenan. . Conclusions: Carrageenan is a previously unreported cause of anaphylaxis during barium enema. It is an allergen widely distributed in common foods and potentially could account for some symptoms related to milk products or baby formula. |
Journal of allergy and clinical immunology. 1995 May 1;95(5):933-6. | pharmacy; pharmaceutical; medical products; enema; carrageenan |
| Taylor BW, Ratchford A, van Nunen S, Burns B. | 2019 | Tick killing in situ before removal to prevent allergic and anaphylactic reactions in humans: a cross-sectional study. No abstract available |
Asia Pacific Allergy. 2019 Apr 3;9(2). | Vector; tick removal |
| Taylor ML, Kersh GJ, Salzer JS, Jones ES, Binder AM, Armstrong PA, Choudhary SK, Commins GK, Amelio CL, Biggerstaff BJ, Beard CB. | 2024 | Intrinsic risk factors for alpha-gal syndrome in a case-control study, 2019-2020. |
Annals of Allergy, Asthma & Immunology. 2024 Feb 8. | risk factors; genetics; local reaction; healing time; blood type; B antigen; ABO; atopy; family history; insect allergy |
| Tector AJ, Mosser M, Tector M, Bach JM. | 2020 | The Possible Role of Anti-Neu5Gc as an Obstacle in Xenotransplantation. Seventy to ninety percentage of preformed xenoreactive antibodies in human serum bind to the galactose-α(1,3)-galactose Gal epitope, and the creation of Gal knockout (KO) pigs has eliminated hyperacute rejection as a barrier to xenotransplantation. Now other glycan antigens are barriers to move ahead with xenotransplantation, and the N-glycolyl neuraminic acid, Neu5Gc (or Hanganutziu-Deicher antigen), is also a major pig xenoantigen. Humans have anti-Neu5Gc antibodies. Several data indicate a strong immunogenicity of Neu5Gc in humans that may contribute to an important part in antibody-dependent injury to pig xenografts. Pig islets express Neu5Gc, which reacted with diet-derived human antibodies and mice deleted for Neu5Gc reject pancreatic islets from wild-type counterpart. However, Neu5Gc positive heart were not rejected in Neu5Gc KO mice indicating that the role of Neu5Gc-specific antibodies has to be nuanced and depend of the graft situation parameters (organ/tissue, recipient, implication of other glycan antigens). Recently generated Gal/Neu5Gc KO pigs eliminate the expression of Gal and Neu5Gc, and improve the crossmatch of humans with the pig. This review summarizes the current and recent experimental and (pre)clinical data on the Neu5Gc immunogenicity and emphasize of the potential impact of anti-Neu5Gc antibodies in limiting xenotransplantation in humans. |
Frontiers in Immunology. 2020;11. | sialic acid; N-glycolyl neuraminic acid; anti-NeuGc; knockout; xenotransplantation |
| Tejan-Kamara AZ, Murhammer JM, Fingert JH. | 2023 | Alpha-gal syndrome (AGS) in a glaucoma suspect with narrow iridocorneal angles |
American Journal of Ophthalmology Case Reports. 2023 Jan 28:101811. | ophthalmology; perioperative; glaucoma; medical product; ophthalmological products |
| Teo EJ, Vial MN, Hailu S, Kelava S, Zalucki MP, Furlong MJ, Barker D, Barker SC | 2021 | Climatic requirements of the eastern paralysis tick, Ixodes holocyclus, with a consideration of its possible geographic range up to 2090. The eastern paralysis tick, Ixodes holocyclus, is an ectoparasite of medical and veterinary importance in Australia. The feeding of I. holocyclus is associated with an ascending flaccid paralysis which kills many dogs and cats each year, with the development of mammalian meat allergy in some humans, and with the transmission of Rickettsia australis (Australian scrub typhus) to humans. Although I. holocyclus has been well studied, it is still not known exactly why this tick cannot establish outside of its present geographic distribution. Here, we aim to account for the presence as well as the absence of I. holocyclus in regions of Australia. We modelled the climatic requirements of I. holocyclus with two methods, CLIMEX, and a new envelope-model approach which we name the ‘climatic-range method’. These methods allowed us to account for 93% and 96% of the geographic distribution of I. holocyclus, respectively. Our analyses indicated that the geographic range of I. holocyclus may not only shift south towards Melbourne, but may also expand in the future, depending on which climate-change scenario comes to pass. |
International Journal for Parasitology. 2021 Jan 26. | Australia; tick; Ixodes holocyclus; geographic range; climate change |
| Tepetam FM. | 2023 | Delayed anaphylaxis due to Alpha-gal allergy: A modified desensitization protocol with red meat in an adult patient. Alpha-gal allergy is the sensitization to Alpha-gal present in saliva when a tick bites and the development of an IgE-mediated reaction to Alpha-gal also present in red meat by cross-reactivity. In contrast to other food allergies, symptoms occur as late as 2-6 hours after a meal. Prick to prick testing with nonmammalian meat in combination with cooked mammalian meat is recommended for diagnosis. However, the main diagnostic test is Alpha-gal sIgE> 0.1 IU/mL. The primary recommendation in patients with Alpha-gal syndrome is to prevent new tick bites and avoid all mammalian meats. Since most of the dishes in our country’s food culture contain red meat, elimination diet may adversely affect patients quality of life. In the management of these patients, the option of desensitization with red meat can be considered by evaluating the benefit-risk ratio together with the patient. Our patient with a history of tick bites and a reaction pattern ranging from urticaria to anaphylaxis two hours after meat consumption was evaluated for Alpha gal allergy. The patient was found to be positive by prick-to-prick with cooked red meat.In addition, the high level of Alpha-gal specific IgE (27.3 Ku/L) confirmed the Alpha-gal allergy, and the decision to apply desensitization with red meat was taken. There are only two literatures on this subject, one of which includes two adult cases and the other a single pediatric case. Since a reaction developed in the fifth step of the 27-step desensitization scheme (Ünal et al.), which we took as a reference, which led to a dose increase of more than 100 times, we modified the protocol by using an intermediate steps. We repeated the prick-to-prick test with red meat after desensitization in our case who successfully completed the modified desensitization protocol. Observation of more than half reduction in test edema diameter concretely supports the success of our modified desensitization protocol. |
Tuberkuloz ve Toraks. 2023 Sep 1;71(3):318-24. | Turkey; desensitization |
| Terzioglu K, Gözükara SI, Kant A. | 2021 | Red meat allergy in patients with IgE antibodies specific for galactose-alpha-1.3-galactose; A case series from Turkey |
Revue Française d'Allergologie. 2021 Jun 12. | Europe; Asia; Turkey |
| Thall A, Galili U. | 1990 | Distribution of Gal. alpha. 1. fwdarw. 3Gal. beta. 1. fwdarw. 4GlcNAc residues on secreted mammalian glycoproteins (thyroglobulin, fibrinogen, and immunoglobulin G) as measured by a sensitive solid-phase radioimmunoassay. The study of the expression of Galα1 → 3Ga1β1 → 4G1cNAc residues on mammalian glycoconjugates is of particular interest since as many as 1% of circulating IgG antibodies in man interact specifically with this carbohydrate residue. In recent studies, the authors have found that Galαl → 3Galβl → 4GlcNac residues are abundant on red cells and nucleated cells of nonprimate mammals, prosimians, and New World monkeys, but their expression is diminished in Old World monkeys, apes, and humans. In the present work, they have analyzed the expression of these residues on secreted mammalian glycoproteins. For this purpose, they have developed a radioimmunoassay (RIA) which enables the quantification of Galα1 → 3Galβ1 → 4GlcNAc residues on the secreted glycoproteins. Purified biotinylated anti-Gal was used as the antibody in the RIA, and bovine thyroglobulin enriched for Galα1 → 3Galβ1 → 4GlcNAc residues served as a solid-phase antigen. In this study, it is reported for the first time that the evolutionary pattern of Galα1 → 3Galβ1 → 4GlcNAc residue distribution in in vivo secreted glycoproteins is similar to that observed in membranes of cell lines and of red cells. It is argued that abnormal expression of Galα1 → 3Galβ1 → 4GlcNAc residues on human glycoproteins may result in anti-Gal-mediated autoimmune processes |
||
| Thomas H, Beaudouin E, Nguyen VM, Picaud J, Renaudin JM, Jacquenet S, Barbaud A. | 2017 | Mammals food anaphylaxis's cases from the French allergy vigilance network. Since 2009, cases of food-related anaphylaxis caused by mammalian meat and stemming from IgE antibodies specific to alpha-galactose have been identified, first in the United States then in Australia and several European states. However, there is little epidemiological data enabling these reactions to be classified as food allergies. The aim of this study is to determine the frequency of anaphylaxis caused by reaction to alpha-gal residue within the sphere of food allergy (FA) in France, to identify the symptoms, to analyze the results of diagnostic tests, and to check for the presence of cofactors. We studied 19 adult cases of anaphylaxis stemming from mammalian meat consumption and confirmed by the presence of IgE to alpha-Gal and reported in a questionnaire to identify food-related anaphylaxis by members of the Allergy Vigilance Network covering France and French-speaking Belgium from September 2008 to December 2015. The diagnostic assessment comprised assay of specific anti-alpha-Gal IgE, skin tests, and tests for IgE antibodies specific to meat. The presence of cofactors such as alcohol, physical exertion and medication, as well as exposure to tick bites, was also checked. Mammalian meat anaphylaxis stemming from alpha-galactose constituted 2.8% of FA in this period and occurred 2-12 hours after ingestion of the offending food, which in most cases was offal. In 47% of the cases studied, the reaction was preceded by a tick bite. In 12 (63.2%) of cases, cofactors were present, with alcohol consumption in 26.3% of subjects and physical exertion in 21.0%. |
REVUE FRANCAISE D ALLERGOLOGIE. 2017 Dec 1;57(8):533-8. | |
| Thomas PW, Ferweda G, West RL, Hoentjen F. | 2020 | Immediate infusion reaction to intravenous ustekinumab in three Crohn’s disease patients: a case report and review of the literature. Recently, ustekinumab has been approved for the treatment of Crohn’s disease and ulcerative colitis. Treatment is started with an intravenous induction dose, followed by a subcutaneous dosage. We present details of three patients with therapy-refractory Crohn’s disease who experienced an immediate infusion reaction to intravenous administration of ustekinumab. In two of these patients a subsequent reaction to subcutaneous injections occurred. Clinical features and pathophysiology are discussed. |
Journal of Crohn's and Colitis. 2020 Jun 26. | chinese hamster ovary; CHO; biologic; monoclonal antibody; mAb; Crohn's |
| Thompson JM, Carpenter A, Kersh GJ, Wachs T, Commins SP, Salzer JS. | 2023 | Geographic Distribution of Suspected Alpha-gal Syndrome Cases — United States, January 2017–December 2022. Alpha-gal syndrome (AGS) is an emerging, tick bite–associated allergic condition characterized by a potentially life-threatening immunoglobulin E (IgE)–mediated hypersensitivity to galactose-alpha-1,3-galactose (alpha-gal), an oligosaccharide found in most nonprimate mammalian meat and products derived from these mammals. Specific symptoms and severity of AGS vary among persons, and no treatment or cure is currently available. During 2010–2018, more than 34,000 suspected cases of AGS were identified in the United States, but current knowledge of where cases occur is limited. This study examined alpha-gal–specific IgE (sIgE) antibody testing results submitted to the commercial laboratory responsible for nearly all testing in the United States before 2022 to assess the geographic distribution and magnitude of this emerging condition. During January 1, 2017–December 31, 2022, a total of 357,119 tests were submitted from residences in the United States, corresponding to 295,400 persons. Overall, 90,018 (30.5%) persons received a positive test result in the study period, and the number of persons with positive test results increased from 13,371 in 2017 to 18,885 in 2021. Among 233,521 persons for whom geographic data were available, suspected cases predominantly occurred in counties within the southern, midwestern, and mid-Atlantic U.S. Census Bureau regions. These data highlight the evolving emergence of AGS and can be used to help state and local health agencies initiate surveillance and target public health outreach and health care provider education to high-risk localities. |
MMWR Morb Mortal Wkly Rep 2023;72:815–820. DOI: http://dx.doi.org/10.15585/mmwr.mm7230a2 | North America; United States; prevalence; geographic distribution; epidemiology |
| Tjernberg I, Hamsten C, Apostolovic D, van Hage M. | 2017 | IgE reactivity to alpha-Gal in relation to Lyme borreliosis. Background: An association between tick bites, the development of immunoglobulin E (IgE) antibodies to galactose-α-1, 3-galactose (α-Gal) and red meat allergy has recently been reported. Here we wanted to elucidate the relation between tick exposure, IgE antibodies to α-Gal and Lyme borreliosis (LB). Methods: In the highly LB endemic area of Kalmar County, Sweden, serum samples and health inquiries from 518 blood donors were included. All sera were investigated for multiple IgG anti-Borrelia antibodies using a multiplex assay (recomBead, Mikrogen). In addition, three serially collected sera over a six month period from 148 patients with clinically defined erythema migrans (EM) were included. IgE antibodies against α-Gal were determined using ImmunoCAP (Thermo Fisher Scientific). Results: In blood donors reporting previous LB (n = 124) IgE to α-Gal was found in 16%, while in donors denying previous LB but with multiple anti-Borrelia antibodies (n = 94; interpreted as asymptomatic LB) 10% were IgE α-Gal-positive. Finally, in donors without Borrelia antibodies denying previous LB (n = 300) 14% showed IgE to α-Gal. No significant difference in proportions among the groups were found. In EM patients, IgE to α-Gal was found in 32/148 (22%) at diagnosis, 31/148 (21%) after two-three months and 23/148 (16%) after six months. A significant reduction of proportion and level of IgE to α-Gal was found between the second and third sample (p<0.01). A positive IgE anti α-Gal was more common among men compared with women both in blood donors and in EM patients (p≤0.01). Conclusions: IgE to α-Gal reactivity was common in a tick endemic area but showed no significant relation to previous LB. IgE anti-α-Gal reactivity in EM patients peaked within three months of diagnosis of EM, after which it waned indicating that recent tick exposure is of importance in α-Gal sensitization. Furthermore, IgE anti α-Gal was more common in men compared with women. |
Plos one. 2017 Sep 27;12(9):e0185723. | Lyme; borreliosis; comorbidity; Europe; Sweden; |
| Tobacman JK. | 2015 | The common food additive carrageenan and the alpha-gal epitope. Letter to the editor Antibodies to the oligosaccharide epitope galactose-a-1,3- galactose (alpha-gal) are of considerable interest because they are so prevalent, include all isotypes, and are specific to humans and Old World apes. Alpha-gal–mediated responses, including immediate and delayed anaphylaxis, appear to be increasing. In the recent review ‘‘The alpha-gal story: lessons learned from connecting the dots,’’ sources of exposure to the alpha-gal epitope were presented, with particular attention to cetuximab, mammalian meat products, and tick bites.1 This communication is intended to bring attention to including carrageenan, a very commonly used food additive, to the list of sources of exposure to the alpha-gal epitope. |
Journal of Allergy and Clinical Immunology. 2015 Dec 1;136(6):1708-9. | carrageenan, red alagae, red seaweed |
| Tonnel AB, Tillie-Leblond I, Botelho AD, De Blay F, Pauli G. | 2009 | Severe acute asthma associated with raw meat cutting. A 26-year-old woman was admitted to the hospital on several occasions for acute severe asthma after preparing couscous and, specifically, after cutting raw beef and lamb before cooking. Pulmonary function tests revealed an obstructive pattern. At her first visit to the emergency department, she had significant urticaria and facial edema, rhinoconjunctivitis, and mostly a rapidly progressive and severe asthma attack. All these symptoms were triggered during the handling of raw lamb. Skin prick test (SPT) results were positive for Dermatophagoides pteronyssinus, Dermatophagoides farinae, cat, dog, and horse epithelia and for several raw meats (lamb, beef, and pork). The patient reported that she could eat cooked lamb and beef without any adverse effects. Total IgE level was 814 IU/L, and specific IgE antibodies (CAP System; Pharmacia, Uppsala, Sweden) were positive for lamb and pork (15.1 and 30.6 IU/mL, respectively) and only weakly positive for beef (0.4 IU/mL). A realistic provocation test was then performed. Raw lamb was handled and cut into small pieces by a nurse in the presence of the patient, which provoked an immediate cutaneous reaction (urticaria), sudden rhinitis, and conjunctivitis with acute bronchospasm. Peak expiratory flow rate values fell rapidly from 450 to 270 L/min (38% reduction). The positive response confirmed the link between cutaneous, nose, eye, and bronchial manifestations and the preparation of raw lamb. A 41-year-old cook in a restaurant whose job consisted exclusively of preparing and cutting raw meat had symptoms only during work time. Ten minutes after an unusual ingestion of raw meat, the patient noted rhinitis, conjunctivitis, breathlessness, localized itching, edema, and an episode of laryngeal edema with increasing dyspnea. Aeroallergen SPT results were negative for a panel of 13 food allergens. Results of SPTs with raw veal, beef, lamb, and pork were positive. Results of SPTs with beef, pork, horse, dog, and cat albumins were positive at dilutions of 10−5 g/L. Total IgE level was 515 IU/L, and specific IgE antibodies were positive for beef (class II) and pork (class I). The patient had a negative methacholine test result after a 15-day holiday, but a provocation test to methacholine performed after 3 weeks back at work showed a significant decline in forced expiratory volume in 1 second (FEV1) (provocation concentration that caused a decrease in FEV1 of 20%, 1 mg/mL), demonstrating bronchial hyperresponsiveness. The exact nature of allergens dispersing during the handling of raw beef is unknown and needs identification of allergen molecules present in the environment surrounding the cutting of raw meat and inhaled by the patient. Crab-processing workers may develop respiratory manifestations as specific IgE antibodies to crab proteins. A study performed aboard crab-processing vessels in Alaska quantified crab allergen concentrations and showed that the highest amounts were measured in air samples at butchering workstations. Similar conditions were observed in our 2 clinical cases with exposure to raw meat during the cutting phase. Another example is given by fish proteins, which become nebulized simply by being exposed to the atmosphere. Using a competitive IgE immunoassay to analyze environmental samples at a fish market, Taylor et al measured levels of fish allergen ranging from 2 to 25 ng/m3. Exposure to raw meat has the potential to induce, without any ingestion, anaphylactic symptoms and acute severe asthma. The handling and cutting of raw meat are likely to allow the release of meat aerosolized allergens into the environment, as already demonstrated in crab-exposed workers. The exact nature of the raw nebulized antigens deserves to be evaluated. The cases reported herein underline the clinical importance of the inhalation route of food allergens. |
Annals of Allergy, Asthma & Immunology. 2009 Apr 1;102(4):348. | airborne |
| Topçu Zİ, Kaklıkkaya N, Baki A, Orhan F. | 2018 | Characteristics of beef allergy in schoolchildren in Turkey. Background: The prevalence of immunoglobulin E (IgE) mediated beef allergy in childhood is unknown. We investigated the prevalence and characteristics of IgE-mediated beef allergy in urban schoolchildren. Methods: This cross-sectional study recruited 6000 randomly selected urban schoolchildren ages 6-17 years from the city center of Giresun in the eastern Black Sea region of Turkey during 2013. Children with suspected IgE-mediated beef allergy, determined by a self-administered questionnaire, after providing written consent, were skin-prick tested with commercial beef and cow's milk solutions and prick-prick tested with raw, boiled, and fried beef. Levels of serum-specific IgE to beef specific IgE and serum-specific IgE to cow's milk were determined by using fluorescent enzyme immunoassay. All children with suspected beef allergy were invited for a double-blind, placebo-controlled food challenge (DBPCFC) to determine the prevalence of IgE-mediated beef allergy. Results: The response rate to the questionnaire was 82.2%. The estimated prevalence of parental-reported IgE-mediated beef allergy was 2.6%. The prevalence of IgE-mediated beef allergy confirmed by DBPCFC was 0.30% (95% confidence interval, 0.18-0.5%). Positive challenge responses were observed in 70.6% (p = 0.027), 76.9% (p = 0.027), and 73.3% (p = 0.028) of the children with a positive family history of beef allergy, positive skin test results, and positive beef specific IgE values, respectively. A beef specific IgE value of >5 kUA/L alone or a combination of a positive family history of beef allergy, positive skin test results, and beef specific IgE values of >3 kUA/L yielded a positive response to DBPCFC. Conclusion: The presence of a family history of beef allergy, beef specific IgE value, and skin test result positivity are independently associated with positive DBPCFC results, and combined evaluation of these three parameters increased the positive predictive power of the tests. |
Allergy & Asthma Proceedings 2018 Jan 1 (Vol. 39, No. 1). | Asia; Europe; Turkey; beef allergy; family history; Topcu; Kaklikkaya; prevalence |
| Tripathi A, Commins SP, Heymann PW, Platts-Mills TA. | 2014 | Delayed Anaphylaxis to Red Meat Masquerading as Idiopathic Anaphylaxis. Anaphylaxis is traditionally recognized as a rapidly developing combination of symptoms that often includes hives and hypotension or respiratory symptoms. Furthermore, when a specific cause is identified, exposure to this cause is usually noted to have occurred within minutes to 2 hours before the onset of symptoms. This case is of a 79-year-old woman who developed a severe episode of anaphylaxis 3 hours after eating pork. Before 2012, she had not experienced any symptoms after ingestion of meat products. Delayed anaphylaxis to mammalian meat has many contrasting features to immediate food-induced anaphylaxis. The relevant IgE antibody is specific for the oligosaccharide galactose-alpha-1,3-galactose, a blood group substance of nonprimate mammals. There is evidence from Australia, Sweden, and the United States that the primary cause of this IgE antibody response is tick bites. These bites characteristically itch for 10 days or more. Diagnosis can be made by the presence of specific IgE to beef, pork, lamb, and milk, and the lack of IgE to chicken, turkey, and fish. Skin prick tests (but not intradermal tests) generally are negative. Management of these cases, now common across the southeastern United States, consists of education combined with avoidance of both ingestion of red meat and further tick bites. |
The Journal of Allergy and Clinical Immunology: In Practice. 2014 May 1;2(3):259-65. | |
| Tripathi A, Commins SP, Heymann PW, Platts-Mills TA. | 2015 | Diagnostic and experimental food challenges in patients with nonimmediate reactions to food. Food challenge is a common and important part of the evaluation of patients with acute reactions to foods, such as milk, egg, wheat, or peanut. Furthermore, double-blind, placebo-controlled food challenges (DBPCFCs) have played a major role in the investigation of food allergy in children. 1 An important element of these challenges is that the responses are sufficiently rapid that increases in dose can be made every 30 minutes (or less). In adults the number of diagnostic challenges needed is much smaller. However, there are an increasing number of cases in adults in which the reactions to food are not rapid and in which the reactions only occur, or occur more consistently, if they are “enhanced.” The most common form of enhancement is exercise, but alcohol and aspirin can also play a role, either in diagnostic challenge or through naturally occurring exposure. 2 In this issue of the Journal, there is an important report on the effects of enhancement on oral food challenges (OFCs) with gluten in adult patients who presented with wheat-dependent exercise-induced anaphylaxis (WD-EIA). 3 |
Journal of Allergy and Clinical Immunology. 2015 Apr 1;135(4):985-7. | Diagnosis; oral food challenge |
| Tripathi A, Erwin EA, Workman LJ, Commins SP, Platts-Mills TA. | 2014 | Measurement of IgE antibodies to minor components in eosinophilic esophagitis, peanut allergy, and delayed anaphylaxis to mammalian meat. Background: In the investigation of food allergy syndromes, serum assays detecting IgE antibodies (Ab) to food allergens use whole extracts on the solid phase, which contain specific allergen components in varying amounts. The interpretation of results assumes that the causative allergen components are adequately represented in the extract and that the presence and level of specific IgE titer to the whole extract of the relevant food(s) are diagnostic of the syndrome. IgE assays for beef or pork can underestimate the IgE Ab to a minor component of mammalian meat, such as galactose-α-1,3-galactose (α-gal). The inciting food allergens in Eosinophilic Esophagitis (EoE) remain unclear, although IgE Ab to milk, wheat, soy, and peanut are frequently present in low titer. Method: IgE Ab to relevant allergens and their components were measured in the sera of adults and children with peanut allergy, delayed anaphylaxis to mammalian meat, or esophageal biopsy-diagnosed EoE. Assay methods included: ImmunoCAP (CAP) using whole and component extracts, CAP assays on serial dilutions (1:2 to 1:8) of sera, and ImmunoCAP ISAC (biochip assay for 112 purified allergens). Results: Analysis with ISAC correlated well with results using component-specific CAP assays for both peanut allergens (peanut allergy) and inhalant allergens (EoE). By contrast, no positive results for food allergens were found by ISAC in EoE sera that were positive for milk, wheat, or soy by CAP. Dilution assays showed no change (undiluted value vs. calculated titer) in either peanut allergy sera or EoE sera positive for aeroallergens (dust mite and cat); in contrast, calculated titers up to six times the undiluted value were noted for foods in EoE sera (milk, wheat, and peanut) and in mammalian meat allergy sera (beef and pork). CAP assays for 5 milk components revealed positivity to minor components in 50% of EoE sera. CAP assays for α-gal revealed positivity in 100% of patients presenting with delayed anaphylaxis to mammalian meat. Conclusion: Differences in the results of the dilution assays demonstrate that assaying undiluted sera can significantly underestimate IgE Ab levels if the IgE Ab are directed against a quantitatively minor component of the extract on the solid phase. These results strongly suggest that the IgE Ab to milk and other foods in EoE sera are directed against a minor component that has not yet been identified. |
Clinical and Translational Allergy. 2014 Mar 1;4(S2):O23. | |
| Tripathi A, Workman LJ, Commins SP, Erwin EA, Platts-Mills TA. | 2015 | Analysis of IgE Antibodies in Several Food Allergy Syndromes By Serial Dilutions of Serum on Immunocap with Whole and Component Allergens. RATIONALE: IgE ImmunoCAP levels are often above detection limit (>100 IU/mL). Actual IgE levels are determined by re-assay with diluted sera. For most allergens including those specific to food-induced immediate anaphylaxis, consistent, calculated results are obtained across the range of dilutions. By contrast, diluted sera of patients with certain food allergy (FA) syndromes, when assayed, do not yield the predicted results. METHODS: Sera of adults and children with Peanut Allergy (PA), Milk Allergy (MA), Mammalian Meat Allergy (MMA), or Eosinophilic Esophagitis (EoE) were serially diluted (1:2 to 1:16) and assayed for IgE to whole allergens and correlating component(s) by the ImmunoCAP method (peanut, Ara h 2; milk, Bos d 8, Bos d 4; beef, alpha-gal; wheat; mite; cat). RESULTS: Dilution assays for allergens showed no change (undiluted vs. calculated titer) in: PA (peanut, Ara h 2), MA (milk, Bos d 8, Bos d 4), and EoE (mite, cat). In contrast, calculated titers up to six times the undiluted titers were noted in EoE (milk, wheat, peanut) and MMA (beef). Assays on MMA sera for alpha-gal IgE showed no change from the undiluted titer. CONCLUSIONS: Dilution results reveal that assay of undiluted sera is likely adequate for measurement of IgE in food-induced immediate anaphylaxis. However, increasing titers upon dilution, as was found in MMA and EoE, suggest underestimation of specific IgE levels. IgE in MMA is directed against alpha-gal– an established, quantitatively minor component of beef. Increasing titers with dilution assays to whole food allergens in EoE strongly suggest presence of IgE to minor component(s). |
Journal of Allergy and Clinical Immunology. 2015 Feb 1;135(2):AB249. | |
| Trivić T, Blagojević G, Živančević-Simonović S, Janjušević A, Dragačević L, Burazer L, Prodić I, Minić R. | 2024 | Thyroglobulin specific IgE and a possible link to suspected penicillin induced allergic skin manifestations–cross sectional study. |
Food and Chemical Toxicology. 2024 Jun 6:114795. | Europe; Serbia; autoimmune; thyroid |
| Tronconi MC, Sclafani F, Rimassa L, Carnaghi C, Personeni N, Santoro A. | 2011 | A. Fatal infusion reaction to cetuximab: the need for predictive risk factors and safer patient selection. | Journal of Clinical Oncology. 2011 Jun 20;29(23):e680-1 | Medical product; pharmaceutical; monoclonal antibody; mAb; cetuximab |
| Trout Fryxell RT, Hendricks BM, Pompo K, Mays SE, Paulsen DJ, Operario DJ, Houston AE. | 2017 | Investigating the adult ixodid tick populations and their associated Anaplasma, Ehrlichia, and Rickettsia bacteria at a Rocky Mountain spotted fever hotspot in Western Tennessee. Ehrlichiosis and rickettsiosis are two common bacterial tick-borne diseases in the southeastern United States. Ehrlichiosis is caused by ehrlichiae transmitted by Amblyomma americanum and rickettsiosis is caused by rickettsiae transmitted by Amblyomma maculatum and Dermacentor variabilis. These ticks are common and have overlapping distributions in the region. The objective of this study was to identify Anaplasma, Ehrlichia, and Rickettsia species associated with questing ticks in a Rocky Mountain spotted fever (RMSF) hotspot, and identify habitats, time periods, and collection methods for collecting questing-infected ticks. Using vegetation drags and CO2-baited traps, ticks were collected six times (May–September 2012) from 100 sites (upland deciduous, bottomland deciduous, grassland, and coniferous habitats) in western Tennessee. Adult collections were screened for Anaplasma and Ehrlichia (simultaneous polymerase chain reaction [PCR]) and Rickettsia using genus-specific PCRs, and resulting positive amplicons were sequenced. Anaplasma and Ehrlichia were only identified within A. americanum (Ehrlichia ewingii, Ehrlichia chaffeensis, Panola Mountain Ehrlichia, and Anaplasma odocoilei sp. nov.); more Ehrlichia-infected A. americanum were collected at the end of June regardless of habitat and collection method. Rickettsia was identified in three tick species; “Candidatus Rickettsia amblyommii” from A. americanum, R. parkeri and R. andeanae from A. maculatum, and R. montanensis ( = montana) from D. variabilis. Overall, significantly more Rickettsia-infected ticks were identified as A. americanum and A. maculatum compared to D. variabilis; more infected-ticks were collected from sites May–July and with dragging. In this study, we report in the Tennessee RMSF hotspot the following: (1) Anaplasma and Ehrlichia are only found in A. americanum, (2) each tick species has its own Rickettsia species, (3) a majority of questing-infected ticks are collected May–July, (4) A. americanum and A. maculatum harbor pathogenic bacteria in western Tennessee, and (5) R. rickettsii remains unidentified. |
Vector-Borne and Zoonotic Diseases. 2017 Aug 1;17(8):527-38. | Tick-borne disease; ehrichia; rickettsiae; lone star tick; amblyomma |
| Turner PJ, Campbell DE, Motosue MS, Campbell RL. | 2019 | Global Trends in Anaphylaxis Epidemiology and Clinical Implications. The true global scale of anaphylaxis remains elusive, because many episodes occur in the community without presentation to healthcare facilities, and most regions have not yet developed reliable systems with which to monitor severe allergic events. The most robust datasets currently available are based largely on hospital admissions, which are limited by inherent issues of misdiagnosis, misclassification and generalizability. Despite this, there is convincing evidence of a global increase in rates of all cause-anaphylaxis, driven largely by medication and food-related anaphylaxis. There is no evidence of parallel increases in global all-cause anaphylaxis mortality, with surprisingly similar estimates for case fatality rates at approximately 0.5-1% rate of fatal outcomes for hospitalizations due to anaphylaxis across several regions. Studying regional patterns of anaphylaxis to certain triggers have provided valuable insights into susceptibility and sensitizing events: for example, the link between the monoclonal antibody cetuximab and allergy to mammalian meat. Likewise, data from published fatality registers can identify potentially modifiable risk factors which can be used to inform clinical practice, such as prevention of delayed epinephrine administration, correct posturing during anaphylaxis, special attention to populations at risk (such as the elderly on multiple medications) and use of venom immunotherapy in individuals at risk of insect-related anaphylaxis. |
The Journal of Allergy and Clinical Immunology: In Practice. 2020 Apr 1;8(4):1169-76. | |
| Uasuf CG, Torina A, Ferrantelli V, Brusca I. | 2018 | An unusual case of positive sIgE to Galactose-alpha-1,3-galactose from South Italy. We report the case of a 38-year-old man who was bitten several times during his life by a tick. He didn't report any previous history of anaphylaxis after the ingestion of red meat. The serum specific IgE showed positivity to alpha-Gal. The proximity of the bits didn't increase the titer of IgE antibodies to alpha-gal. We could hypothesize that the frequency of the exposure to the tick Corresponding author bites and the amount of tick bites during his lifetime induced a sort of tolerance in this patient. |
European annals of allergy and clinical immunology. 2018 Jan;50(1):45-7. | |
| Uchi, J. | 2023 | P209: Understanding Health Related Challenges in Patients with Alpha-Gal Syndrome |
||
| Unal D, Coskun R, Demir S, Gelincik A, Colakoglu B, Buyukozturk S. | 2017 | Successful beef desensitization in 2 adult patients with a delayed-type reaction to red meat. Allergic reactions to red meat are relatively uncommon and responsible for approximately 3% of all food allergies.1 Recently, a new syndrome has been described in which delayed onset of anaphylaxis occurs 3 to 6 hours after mammalian meat consumption. This reaction is associated with IgE antibodies directed against oligosaccharides galactose-alpha-1,3-galactose (alpha-gal).2 Following this finding it was concluded that some patients previously diagnosed with “spontaneous” or “idiopathic” anaphylaxis may have had delayed anaphylaxis to red meat that was not immediately recognized because of the significant delay between the exposure to meat and the appearance of symptoms.3 Although avoidance is the main treatment option for food allergies, it can cause difficulties especially in children who are allergic to common foods.4,5 For that reason, food immunotherapy trials have been undertaken with children to selected foods, such as milk and peanuts.6 Since the avoidance of beef or lamb is not difficult for adults, desensitization has not been commonly considered as an option for “red meat” cases.7 Here, we present 2 cases of delayed-onset red meat allergy that were successfully desensitized to beef. |
J Allergy Clin Immunol Pract. 2017 Mar 1;5(2):502-3. | |
| Ünal D, Eyice‐Karabacak D, Kutlu A, Demir S, Tüzer C, Arslan AF, Işık SR, Gelincik A. | 2023 | Oral immunotherapy in alpha‐gal red meat allergy: Could specific IgE be a potential biomarker in monitoring management?. Our study showed the long-term safety and efficacy of alpha-gal OIT. Additionally, alpha-gal sIgE seems to be a potential biomarker to monitor OIT. |
Allergy. 2023 Aug 7. | treatment; OIT; oral immunotherapy |
| Ünal D, Eyice‐Karabacak D, Kutlu A, Demir S, Tüzer C, Arslan AF, Işık SR, Gelincik A. | 2024 | Oral immunotherapy in alpha‐gal red meat allergy: could specific IgE be a potential biomarker in monitoring management?. |
Allergy. 2023 Dec;78(12):3241-51. | |
| Unknown | 2019 | A SECOND CASE OF MAMMALIAN MEAT ALLERGY IN WATERBURY, CT Introduction: Mammalian Meat Allergy (MMA) is a rare, IgE mediated delayed hypersensitivity reaction that may be confused with other etiologies of urticarial rashes. MMA is more common in the Southeastern United States but may be on the rise in Connecticut. Case History: Our patient is a 55 year old male who previously tolerated and regularly consumed beef and pork. In April of 2019 he reports working in his yard and cutting "very tall grass". In May of 2019, he developed a pruritic, generalized, urticarial rash accompanied by shortness of breath 3-4 hours after consuming Vietnamese beef stew. He was treated at a local hospital with Benadryl, solumedrol, and pepsid with complete resolution of symptoms within 2 hours and released. He was evaluated in our office and found to have an unremarkable physical exam, but did show elevations in sIgE to Alpha-Gal (58.5 kU/L), beef (11.10 kU/L), pork (5.77 kU/L), and lamb (1.28 kU/L). He is now symptom free, avoids all red meat, avoids the MMR vaccine, and carries an EpiPen. Discussion: MMA manifests as urticaria, angioedema, or anaphylaxis within 3-6 hours after the ingestion of Galactose-Alpha-1,3-Galactose (Alpha-Gal) containing meat products (1-4). Patients most commonly develop IgE antibodies to Alpha-Gal following a bite from a lone star tick (Amblyomma americanum) (5). Previously rare in Connecticut, recent studies have shown lone star tick populations to be on the rise in the southwestern part of our state (6). Management involves the avoidance of all red meat or red meat containing products like certain vaccines (7). |
Allergy Asthma Immunol. 2019;123(S64eS142):S127. | New England; Connecticut |
| Urra JM, Ferreras E, Contreras M, Cabrera CM, Fernández de Mera IG, Villar M, Cabezas-Cruz A, Gortázar C. | 2020 | Immunity to glycan alpha-gal and COVID-19: Possibilities for disease control and prevention. |
Journal of Infectious Diseases and Research 3(S3): 09 (2020) | Covid; coronavirus; vaccination |
| Urra JM, Ferreras-Colino E, Contreras M, Cabrera CM, de Mera IG, Villar M, Cabezas-Cruz A, Gortázar C, de la Fuente J. | 2020 | The antibody response to the glycan α-Gal correlates with COVID-19 disease symptoms. The coronavirus disease 19 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has affected millions of people worldwide. The characterization of the immunological mechanisms involved in disease symptomatology and protective response is important to advance in disease control and prevention. Humans evolved by losing the capacity to synthesize the glycan Galα1-3Galβ1-(3)4GlcNAc-R (α-Gal), which resulted in the development of a protective response against pathogenic viruses and other microorganisms containing this modification on membrane proteins mediated by anti-α-Gal IgM/IgG antibodies produced in response to bacterial microbiota. In addition to anti-α-Gal antibody-mediated pathogen opsonization, this glycan induces various immune mechanisms that have shown protection in animal models against infectious diseases without inflammatory responses. In this study, we hypothesized that the immune response to α-Gal may contribute to the control of COVID-19. To address this hypothesis, we characterized the antibody response to α-Gal in patients at different stages of COVID-19 and in comparison with healthy control individuals. The results showed that while the inflammatory response and the anti-SARS-CoV-2 (Spike) IgG antibody titers increased, reduction in anti-α-Gal IgE, IgM and IgG antibody titers and alteration of anti-α-Gal antibody isotype composition correlated with COVID-19 severity. The results suggested that the inhibition of the α-Gal-induced immune response may translate into more aggressive viremia and severe disease inflammatory symptoms. These results support the proposal of developing interventions such as probiotics based on commensal bacteria with α-Gal epitopes to modify the microbiota and increase the α-Gal-induced protective immune response and reduce the severity of COVID-19. |
bioRxiv. 2020 Jan 1. | Enveloped virus; corona virus; SARS-Cov-2; Covid-19; immunity; prevalence; Spain; Ciudad Real |
| USDA | 2011 | Carrageenan Handling/Processing Note: lists names of carrageenan, foods it's found in and more |
Journal of Apicultural Research. 2018 Jan 1;57(1):5-37. | Carrageenan |
| Usov AI. | 2011 | Polysaccharides of the red algae. Red algae (Rhodophyta) are known as the source of unique sulfated galactans, such as agar, agarose, and carrageenans. The wide practical uses of these polysaccharides are based on their ability to form strong gels in aqueous solutions. Gelling polysaccharides usually have molecules built up of repeating disaccharide units with a regular distribution of sulfate groups, but most of the red algal species contain more complex galactans devoid of gelling ability because of various deviations from the regular structure. Moreover, several red algae may contain sulfated mannans or neutral xylans instead of sulfated galactans as the main structural polysaccharides. This chapter is devoted to a description of the structural diversity of polysaccharides found in the red algae, with special emphasis on the methods of structural analysis of sulfated galactans. In addition to the structural information, some data on the possible use of red algal polysaccharides as biologically active polymers or as taxonomic markers are briefly discussed. |
InAdvances in carbohydrate chemistry and biochemistry 2011 Jan 1 (Vol. 65, pp. 115-217). Academic Press. | Rhodophyta; red algae; carrageenan |
| Uyttebroek A, Sabato V, Bridts CH, De Clerck LS, Ebo DG. | 2014 | Anaphylaxis to succinylated gelatin in a patient with a meat allergy: galactose-alpha(1, 3)-galactose (alpha-gal) as antigenic determinant. Specific immunoglobulin E (sIgE) antibodies towards the galactose-alpha(1,3)-galactose (alpha-gal) moieties may elicit life-threatening and fatal anaphylactic reactions. Patients sensitized to alpha-gal moieties from mammalian meat may also react towards mammalian gelatins and gelatin-containing drugs such as bovine gelatin-based colloid plasma substitute. The case of a 56-year-old woman with a meat allergy who suffered anaphylaxis to succinylated gelatin is reported. |
Journal of clinical anesthesia. 2014 Nov 1;26(7):574-6. | |
| Vakaljan SL, Scheffler SA, Wu V, Ohayon JA. | 2019 | When Milk isn't the Problem—Carrageenan as a Trigger for Allergic Reactions to Dairy Products. Rationale: Carrageenan is a thickening or emulsifying agent in food and medicinal products that is derived from red seaweed algae. Adverse reactions to carrageenan have been reported sparingly with barium enema solution, but may also be associated with adverse reactions to food. Methods: A 12 year old male patient presented to a community allergy clinic with an immediate, suspected allergic, reaction to ice cream. The allergy evaluation included skin testing, and oral challenges to a sample of the ice cream, ASA, and carrageenan. Results: Skin testing to common foods was negative. An oral challenge in office to a sample of the ice cream resulted in chest tightness and throat discomfort. Salicylates were suspected as a potential trigger, ruled out on subsequent ASA oral challenge. The patient later had a reaction to whipped cream, which among other ingredients previously ruled out for allergy, contained carrageenan. Skin testing to carrageenan revealed a borderline response. A blinded oral challenge to powdered carrageenan in a food vehicle was carried out. The first oral challenge dose containing 0.1 g elicited symptoms of chest pain and a reduction of 10% in FEV1 from baseline, which reversed by 14% post-bronchodilator, confirming an immediate allergic response. Carrageenan avoidance was recommended. Information was given to the family on avoidance of carrageenan in food products and medications. Conclusions: Carrageenan may account for allergic reactions to foods or medications in the absence of other allergic triggers. Potential carrageenan sources include dairy products, milk alternatives, protein supplements, meat products, and oral medications. |
Journal of Allergy and Clinical Immunology. 2019 Feb 1;143(2):AB73. | carrageenan |
| Valcárcel F, Elhachimi L, Vilá M, Tomassone L, Sánchez M, Selles SM, Kouidri M, González MG, Martín‐Hernández R, Valcárcel Á, Fernández N. | 2023 | Emerging Hyalomma lusitanicum: From identification to vectorial role and integrated control. |
Emerging Hyalomma lusitanicum: From identification to vectorial role and integrated control. Medical and Veterinary Entomology. 2023 May 5. | Vectors of sensitization; ticks; Hyalomma |
| Valcárcel Olmeda Á, Briones Montero A, Rodero Martínez M, González Fernández J, Olmeda García ÁS, Valcárcel F, Cuéllar Del Hoyo MD. | 2024 | Alpha-Gal, epitope responsible for allergy to red meat, in the Mediterranean tick Hyalomma lusitanicum. |
Med Vet Entomol. Published online May 13, 2024. doi:10.1111/mve.12724 | Europe; Spain; vector; tick; Hyalomma lusitanicum |
| Valk-Weeber R. | 2020 | The composition and dynamic nature of the N-linked glycoprofile of bovine milk serum and its individual proteins. Bovine milk serum (whey), the solvent that remains after removal of the caseins, contains many functional proteins. Some of these proteins are decorated with carbohydrate structures, also known as glycans, that provide additional functions to their respective proteins. In this work, methods were developed and used for the analysis of the glycosylated proteins of bovine milk whey. The 3 main proteins that contribute to the overall glycoprofile of bovine whey were identified as lactoferrin, immunoglobulin G and glycosylation dependent adhesion molecule 1 (GlyCAM-1). The profile of glycans expressed on the glycoproteins is strongly regulated, but under certain conditions changes can take place. For example, we observed that the glycans of lactoferrin vary during the short colostrum period. In functional studies with highly purified glycans of lactoferrin, we showed that these glycans interact with the immune system via so-called Toll-like receptors. Changes in the glycoprofile can affect the receptor interaction, resulting in altered functionality. The protein GlyCAM-1 is absent in human milk, but in bovine milk we found that its concentration is relatively high. The glycans of GlyCAM-1 make a significant contribution to the overall whey glycoprofile and carry important functional epitopes, with a relatively high sialylation and fucosylation degree. We discovered that the levels of sialylation and fucosylation of GlyCAM-1 vary between individual cows, but also with dietary substrates, potentially as a result of metabolic imbalances. The large contribution of GlyCAM-1 to the overall glycoprofile, together with its glycoprofile variability, makes it an interesting target for further study. |
[Groningen]: University of Groningen, 2020. 337 p. | Milk; dairy; glycoproteins |
| van Bueren JJ, Rispens T, Verploegen S, van der Palen-Merkus T, Stapel S, Workman LJ, James H, van Berkel PH, van de Winkel JG, Platts-Mills TA, Parren PW. | 2011 | Anti-galactose-alpha-1,3-galactose IgE from allergic patients does not bind alpha-galactosylated glycans on intact therapeutic antibody Fc domains. Letter to the Editor Manufacture of monoclonal antibodies (mAb) and related biologies is performed in eukaryotic cell lines to allow proper glycosylation, which is often critical for function. The first mAbs were produced in the mouse-derived cell lines SP2/0 and NS0, which have the genetic makeup to produce proteins containing nonhuman glycan structures, such as galactose-[alpha]-1,3-galactose ([alpha]-Gal) and N-glycolylneuramic acid (1), that can adversely affect safety and half-life. The best example is Erbitux (cetuximab), produced in SP2/0 cells, clinical use of which has been associated with [alpha]-Gal-specific, IgE-mediated anaphylactic responses (2). In addition, patients with IgE antibodies to [alpha]-Gal may experience allergic reactions to red meat (3,4). The quantity of [alpha]-Gal required to induce hypersensitivity reactions is not known; however, it is clear that binding of IgE antibodies against [alpha]-Gal is an important trigger in this pathology (2). Another host cell frequently used for mAb manufacture is the Chinese hamster ovary (CHO) cell line. For years it was thought that CHO cells lack the machinery to synthesize [alpha]-Gal and therefore represent a more suitable production system for protein therapeutics, although the ability of CHO cells to produce the [alpha]-Gal epitope in recombinant proteins was previously reported (5). Recently, Bosques et al. (6) have identified a functional CHO ortholog of N-acetyllactosaminide-3-ogalactosyltransferase-1, showing that the therapeutic product abatacept (Orencia, CTLA4-IgG fusion protein), produced in CHO, contains [alpha]-Gal residues. Knowing this, they argue that proteins manufactured in CHO cells need to be monitored and controlled for [alpha]-Gal levels. To date, therapeutic mAbs manufactured in various production cell lines have been used to treat numerous patients without direct evidence for the [alpha]-Gal IgE-mediated hypersensitivity reactions observed with cetuximab; however, cetuximab is not the only therapeutic mAb for which IgE-mediated hypersensitivity-like reactions have been observed (7). For cetuximab, the problem appears to relate to its [alpha]-Gal-containing glycosylation in the Fab domain. Therapeutic mAbs usually lack such Fab glycosylation and carry glycans only in their Fc domain (8). There are several possible explanations for the absence of IgE-mediated hypersensitivity reactions associated with therapeutic mAbs produced in murine cell lines other than cetuximab. First, these mAbs may contain fewer [alpha]-Gal glycans; or second, glycans in the Fc domain may not be sufficiently accessible for IgE binding; or third, glycans present in the Fab domain may differ in [alpha]-Gal glycan composition compared with glycans in the Fc domain. Finally, an IgE-mediated reaction might be attenuated by competition with natural [alpha]-Gal IgG or IgM antibodies. Here we studied whether IgE antibodies against [alpha]-Gal can interact with [alpha]-Gal moieties on six representative therapeutic mAbs produced in the three different mammalian production systems: SP2/0 (cetuximab; and Remicade, infliximab), NS0 (Simulect, basiliximab; and Synagis, palivizumab) and CHO (Vectibix, panitumumab; and zalutumumab) (Supplementary Table 1). |
Nature biotechnology. 2011 Jul;29(7):574-6. | pharmacy; pharmaceutical; biologics; mAb; monoclonal antibodies; biological agents; abatacept; Chinese hamster ovary; CHO |
| van Gorkom T, Heron M, Hofhuis A, Jongerius C, van der Klis FRM, Oude Elberink HNG, Sprong H, Thijsen SFT, Kremer K. | 2025 | Alpha-Gal Sensitization Dynamics in Individuals After Tick Bites With or Without Erythema Migrans. |
Clin Exp Allergy. 2025 Mar 19. doi: 10.1111/cea.70011. Epub ahead of print. PMID: 40108824. | Prevalence; tick bites; Europe; the Netherlands; pathogenesis |
| van Nunen S and Ratchford A. | 2021 | Managing mammalian meat allergy and tick anaphylaxis |
MedicineToday 2022; 23(7 Suppl): 11-17. First Published 2021; 22(3): 22-32. Updated July 2022 | Australia; management |
| van Nunen S, Basten A, Cowdery N, Anderson D, Broady K, Said M, Ratchford A, Doggett S, Arns E, Cook G, Ginsborg S. | 2013 | THE DEVELOPMENT OF TIARA (TICK-INDUCED ALLERGIES RESEARCH AND AWARENESS) Background: World-wide, the association of mammalian meat-inducedanaphylaxis and previous tick bites was first described by van Nunen et al.in2007. Since that time she has seen in excess of 450 people with thiscondition and currently sees at least 2 newly diagnosed people/week, and,where ticks are endemic, tick-induced anaphylaxis has become such acommon cause of anaphylaxis, that the development of TiARA (Tickinduced Allergies Research and Awareness) was prompted. Methods: The Terms of Reference established by the TiARA Committeeare to:• Promote awareness of tick bite-associated mammalian meat & tick biteinduced anaphylaxis• Provide educational resources for these individuals and the wider community• Promote research into prevention and cure of tick-induced allergies and• Disseminate proven tick management strategies Results: Awareness initiatives:• www.tiara.org.au has been designed and uploaded.• e-pamphlets have been distributed to regional Emergency Departmentsand Emergency physicians throughout Australasia and pamphlets given toour regional Emergency Departments.• e-pamphlet and pamphlets have been distributed to all GPs in SydneyNorth Shore and Beaches and Northern Sydney Medicare Locals andEmergency Departments in our region.• Allergy & Anaphylaxis Australia has established a website link towww.tiara.org.au.• All NSW parliamentary electorate offices have been given information forpublication regarding tick-induced allergies.• PSU (Public Servants Union) website has posted information.Website resources developed:• Ambassadors‘ recounts and tips for living with these conditions.• Downloadable pamphlet: ‘Allergic Conditions caused by Tick Bites’.• ‘Allergies provoked by Ticks’ presentation.• Comprehensive dietary information.• The Medical Science behind Tick-induced Allergies: references from themedical literature. Conclusion: Emerging allergies call for concerted action by clinicians,sufferers, scientists, community leaders and government, to ensure community awareness and generate appropriate responses leading to theseconditions being controlled. The development of TiARA may serve as aparadigm |
ASCIA 2013 Poster Abstracts | awareness; education; australia |
| van Nunen S, Mastroanni M, Fulton R, Fernando S, Basten T. | 2011 | CLINICAL UTILITY OF ALLERGEN-SPECIFIC IgE MEASUREMENT IN THE DIAGNOSIS OF MAMMALIAN MEAT-INDUCED ANAPHYLAXIS ASSOCIATED WITH PRIOR TICK BITES: P70. ASCIA 2011 Poster Abstract. Background:In 2007, van Nunen et al. first described the association between red meat-induced anaphylaxis and prior tick bites (van Nunen et al 2007). Given the distribution of Ixodes holocyclus (along the entire Eastern seaboard of Australia) and that ticks occur overall in a wide distribution within Australia, this complaint is likely to prove more common in the future, particularly considering predicted climate change effects on hosts’ habitat. Accordingly, we have examined whether commercially available mammalian meat RAST results correlate with a clearcut clinical diagnosis. Methods: The mammalian meat RAST results were reviewed in twenty patients whose clinical histories of mammalian meat anaphylaxis associated with tick bites satisfied a strict algorithm for diagnosis- prior large local reactions to tick bites, ingestion of mammalian meat 5-7 hours pre-anaphylaxis and total remission following strict mammalian meat exclusion. Results: In this selected patient group, all individuals had positive mammalian meat RASTs (20/20). Conclusions: A strong correlation appears likely then between positivity of the mammalian meat RASTs and typical mammalian meat anaphylaxis associated with prior tick bites, when the patient’s history satisfies a strict clinical algorithm for the diagnosis of this condition. The clinical utility of this observation lies in the ability of mammalian meat RAST results to provide confirmatory evidence for the diagnosis in sufferers in a timely manner, with testing easily available to primary medical practitioners, which may thereby reduce the morbidity associated with delayed diagnoses of this cause of anaphylaxis, a diagnosis with unique clinical features lending itself to such an approach. |
Internal Medicine Journal. 2011 Sep; 41. | |
| van Nunen S, Mastroianni M, Fulton R, Fernando S, Basten A. | 2013 | Clinical significance of detectable alpha-gal-specific IgE in individuals with undetectable specific IgE for mammalian meats in mammalian meat allergy following tick bites. No abstract available |
Asia Pacific Congress of Allergy, Asthma and Clinical Immunology. 2018; 68. | |
| van Nunen S, Mullins R, Baumgart K, Fernando S, Fulton R, Ratchford A, Broady K, Basten A. | 2014 | Alphagal and mammalian meat specific-IgE in mammalian meat tolerant tick anaphylaxis sufferers: 697. No abstract available |
Allergy: European Journal of Allergy and Clinical Immunology. 2014 Sep;69:276-7. | |
| van Nunen S, O'Connor K, Fernando S, Clarke L, Boyle R. | 2007 | P17 The Association Between Ixodes Holocyclus Tick Bite Reactions and Red Meat Allergy. Introduction: Red meat allergy is rare in the adult population. An association between red meat allergy and local reactions to Australian tick, Ixodes holocyclus, has been observed. A retrospective analysis was conducted to further examine this association in one Sydney North Shore Allergy Practice. Methods and results: Twenty-five patients with confirmed IgE-mediated response to red meat were analysed. All patients had documented positive skin prick responses and/or RASTs to red meat. Twenty-three of the 25 patients gave a history of a clinical reaction following the ingestion of red meat. Fourteen of these individuals had a documented severe allergic reaction with cardiovascular and or respiratory compromise.The most commonly implicated meat was beef followed by lamb and then pork. However, a number of other meats also produced clinical reactions and positive skin prick tests including kangaroo, venison, goat and rabbit. Patients ranged in age from 21 to 63 years and all, except one patient, developed their meat allergy in adulthood. Twenty-four of the 25 patients gave a history of a large local reaction to tick bites. One patient reported multiple tick bites but no local reaction. Furthermore, in all but one case, the history of tick exposure preceded the development of the meat allergy. A group of 25, age matched patients, from the same practice with other IgE-mediated food allergies were questioned about tick exposure and none of these patients gave a history of large local reactions. Conclusion: Our study suggests an association between red meat allergy and local reactions to tick bites. We propose that tick salivary proteins may sensitize individuals to IgE-mediated responses to cross reactive proteins in red meat. Further studies are required to characterise the allergen. |
Internal Medicine Journal. 2007 Nov 1; 37. | |
| van Nunen S, Said M, Batty G. | 2013 | Use of expanded search criteria in diagnosing mammalian meat allergy provoked by previous tick bites in individuals who do not live in areas where ticks are endemic: 2050. No abstract available |
Allergy: European Journal of Allergy and Clinical Immunology. 2013 Sep 1;68. | |
| van Nunen S. | 2014 | Galactose-Alpha-1,3-Galactose, Mammalian Meat and Anaphylaxis: A World-Wide Phenomenon? Mammalian meat allergy following tick bites is known to occur in Australia, North America, Europe, Asia, Africa and Central America. Over the last decade, the condition has become increasingly prevalent in tick-endemic areas of Australia and the USA. In mammalian meat-allergic individuals, gelatine allergy and/or cow’s milk allergy may co-exist. Awareness of tick-induced allergies in health professionals and the general community is key to both a timely diagnosis and the prevention of mammalian meat allergy. Treatment of mammalian meat allergy is limited currently to avoidance of all mammalian meat, whilst gelatine allergy similarly mandates avoidance of mammalian-derived gelatine, especially intravenously administered gelatine-containing solutions. Adults with anaphylaxis to mammalian meat should have a convalescent tryptase estimation and investigations for mastocytosis should then be undertaken if the tryptase is significantly elevated. Before initiating treatment with certain therapeutic agents (e.g. cetuximab, gelatine-containing substances, bovine artificial blood), a careful assessment of the risk of anaphylaxis, including serological analysis for galactose-alpha-1,3-galactose-specific immunoglobulin E, should be undertaken in any individual who works, lives, volunteers or participates in leisure activities in a tick-endemic area, particularly where a history is obtained of a tick bite prior, or of mammalian meat or gelatine allergy. Strategies aimed at the prevention of tick bites are paramount for primary prevention and amelioration of mammalian meat allergy. |
Current Treatment Options in Allergy. 2014 Sep 1;1(3):262-77. | Review article |
| van Nunen S. | 2015 | Tick-induced allergies: mammalian meat allergy, tick anaphylaxis and their significance. Serious tick-induced allergies comprise mammalian meat allergy following tick bites and tick anaphylaxis. Mammalian meat allergy is an emergent allergy, increasingly prevalent in tick-endemic areas of Australia and the United States, occurring worldwide where ticks are endemic. Sensitisation to galactose-alpha-1,3-galactose (alpha-Gal) has been shown to be the mechanism of allergic reaction in mammalian meat allergy following tick bite. Whilst other carbohydrate allergens have been identified, this allergen is unique amongst carbohydrate food allergens in provoking anaphylaxis. Treatment of mammalian meat anaphylaxis involves avoidance of mammalian meat and mammalian derived products in those who also react to gelatine and mammalian milks. Before initiating treatment with certain therapeutic agents (e.g., cetuximab, gelatine-containing substances), a careful assessment of the risk of anaphylaxis, including serological analysis for alpha-Gal specific-IgE, should be undertaken in any individual who works, lives, volunteers or recreates in a tick endemic area. Prevention of tick bites may ameliorate mammalian meat allergy. Tick anaphylaxis is rare in countries other than Australia. Tick anaphylaxis is secondarily preventable by prevention and appropriate management of tick bites. Analysis of tick removal techniques in tick anaphylaxis sufferers offers insights into primary prevention of both tick and mammalian meat anaphylaxis. Recognition of the association between mammalian meat allergy and tick bites has established a novel cause and effect relationship between an environmental exposure and subsequent development of a food allergy, directing us towards examining environmental exposures as provoking factors pivotal to the development of other food allergies and refocusing our attention upon causation of allergy in general. |
Asia Pacific Allergy. 2015 Jan 1;5(1):3-16. | |
| van Nunen S. | 2024 | Quantifying the allergenic potency of mammalian meat sources, an important step in providing a framework for improved management of mammalian meat allergy after tick bite (alpha-gal syndrome/AGS). |
Allergy. | Quantification; potency; threshold |
| Van Nunen SA, O’Connor KS, Clarke LR, Boyle RX, Fernando SL. | 2009 | An association between tick bite reactions and red meat allergy in humans. Twenty-five patients living in a tick-endemic region of Sydney, New South Wales developed red meat allergy after experiencing large local reactions to tick bites. This represents a potentially novel cross-reaction between an arthropod and a food protein. |
The Medical journal of Australia. 2009 May 4;190(9):510-1. | |
| van Nunen SA. | 2018 | Tick-induced allergies: mammalian meat allergy and tick anaphylaxis. •Mammalian meat allergy after tick bites and tick anaphylaxis are the most serious tick‐induced allergies. They are often severe, should be largely avoidable and offer fascinating insights into the development and prevention of allergies. •Australian clinicians reported the first cases of tick anaphylaxis and discovered the association between tick bites and the development of mammalian meat allergy. The subsequent finding of the allergen epitope within the meat responsible for the allergic reaction, α‐gal (galactose‐α‐1,3‐galactose), stimulated further interest in this emergent allergy. •Reports of mammalian meat allergy associated with bites from several tick species have now come from every continent where humans are bitten by ticks. The number of diagnosed patients has continued to rise. •Clinically, mammalian meat allergy and tick anaphylaxis present quite differently. The prominent role of cofactors in triggering episodes of mammalian meat allergy can make its diagnosis difficult. •Management of mammalian meat allergy is complicated by the manifold potential therapeutic implications due to the widespread distribution of the mammalian meat allergen, α‐gal. Exposures to α‐gal‐containing medications have proved lethal in a minority of people, and fatal tick anaphylaxis has been reported in Australia. Prevention of tick bites is prudent and practicable; killing the tick in situ is crucial to both primary and secondary prevention of allergic reactions. •Mechanisms in the development of mammalian meat allergy constitute a paradigm for how allergies might arise. |
Medical Journal of Australia. 2018 Apr;208(7):316-21. | |
| VAN SD, Jeanneteau A, Baufreton C. | 2021 | Aortic homograft for aortic valve replacement in patient with Alpha-Gal allergy. Allergy to Galactose-Alpha-1,3-Galactose is an allergy to mammalian proteins, that are present on the surface of standard bioprosthestic valves, and could result in catastrophic allergic reaction or may cause early deterioration of the bioprostheses. Aortic homograft is an acceptable alternative to standard prosthetic valves (biological and mechanical) to avoid a potential allergic manifestation and the need of definitive oral anticoagulation. We report the implantation of an aortic homograft in a patient with an aortic stenosis who present a documented Alpha-Gal allergy |
Authorea. 2021 Feb. | cardiac; cardiothoracic; surgery; xenotranplantation; bioprosthetic heart valve; perioperative; medical products |
| Van Tine BA, Govindarajan R, Attia S, Somaiah N, Barker SS, Shahir A, Barrett E, Lee P, Wacheck V, Ramage SC, Tap WD. | 2019 | ‡ Incidence and management of olaratumab infusion-related reactions. PURPOSE: Olaratumab is a human monoclonal immunoglobulin G1 antibody against platelet-derived growth factor receptor-α. We report the nature and frequency of infusion-related reactions (IRRs) with olaratumab in clinical trials and postmarketing reports. METHODS: Data from patients exposed to olaratumab across nine clinical trials were reviewed for IRRs. Blood samples were also analyzed for pre-existing immunoglobulin E anti–galactose-α-1,3-galactose (anti–α-Gal) antibodies. RESULTS: In the clinical trials, IRRs were identified in 70 of 485 patients (14.4%). The most frequent symptoms included flushing, fever or chills, and dyspnea. For 68 of 70 patients (97.1%), the first IRR occurred during the first two cycles of treatment. Grade 3 or worse IRRs were reported in 11 patients (2.3%), all during the first infusion and usually within 15 minutes of the start of the infusion. One IRR-related fatality (0.2%) occurred in a nonpremedicated patient with grade 3 or worse cardiac comorbidities. There was an association between grade 3 or worse IRRs and pre-existing anti–α-Gal antibodies, with a trend toward higher IRR rates in US geographies known to have a higher prevalence of anti–α-Gal antibodies. IRRs in postmarketing reports were consistent in nature and severity with those in the clinical trials. CONCLUSION: Premedication with corticosteroids and antihistamines should occur in all patients before olaratumab infusion, as indicated in labels in the United States and the European Union. Patients receiving olaratumab should be monitored for IRRs in a setting where resuscitation equipment is available for the treatment of IRRs. |
Journal of oncology practice. 2019 Nov;15(11):e925-33. | pharmacy; pharmaceutical; medication; biologic; biological agent; monoclonal antibody; olaratumab; |
| Vanegas E, Felix M, Bajaña MJ, Robles-Velasco K, Lascano MP, Shijin CC, Logroño RH, Greiding L, Cherrez-Ojeda I. | 2022 | An approach to a patient with suspected meat allergy due to underlying alpha-Gal syndrome in a resource-limited setting. The alpha-Gal syndrome is a type of food allergy in which antibodies against the galactose α-1, 3-galactose are generated.1 Patients with alpha-Gal syndrome typically present with symptoms related to allergic reactions, such as pruritus, urticaria, angioedema, and even anaphylaxis 3 to 6 hours after eating meat.1 Diagnosis is often a combination of a compatible clinical presentation with additional testing that can include skin prick test, prick-by-prick testing, and serum immunoglobulin E (IgE) antibodies against galactose-α-1, 3-galactose.1 Management often includes dietary restriction of meat and meat-derived products and appropriate treatment, when exacerbations occur. The goal of this report is to present an interesting case of alpha-Gal syndrome and describe some of the challenges associated with the management of this condition in a developing country. |
JAAD Case Reports. 2022 Mar 1;21:173-5. | Latin America; Ecuador; diagnosis; diagnostic challenges; developing countries |
| Vaz-Rodrigues R, Feo Brito F, Guzmán Rodríguez R, Mazuecos L, de la Fuente J. | 2023 | Allergic reactions associated with medically relevant arthropods. |
Annals of Medicine. 2023 Dec 12;55(2):2286531. | vector; arthropods; fly; Diptera; Asilidae |
| Vaz-Rodrigues R, Mazuecos L, Contreras M, González-García A, Rafael M, Villar M, de la Fuente J. | 2025 | Tick salivary proteins metalloprotease and allergen-like p23 are associated with response to glycan α-Gal and mycobacterium infection. |
Scientific Reports. 2025 Mar 14;15(1):8849. | tick salivary proteins; pathogenesis |
| Vaz-Rodrigues R, Mazuecos L, de la Fuente J. | 2022 | Current and Future Strategies for the Diagnosis and Treatment of the Alpha-Gal Syndrome (AGS). The α-Gal syndrome (AGS) is a pathognomonic immunoglobulin E (IgE)-mediated delayed anaphylaxis in foods containing the oligosaccharide galactose-α-1,3-galactose (α-Gal) such as mammalian meat or dairy products. Clinical presentation of AGS can also comprise immediate hypersensitivity due to anticancer therapy, gelatin-containing vaccines or mammalian serum-based antivenom. The IgE initial sensitization is caused by hard-bodied tick bites and symptomatic individuals typically develop delayed pruritus, urticaria, angioedema, anaphylaxis, malaise or gut-related symptoms. Due to inapparent presentation, delayed reactions and a wide variety of patients´ clinical history, the AGS diagnosis and treatment remain challenging. This review covers not only current diagnostic methods used for AGS such as the skin prick test (SPT), the oral food challenge (OFC), anti-α-Gal IgE levels measurement and the basophil activation test (BAT), but also potentially relevant next-generation diagnostic tools like the mast cell activation test (MAT), the histamine-release (HR) assay, omics technologies and model-based reasoning (MBR). Moreover, it focuses on the therapeutical medical and non-medical methods available and current research methods that are being applied in order to elucidate the molecular, physiological and immune mechanisms underlying this allergic disorder. Lastly, future treatment and preventive tools are also discussed, being of utmost importance for the identification of tick salivary molecules, with or without α-Gal modifications, that trigger IgE sensitivity as they could be the key for further vaccine development. Bearing in mind climate change, the tick-host paradigm will shift towards an increasing number of AGS cases in new regions worldwide, which will pose new challenges for clinicians in the future. |
Journal of Asthma and Allergy. 2022;15:957. | diagnosis; management |
| Vaz-Rodrigues R, Mazuecos L, Villar M, Contreras M, Artigas-Jerónimo S, González-García A, Gortázar C, de la Fuente J. | 2023 | Multi-omics analysis of zebrafish response to tick saliva reveals biological processes associated with alpha-Gal syndrome. |
Biomedicine & Pharmacotherapy. 2023 Dec 1;168:115829. | |
| Vaz-Rodrigues R, Mazuecos L, Villar M, Contreras M, González-García A, Bonini P, Scimeca RC, Mulenga A, de la Fuente J. | 2024 | Tick salivary proteome and lipidome with low glycan content correlate with allergic type reactions in the zebrafish model. |
International Journal for Parasitology. 2024 Jul 27. | Spain; Europe; tick salivary proteins; tick salivary lipids |
| Venkat P, Nehrbas J, Figueroa E, Behm B, Wilson J. | 2024 | S39 First-Dose Infusion Reaction to Ustekinumab is Associated With the Presence of Serum IgE Against Galactose-α-1, 3-Galactose (α-gal). |
Official journal of the American College of Gastroenterology| ACG. 2024 Dec 1;119(12S):S11. | medical products; biologic; monoclonal antibody; Ustekinumab; Crohn's; gastroenterology; IBD; GI |
| Venturini Díaz M, Vidal Oribe I, D’Elia Torrence D, Hernández Alfonso P, Alarcón Gallardo E. | 2022 | New Challenges in Drug Allergy: the Resurgence of Excipients. The purpose of this article is to review the excipients that may produce inmediate hypersensitivity drugs and vaccine reactions and update diagnostic procedures to reach an accurate diagnosis. We highlight the in vivo and in vitro diagnostic tests used in published reports and detail the dilution used for each excipient to perform ST in order to confirm this vital pathology and to prevent new reactions. |
Current Treatment Options in Allergy. 2022 Jul 24:1-9. | medical products; drugs; surgery; perioperative; carrageenan; gelatin; enema; barium |
| Venturini M, Lobera T, Sebastián A, Portillo A, Oteo JA. | 2018 | IgE to alpha-Gal in Foresters and Forest Workers From La Rioja, North of Spain. Objective: To investigate the prevalence of and factors associated with the presence of α-gal–specific IgE in a risk group of foresters and forest workers from La Rioja, Spain and in a control group. Methods: The study population comprised 169 workers and 100 individuals who did not recall having had tick bites. A questionnaire including demographic data and number of tick bites per year was completed by a physician. α-Gal sIgE was assessed using ImmunoCAP with serum samples that had been taken in 2010. In 2015, second serum specimens were taken from all but 1 of the workers, who had positive specific IgE to α-gal in 2010. These new samples were tested for IgE to the α-gal epitope and to mammalian meat. Results: The prevalence of positive sIgE to α-gal was 15% in the risk population and 4% in the control population. α-Gal sIgE positivity was associated with the number of tick bites per year and with seniority. Thirteen out of 21 patients sensitized to α-gal in 2010 showed positive specific IgE to α-gal in serum samples from 2015. Eleven had specific IgE to mammalian meat, but none reported symptoms of meat allergy. Conclusion: The prevalence of α-gal sIgE antibodies in this risk population was higher than in the control group and was associated with the number of tick bites per year and with seniority. None of the workers sensitized to mammalian meat developed meat allergy, possibly owing to the low levels of sIgE to α-gal. |
Journal of investigational allergology & clinical immunology. 2018;28(2):106. | Europe; Spain; occupational medicine; forestry; foreser; prevalence |
| Veraar C, Koschutnik M, Nitsche C, Laggner M, Polak D, Bohle B, Mangold A, Moser B, Mascherbauer J, Ankersmit HJ. | 2021 | Inflammatory immune response in recipients of transcatheter aortic valves. Objective: Transcatheter aortic valve implantation (TAVI) is rapidly replacing cardiac surgery due to its minimal invasiveness and practicality. Midterm immunological studies on the biocompatibility of galactose-alpha-1,3-galactose (α-Gal)–carrying bioprosthetic heart valves for TAVI are not available. In this study we investigated whether bioprosthetic heart valves employed for TAVI augment an α-Gal–specific antibody-dependent and antibody-independent immune response 3 months after TAVI implantation. MethodsThis prosp: ctive observational study included 27 patients with severe aortic valve stenosis undergoing TAVI and 10 patients with severe mitral valve regurgitation treated with a transcatheter MitraClip (Abbott Laboratories, Abbott Park, Ill) procedure. Blood samples were drawn before and 90 days after treatment at a routine checkup. Serum samples were analyzed using enzyme-linked immunosorbent assay. Serum concentrations of α-Gal–specific immunoglobulin (Ig) G, IgG subclasses and IgE, complement factor 3a, NETosis-specific citrullinated H3, and the systemic inflammation markers soluble suppression of tumorigenicity and interleukin 33 were evaluated. Results: Three months after TAVI, we found significantly increased serum concentrations of α-Gal–specific IgG3, complement factor complement factor 3a, citrullinated H3 levels, and soluble suppression of tumorigenicity (P = .002, P = .001, P = .025, and P = .039, respectively). Sensitization of α-Gal–specific IgE antibodies occurred in 55% of all patients after TAVI. Conclusions: Our results indicate that TAVI elicits a midterm, specific humoral immune response against α-Gal and causes an unspecific humoral inflammation compared with patients undergoing MitraClip implantation. This observation will lead to a better understanding of postintervention morbidity and the long-term durability of bioprostheses and indicates that caution is appropriate when designing implantation strategies for younger patients. |
JTCVS Open. 2021 Mar 12. | Xenotransplantation; cardiac surgery; cardiology; medical products; bovine; porcine; bioprosthetic heart valves |
| Vernon S, Kott K, Hansen T, van Nunen S, Figtree G. | 2020 | 446 Association of Mammalian Oligosaccharide Galactose-α-1, 3-galactose (α-Gal) With Atherosclerotic Coronary Artery Disease. | Heart, Lung and Circulation. 2020 Jan 1;29:S237-8. | cardiac; cardiothoracic; coronary artery disease; CAD; atherosclerosis; arteriosclerosis; |
| Vernon ST, Kott KA, Hansen T, Finemore M, Baumgart KW, Bhindi R, Yang J, Hansen PS, Nicholls SJ, Celermajer DS, Ward MR. | 2022 | Immunoglobulin E Sensitization to Mammalian Oligosaccharide Galactose-α-1, 3 (α-Gal) Is Associated With Noncalcified Plaque, Obstructive Coronary Artery Disease, and ST-Segment–Elevated Myocardial Infarction. Background: Treating known risk factors for coronary artery disease (CAD) has substantially reduced CAD morbidity and mortality. However, a significant burden of CAD remains unexplained. Immunoglobulin E sensitization to mammalian oligosaccharide galactose-α-1,3-galactose (α-Gal) was recently associated with CAD in a small observational study. We sought to confirm that α-Gal sensitization is associated with CAD burden, in particular noncalcified plaque. Additionally, we sort to assess whether that α-Gal sensitization is associated with ST-segment–elevated myocardial infarction (STEMI) Methods: We performed a cross-sectional analysis of participants enrolled in the BioHEART cohort study. We measured α-Gal specific-immunoglobulin E antibodies in serum of 1056 patients referred for CT coronary angiography for suspected CAD and 100 selected patients presenting with STEMI, enriched for patients without standard modifiable risk factors. CT coronary angiograms were assessed using coronary artery calcium scores and segmental plaque scores. Results: α-Gal sensitization was associated with presence of noncalcified plaque (odds ratio, 1.62 [95% CI, 1.04–2.53], P=0.03) and obstructive CAD (odds ratio, 2.05 [95% CI, 1.29-3.25], P=0.002), independent of age, sex, and traditional risk factors. The α-Gal sensitization rate was 12.8-fold higher in patients with STEMI compared with matched healthy controls and 2.2-fold higher in the patients with STEMI compared with matched stable CAD patients (17% versus 1.3%, P=0.01 and 20% versus 9%, P=0.03, respectively). Conclusions: α-Gal sensitization is independently associated with noncalcified plaque burden and obstructive CAD and occurs at higher frequency in patients with STEMI than those with stable or no CAD. These findings may have implications for individuals exposed to ticks, as well as public health policy. |
Arteriosclerosis, Thrombosis, and Vascular Biology. 2022 Mar;42(3):352-61. | cardiac; cardiology; coronary artery disease; CAD; atherosclerosis; CVD; cardiovascular disease; sensitization |
| Versluis A, van Os‐Medendorp H, Kruizinga AG, Blom WM, Houben GF, Knulst AC. | 2016 | Cofactors in allergic reactions to food: physical exercise and alcohol are the most important. Introduction: Involvement of cofactors, like physical exercise, alcohol consumption and use of several types of medication, are associated with more severe food allergic symptoms. However, there is limited evidence on how often cofactors play a role in food allergic reactions. The study aimed to get more insight into the frequency of exposure to cofactors and how often cofactors are associated with more severe symptoms in food allergic patients. Methods: A questionnaire was completed by patients visiting the Allergology outpatient clinic. Patients with food allergy were included. Outcome measures were the frequency of medication use of medication groups that might act as cofactor and the frequency that physical exercise, alcohol consumption and use of analgesics are associated with more severe food allergic symptoms. Results: Four hundred ninety‐six patients were included in the study. The frequency with which patients used one or more types of medication that might act as cofactors was 7.7%: antacids/acid neutralizing medication (5%), NSAIDs (2%), beta blockers (0.6%), angiotensin‐converting enzyme inhibitors (0.6%), and angiotensin receptor blockers (0.2%). Of all patients, 13% reported more severe symptoms to food after involvement of one or more of the cofactors: physical exercise (10%), alcohol consumption (5%), and use of analgesics (0.6%). Sixty‐five percent did not know if these cofactors caused more severe symptoms; 22% reported that these cofactors had no effect. Conclusions: Only a small percentage of patients (7.7%) used medication that might aggravate food allergic reactions. Physical exercise and alcohol consumption were the most frequently reported cofactors, but occurring still in only 10% or less. |
Immunity, inflammation and disease. 2016 Dec;4(4):392-400. | Cofactor |
| Veyrac G, Pipet A, Joyau C, Ruellan AL, Jolliet P. | 2017 | Allergie à la viande rouge et choc anaphylactique à la gélatine injectable: quel rapport entre un anticancéreux, des tiques et un steak? IntroductionL’« alpha-Gal » (AG) ou galactose-alpha-1,3-galactose, allergène connu des allergologues est un motif de glycosylation présent chez quasi tous les mammifères mais pas chez l’Homme. Il est impliqué dans les chocs anaphylactiques au cetuximab et des anaphylaxies à la viande de mammifères. Nous rapportons un cas qui illustre l’allergie croisée viande/gélatine injectable.MéthodesUn homme de 80 ans consulte en allergologie pour bilan de 2 chocs anaphylactiques au cours d’un pontage coronarien : 2 h après l’induction, cardioplégie 4 min après une 1re perfusion de Gélofusine®, puis nouvelle chute tensionnelle lors d’une 2nd perfusion en fin d’intervention avec une urticaire généralisée. Le patient présente une allergie alimentaire aux viandes rouges depuis 2006 survenant des heures après le repas, notée sur sa fiche d’anesthésie. Cet ancien chasseur a consommé beaucoup de viandes et d’abats.RésultatsLes tests étaient positifs en IDR au 1/10e pour la Gélofusine® et négatifs pour les médicaments anesthésiants. La tryptase dosée à une heure était à 42,7 μg/mL puis redescendue à 4,58 μg/mL 16 h après (VN ≤ 13,5 μg/L).DiscussionLes morsures de tiques joueraient un rôle dans l’induction d’anticorps IgE anti-AG. Les patients sensibilisés pourraient développer une hypersensibilité à la viande rouge. Notre chasseur a pu se faire piquer par des tiques et engendrer ainsi l’allergie à la viande et aux abats. Mullins et al. [1] retrouvent que la plupart des patients allergiques à la viande rouge sont sensibilisés à la gélatine et certains d’entre eux sont allergiques cliniquement aux deux. Il a démontré la présence d’antigène AG dans la gélatine injectable suggérant ainsi que l’AG soit un allergène majeur dans les réactions anaphylactiques aux gélatines injectables. Les patients avec un syndrome AG ne doivent pas recevoir de médicaments contenant de l’AG comme le cétuximab ni de gélatine injectable. |
Revue Française d'Allergologie. 2017 Apr 1;57(3):252. | pharmacy; pharmaceutical; gelatin; gelatine; Gelofusine; perioperative care |
| Vidal C, Mendez-Brea P, Lopez-Freire S, Gonzalez-Vidal T. | 2016 | Vaginal Capsules: An Unsuspected Probable Source of Exposure to alpha-Gal. ...The patient was a 65-year-old woman who had previously experienced 6 episodes of anaphylaxis after eating beef and pork during the previous 2 years. The workup performed at the time revealed positive skin prick test (SPT) results with a panel of commercially available food allergens including beef and pork (Bial-Arístegui) and cetuximab 5 mg/mL (Erbitux; Merck SL). sIgE to beef, pork, lamb, rabbit, chicken, cat dander, rFel d 1, and α-gal from bovine thyroglobulin (ImmunoCAP-250 analyzer, Thermo Fisher Scientific) yielded positive results with beef, pork, lamb, rabbit, cat dander, and α-gal from bovine thyroglobulin (12.4 kUA/L, 5.01 kUA/L, 6.3 kUA/L, 2.5 kUA/L, 0.54 kUA/L, and 52.3 kUA/L, respectively). The patient experienced no clinical problems by strictly following an avoidance diet excluding mammal meat until she was diagnosed with vaginitis. She was prescribed a fenticonazole vaginal capsule (Lomexin 600, Casen Recordati). Fifteen minutes after the application of the vaginal capsule, she experienced generalized erythema and intense pruritus quickly followed by hives, palpebral and labial angioedema, chest tightness, and dyspnea. patient was taken to the emergency department, where she received albuterol, methylprednisolone, and antihistamines, with total recovery in less than 4 hours. We completed the allergy workup 1 month later by performing SPTs with the vaginal capsule involved in the reaction. First, we cut the capsule open to access the active drug (fenticonazole) and performed SPTs with fenticonazole and the inner and the outer surfaces of the capsule cover, although the results were negative. After removing the active drug from the capsule, we heated the cover at 37ºC in a water bath until it dissolved. An SPT was performed with the solution. As can be seen in the Figure, a positive wheal and flare response was obtained. In order to rule out an irritative response, 11 control patients (6 atopic and 5 nonatopic) were tested with the same solution, although no reaction was observed. Finally, the summary of product characteristics made reference to the porcine origin of the collagen used in the gelatin cover of the capsule, thus suggesting the role of α-gal in the reaction |
Journal of investigational allergology & clinical immunology. 2016;26(6):388. | Pharmacy; pharmaceutical; medication; gynecology; gelatin; gelatine; vaginal capsule |
| Vieira J, Pestana L, Câmara R. | 2023 | Allergy to galactose-α-1, 3-galactose (α-gal)–A case report. |
Revista Portuguesa de Imunoalergologia 2023. | Europe; Portugal; lipothymia; syncope |
| Vieira-Baptista P, Lima-Silva J, Cavaco-Gomes J, Beires J, Martinez-de-Oliveira J. | 2015 | What differentiates symptomatic from asymptomatic women with lichen sclerosus?. Aims: To investigate the differences between symptomatic and asymptomatic women with vulvar lichen sclerosus (LS). Methods: Data on file concerning 228 LS patients was retrospectively reviewed. Results: Most patients were symptomatic (193/228; 85%). Worsening of symptoms related to specific food intake was experienced by 26% (48/182) and pork was the most frequently cited (25/48; 52%); worsening at night was reported by 47% (87/185). Being over 50 years at the time of diagnosis or being menopausal were associated with being symptomatic (RR = 2.47, 95% CI: 1.15-5.29 and 6.55, 2.05-20.91, respectively). The same was true for urinary incontinence (UI) (5.23, 1.78-15.42), the use of absorbents (without UI) (3.59, 1.05-12.34) and dyspareunia (5.28, 1.64-17.0). All patients with a family history of LS were symptomatic. There was no association with hormonal factors or specific vulvar anatomical changes. Conclusions: Pork consumption may be involved in the worsening of symptoms. UI and the use of absorbents are more commonly present in symptomatic LS patients. Dietary changes and correction of UI might be useful in the control of LS symptoms. |
Gynecologic and Obstetric Investigation. 2015;79(4):263-8. | gynecology; dermatology; lichen sclerosis |
| Villalta D, Cecchi L, Farsi A, Chiarini F, Minale P, Voltolini S, Scala E, Quercia O, Muratore L, Pravettoni V, Calamari AM. | 2017 | Galactose-alpha-1,3-galactose syndrome: an Italian survey. Background. The term of α-Gal syndrome, which includes the delayed allergy to red meat and the allergic reactions following the administration of cetuximab, is associated to the presence of specific IgE to α-Gal. In Italy, only anecdotal cases were reported so far. The Association of Italian Allergists (AAITO) carried out a survey with the aim of evaluating presence, characteristics, clinical features, and distribution of the syndrome in Italy. Methods. A web structured questionnaire was made available on the website of AAIITO from July 2016 to January 2017. It included 31 multiple-choice questions concerning different items, including the site of physicians, the number of patients diagnosed as having cetuximab allergy and/or delayed red meat allergy, recall of tick bites, symptoms, time to reactions, elicitor foods, reactions with foods other than meat, and in-vivo and in-vitro tests used for the diagnosis. Results. Seventy-nine physicians completed the questionnaire. Nine cases of allergy to cetuximab and 40 cases of delayed red meat allergy were recorded across Italy. 22.5% of patients with cetuximab allergy and 62.5% of those with delayed red meat allergy recalled a tick bite. 75% of patients with delayed red meat allergy experienced symptoms after eating beef (butcher’s cut in 72.5%). Urticaria was the most frequent clinical manifestation (65% of cases). In 60.6% of cases symptoms appeared 2 - 4 hours after meat ingestion, while in 7.9% symptoms appeared after > 4 hours. The most used diagnostic methods were the intradermal test for cetuximab allergy (88.9%) and the detection of IgE to α-Gal (55.5%) for red meat allergy. Most case reports came from Northern Italy. Conclusion. α-Gal syndrome is present in Italy and beef is the most frequent offending food. In most cases symptoms were not severe. |
European annals of allergy and clinical immunology. 2017 Nov;49(6):263. | Europe; Italy; prevalence |
| Villalta D, Pantarotto L, Da Re M, Conte M, Sjolander S, Borres MP, Martelli P. | 2016 | High prevalence of sIgE to Galactose-α-1,3-galactose in rural pre-Alps area: a cross-sectional study. Reasearch letter. No abstract available. |
Clinical & Experimental Allergy. 2016 Feb;46(2):377-80. | Europe; Italy; prevalence |
| Villar M, Pacheco I, Mateos-Hernández L, Cabezas-Cruz A, Tabor AE, Rodríguez-Valle M, Mulenga A, Kocan KM, Blouin EF, de la Fuente J. | 2021 | Characterization of tick salivary gland and saliva alphagalactome reveals candidate alpha-gal syndrome disease biomarkers. BACKGROUND: Ticks are obligate hematophagous arthropods that synthesize the glycan Galα1-3Galβ1-(3)4GlcNAc-R (α-Gal) associated with the alpha-gal syndrome (AGS) or allergy to mammalian meat consumption. RESEARCH DESIGN AND METHODS: In this study, we used a proteomics approach to characterize tick proteins in salivary glands (sialome SG), secreted saliva (sialome SA) and with α-Gal modification (alphagalactome SG and SA) in model tick species associated with the AGS in the United States (Amblyomma americanum) and Australia (Ixodes holocyclus). Selected proteins reactive to sera (IgE) from patients with AGS were identified to advance in the identification of possible proteins associated with the AGS. For comparative analysis, the α-Gal content was measured in various tick species. RESULTS: The results confirmed that ticks produce proteins with α-Gal modifications and secreted into saliva during feeding. Proteins identified in tick alphagalactome SA by sera from patients with severe AGS symptomatology may constitute candidate disease biomarkers. CONCLUSIONS: The results support the presence tick-derived proteins with α-Gal modifications in the saliva with potential implications in AGS and other disorders and protective capacity against tick infestations and pathogen infection. Future research should focus on the characterization of the function of tick glycoproteins with α-Gal in tick biology and AGS. |
Expert Review of Proteomics. 2021 Dec 2(just-accepted). | |
| Villar M, Pacheco I, Merino O, Contreras M, Mateos-Hernández L, Prado E, Barros-Picanço DK, Lima-Barbero JF, Artigas-Jerónimo S, Alberdi P, Mera IG. | 2020 | Tick and Host Derived Compounds Detected in the Cement Complex Substance. Ticks are obligate hematophagous arthropods and vectors of pathogens affecting human and animal health worldwide. Cement is a complex protein polymerization substance secreted by ticks with antimicrobial properties and a possible role in host attachment, sealing the feeding lesion, facilitating feeding and pathogen transmission, and protection from host immune and inflammatory responses. The biochemical properties of tick cement during feeding have not been fully characterized. In this study, we characterized the proteome of Rhipicephalus microplus salivary glands (sialome) and cement (cementome) together with their physicochemical properties at different adult female parasitic stages. The results showed the combination of tick and host derived proteins and other biomolecules such as α-Gal in cement composition, which varied during the feeding process. We propose that these compounds may synergize in cement formation, solidification and maintenance to facilitate attachment, feeding, interference with host immune response and detachment. These results advanced our knowledge of the complex tick cement composition and suggested that tick and host derived compounds modulate cement properties throughout tick feeding. |
Biomolecules. 2020 Apr;10(4):555. | |
| Virant FS. | 2013 | Galactose-α-1, 3-galctose and Delayed Anaphylaxis, Angioedema, and Urticaria in Children. PURPOSE OF THE STUDY.To determine whether immunoglobulin E (IgE) antibody to galactose-α-1,3-galactose (α-Gal) is present in the sera of pediatric patients who report idiopathic anaphylaxis or urticaria 3 to 6 hours after eating beef, pork, or lamb. STUDY POPULATION.Children aged 4 to 17 years with a history suggestive of delayed anaphylaxis, urticaria, or angioedema (N = 51) were enrolled in an institutional review board–approved protocol at the University of Virginia and private practice offices in Lynchburg, Virginia. METHODS.Sera were obtained and analyzed by using ImmunoCAP (Phadia, Inc, Uppsala, Sweden) for total IgE and specific IgE to α-Gal, beef, pork, cat epithelium and dander, Fel d 1, dog dander, and milk. RESULTS.A total of 45 children were identified who had both clinical histories supporting delayed anaphylaxis or urticaria to mammalian meat and IgE antibodies specific for α-Gal. Most of these children also had a history within the last year of tick bites that itched and persisted. CONCLUSIONS.A new form of anaphylaxis and urticaria that occurs 3 to 6 hours after eating mammalian meat is not uncommon among children in the Virginia area. The diagnosis should be suspected in children with a suggestive history living in the area in which the Lone Star tick is common, and the diagnosis should be confirmed by specific serologic testing. |
Pediatrics. 2013 May 1;131(5):e1545-52. | pediatric' children |
| Vitte J, Sabato V, Tacquard C, Garvey LH, Michel M, Mertes PM, Ebo DG, Schwartz LB, Castells MC. | 2021 | Use and Interpretation of Acute and Baseline Tryptase in Perioperative Hypersensitivity and Anaphylaxis. Paired acute and baseline serum or plasma tryptase sampling and determination have recently been included as a mechanistic approach in the diagnostic and management guidelines of perioperative immediate hypersensitivity and anaphylaxis. The timing of this paired sampling is clearly defined in international consensus statements, with the optimal window for acute tryptase sampling between 30 minutes and 2 hours after the initiation of symptoms, whereas baseline tryptase should be measured in a sample collected before the event (preop) or at least 24 hours after all signs and symptoms have resolved. A transient elevation of the acute tryptase level greater than [2 + (1.2 × baseline tryptase level)] supports the involvement and activation of mast cells. Here, we provide the clinical, pathophysiological, and technical rationale for the procedure and interpretation of paired acute and baseline tryptase. Clinical examples, up-to-date knowledge of hereditary α-tryptasemia as a frequent cause of baseline tryptase of 7 μg/L and higher, mastocytosis, other clonal myeloid disorders, cardiovascular or renal failure, and technical improvements resulting in continued lowering of the 95th percentile value are discussed. Clues for improved management of perioperative immediate hypersensitivity and anaphylaxis include (1) sustained dissemination and implementation of updated guidelines; (2) preoperative sample storage for deferred analysis; (3) referral for thorough allergy investigation, screening for mast cell–related disorders, and recommendations for future anesthetic procedures; and (4) sustained collaboration between anesthesiologists, immunologists, and allergists. |
The Journal of Allergy and Clinical Immunology: In Practice. 2021 Mar 18. | perioperative; anesthesia; tryptase |
| Voltolini S, Spigno F, Cioè A, Cagnati P, Bignardi D, Minale P. | 2013 | Bovine serum albumin: a double allergy risk. We analyse two cases of Bovine Serum Albumin (BSA) allergy. The first regards a female laboratory technician with a history of bronchial asthma due to cat allergy, who developed an exacerbation of bronchial symptoms as a consequence of BSA powder inhalation at work. To date, sensitization to BSA as a cause of occupational asthma has rarely been reported in the scientific literature. The second case concerns a woman with a similar cat sensitivity, who presented an oral allergy syndrome-type clinical reaction, gastric pain and diarrhoea immediately after eating cooked pork meat. Subsequently, she developed the same reaction after eating goat meat and goat cheese, and then also after eating beef. Both patients resulted specifically sensitized to BSA and to other mammalian serum albumins which play a role as panallergens in animals. The two cases show that BSA, a well known cause of food allergy in childhood, may also provoke symptoms of food allergy in adulthood, though in case of powder inhalation, it may provoke respiratory symptoms. Prior animal sensitization appears to represent a risk factor. |
Allergy. 1999 Jan 1;54(1):27-45. | occupational medicine; BSA |
| Vongsavath T, Tun KM, Haque L, Manne V. | 2024 | S314 The Diagnosis and Treatment of Alpha-Gal Syndrome: A Review. |
Official journal of the American College of Gastroenterology| ACG. 2024 Oct 1;119(10S):S224. | GI variant; gastroenterology |
| Wadsworth M, Risinger B, Elliott M. | 2024 | ALPHA-GAL SYNDROME DIAGNOSED BY RAPID REACTION TO INTRAVENOUS HEPARIN. |
Annals of Allergy, Asthma & Immunology. 2024 Nov 1;133(6):S115. | Heparin |
| Wagner KD, Bell MC, Pesek RD, Kennedy JL. | 2015 | Fifty-six-year-old man with anaphylaxis: A novel delayed food hypersensitivity reaction. Anaphylaxis and urticaria are commonly seen in both primary care and allergy clinics. Foods, drugs, and insects are frequent culprits for immediate reactions; however, the trigger for recurring and/or chronic episodes is often unclear. We present a 56-year-old male with recurrent symptoms of urticaria, angioedema, and anaphylaxis found to be triggered by sensitization to galactose-alpha 1, 3-galactose (alpha-gal), a novel food allergen. |
The Journal of the Arkansas Medical Society. 2015 Nov;112(7):110-2. | Arkansas |
| Wagner N, Jappe U, Podda M, Hartmann K. | 2012 | Anaphylaxis to red meat: galactose-alpha-1,3-galactose (alpha-Gal) - an interesting allergen. No abstract available |
Allergologie. 2012 Nov 1;35(11):559-62. | |
| Wai M, Filip AB, Abbott A, Martin A, Donnell R, Sutton J. | 2024 | Anaphylaxis in Alpha-Gal patients treated with F (ab’) 2 for snake bite venom. |
Toxicology Communications. 2024 Dec 31;8(1):2392459. | medical product; antivenom; F (ab’) 2 for snake bite venom |
| Wallace TK. | 2023 | ABUNDANCE AND DISTRIBUTION OF MEDICALLY IMPORTANT HARD TICKS AND ASSOCIATED IXODES-BORNE PATHOGENS IN RHODE ISLAND. |
University of Rhode Island, DigitalCommons@URI, Open Access Master's Theses | Rhode Island; Amblyomma americanum; lone star tick |
| Waltz H, Kaminski L, Dye-Braumuller K, Haldeman M, Pickle EO, Nolan MS. | 2025 | α-Galactose Syndrome Cases within the Prisma Health System, South Carolina. |
Southern medical journal. 2025 Mar;118(3):161-6. | South Carolina; prevalence |
| Wan Majdiah WM, Nurul Khaiza Y, Suzina SA, Che Maraina CH, Noor Suryani MA. | 2016 | Food Allergen Sensitization among Malaysian Rhinitis Patients. Background: Allergic rhinitis (AR) is a very common disease in children as well as adults and impairs the quality of life ifleft untreated. It affects 10 to 25% of the world population and is characterized by nasal itching, sneezing, watery rhinorrhoeaand nasal obstruction. Few studies have focused on the association between local food and AR. Objectives: This study aims to determine the prevalence of food allergen sensitization among AR patients. Materials and Methods: This cross sectional study comprised of 128 AR patients aged 20-60 years old attending theOtorhinolaryngology - Head & Neck Surgery (ORL-HNS) Clinic, Hospital Universiti Sains Malaysia (HUSM), Kelantan.Specific immunoglobulin E (IgE) levels were used to evaluate 13 common foods in Malaysian diet. An interviewer guided questionnaire was administered to gather patients' clinical information. Results: Among the food allergen tested, shrimp was found to be the most common food (28.9%) implicated with AR, followed by soybean (26.6%), crab (23.4%), clam (22.7%), wheat (21.9%), peanut (20.3%), yolk egg (18.8%), cow milk (18.0%),citrus mix (18.0%), beef (14.1%), white egg (12.5%), tuna (11.7%) and chicken (11.7%). Conclusion: This study confirms the role of IgE in food allergy. Measurement of allergen-specific IgE is valuable and recommended to be an important tool in the diagnosis of immediate type of allergy. |
International Medical Journal. 2016 Jun 1;23(3):252-5. | Asia; Malaysia; prevalence |
| Wang D. | 2020 | Coronaviruses’ sugar shields as vaccine candidates. A successful global healthcare response relies on versatile vaccines and production of broadly virusneutralizing antibodies by the immune system to protect us from emerging infectious diseases. The present 2019 severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) pandemic highlights the urgent need for development of anti-viral biodefense. Due to the genetic and proteomic diversities of viral pathogens, establishing versatile anti-viral vaccines or therapeutic agents is highly challenging. Carbohydrate antigens represent an important class of immunological targets for vaccine development and immunotherapy against microbial infections. In this mini review, some concepts and strategies for exploring the potential of immunogenic sugar moieties as CoV vaccine candidates are presented. |
Current trends in immunology. 2020;21:17. | coronavirus; Covid-19; glycan shield; virus; sugar shield; viral envelope; vaccine |
| Wang Q, Lepus CM, Raghu H, Reber LL, Tsai MM, Wong HH, von Kaeppler E, Lingampalli N, Bloom MS, Hu N, Elliott EE. | 2019 | IgE-mediated mast cell activation promotes inflammation and cartilage destruction in osteoarthritis. Osteoarthritis is characterized by articular cartilage breakdown, and emerging evidence suggests that dysregulated innate immunity is likely involved. Here, we performed proteomic, transcriptomic, and electron microscopic analyses to demonstrate that mast cells are aberrantly activated in human and murine osteoarthritic joint tissues. Using genetic models of mast cell deficiency, we demonstrate that lack of mast cells attenuates osteoarthritis in mice. Using genetic and pharmacologic approaches, we show that the IgE/FcεRI/Syk signaling axis is critical for the development of osteoarthritis. We find that mast cell-derived tryptase induces inflammation, chondrocyte apoptosis, and cartilage breakdown. Our findings demonstrate a central role for IgE-dependent mast cell activation in the pathogenesis of osteoarthritis, suggesting that targeting mast cells could provide therapeutic benefit in human osteoarthritis. |
Elife. 2019 May 14;8:e39905. | rheumatology; arthritis; joints |
| Wang T, Xu W, Zhao X, Bai B, Hua Y, Tang J, Chen F, Liu Y, Wang Y, Zhou G, Cao Y | 2022 | Repair of osteochondral defects mediated by double-layer scaffolds with natural osteochondral-biomimetic microenvironment and interface. Tissue engineering provides a new approach for the treatment of osteochondral defects. However, the lack of an ideal double-layer scaffold with osteochondral-biomimetic microenvironment and interface similar to native articular tissue greatly limits clinical translation. Our current study developed a double-layer acellular osteochondral matrix (AOM) scaffold with natural osteochondral-biomimetic microenvironment and interface by integrating ultraviolet (UV) laser and decellularization techniques. The laser parameters were optimized to achieve a proper pore depth close to the osteochondral interface, which guaranteed complete decellularization, sufficient space for cell loading, and relative independence of the chondrogenic and osteogenic microenvironments. Gelatin-methacryloyl (GelMA) hydrogel was further used as the cell carrier to significantly enhance the efficiency and homogeneity of cell loading in the AOM scaffold with large pore structure. Additionally, in vitro results demonstrated that the components of the AOM scaffold could efficiently regulate the chondrogenic/osteogenic differentiations of bone marrow stromal cells (BMSCs) by activating the chondrogenic/osteogenic related pathways. Importantly, the AOM scaffolds combined with BMSC-laden GelMA hydrogel successfully realized tissue-specific repair of the osteochondral defects in a knee joint model of rabbit. The current study developed a novel double-layer osteochondral biomimetic scaffold and feasible strategy, providing strong support for the tissue-specific repair of osteochondral defects and its future clinical translation. |
Materials Today Bio. 2022 Mar 8:100234. | Bioscaffolding; scaffold; acellular osteochondral matrix (AOM), medical product; surgery; perioperative, orthopedic surgery |
| Wang X, Apple JA, Huang Y. | 2018 | Inactivation of Gene α-1,3-Galactosyltransferase in Bovine Aortic Smooth Muscle Cells Using CRISPR-Cas9. People who get bites from Amblyomma americanum usually develop a severe allergic reaction to red meat. The main reason caused this allergy is because of the presence of α‐1,3‐galactosyl epitopes on the membranes of most mammalian cells. Since human beings do not create galactose‐alpha‐1,3‐galactose (alpha‐gal), the patients' immune system is free to start attacking alpha‐gal when they eat red meat. The epitope transferase coded geneα‐1,3‐galactosyltransferase (GGTA1) was already identified, and it can be knocked out to solve the allergy of eating red meat. GGTA1 gene has successfully knocked out in pigs. However, there is no evidence to show the GGTA1 gene has been knocked out in beef. In this study, we utilized bovine aortic smooth muscle cells (BAOSMC) as the module for the research of GGTA1 gene knockout. The clustered regularly interspaced short palindromic repeats (CRISPR) systems are widely used in performing targeted genome editing in cultured cells. The use of CRISPR‐associated (Cas) systems as an RNA‐programmable DNA targeting and editing platform is followed by a synthetic single‐guide RNA (sgRNA), which can simply edit genome sequences like other tools such as transcription activator‐like effector nucleases (TALENs) and zinc‐finger nucleases (ZFNs). We used the gRNA design tool and selected 5′‐GGCCTGACGGTTTTCGCCGT‐3′ as the target gRNA sequence from the coding DNA sequence of Bos taurus alpha‐galactosyltransferase 1 (glycoprotein). The gRNA was constructed in the pSpCas9 BB‐2A‐GFP (PX458) vector provided by GenScript USA Inc. Vectors were amplified and transfected into BAOSMC by GenePORTER2 transfection reagent when the cells were 80% confluency. Green fluorescent can be viewed after 24 hours transfection (Fig. 1). The transfection efficiency can reach about 70% to 80%. Cells were collected in PBS at pH7.4 after 24 hours transfection. Total protein was extracted then the enzyme‐linked immunosorbent assay was used to examine the GGTA1 production. By normalized with the total protein concentration, the GGTA1 protein level in the transfected cells was 17.9 ± 7.25% lower (P < 0.05) than in the control cells, showing a significant inhibition of GGTA1 gene expression in the cells by CRISPR‐Cas9 gene edition method (Fig. 2). Our data show that the gRNA sequence that we chose was suitable for the GGTA1 gene knockout in BAOSMC. Moreover, the CRISPR‐Cas9 system was proved can be applied in the genome editing of bovine cells. |
The FASEB Journal. 2018 Apr;32:649-7. | cow; galactosyltransferase knockout |
| Wang X, Mathias DK. | 2024 | Surveillance of ticks (Acari: Ixodidae) and tick-borne pathogens in Eastern Central Alabama. |
Journal of Medical Entomology. 2024 Aug 5:tjae096. | lone star ticks; Alabama |
| Wang Y, Hils M, Fischer A, Wölbing F, Fischer K. | 2024 | Gene-edited pigs: a translational model for human food allergy against alpha-Gal and anaphylaxis. |
Frontiers in Immunology. 2024 Feb 26;15:1358178. | Knockout pig; GalSafe; animal model; GMO; genetically modified |
| Weaver M, Thevarajah T, Shah H. | 2021 | Considerations for cataract surgery: alpha-gal allergy. Note: no abstract. Includes table of medical products used in cataract surgery and their alpha-gal content. |
Journal of Cataract & Refractive Surgery. 2021 Mar 1;47(3):415-6. | Medical product; surgery; ophthalmology; perioperative |
| Weins AB, Eberlein B, Biedermann T. | 2019 | ‡ Diagnostik des α‑Gal-Syndroms Aktuelle Standards, Fallstricke und Perspektiven/Diagnostics of alpha-gal syndrome: Current standards, pitfalls and perspectives. α-Gal syndrome results from sensitization to the carbohydrate epitope galactose-α-1,3-galactose (α‑gal). The allergen occurs in mammalian meat and innards, but also in other foods and medical products of animal origin. Allergic reactions generally occur delayed after allergen intake with a latency period, depending on the individual tolerance threshold and the influence of cofactors. Details in the patient's medical history can help to establish the suspected diagnosis of α‑gal syndrome. Confirmation of the diagnosis requires the expertise of specialists, experienced with the implementation and interpretation of in vitro and in vivo diagnostic tests. Whereas skin prick testing with commercial whole-meat extracts often does not provide reliable results, allergen-specific IgE (α-gal) is generally detectable in affected patients. Cell-based tests such as the basophil activation test are currently only employed in an experimental setting. To evaluate, whether a sensitization is clinically relevant, an in-patient oral food challenge should be performed, using for example cooked pork or porcine kidney in addition to suspected cofactors. |
Hautarzt. 2019:36-43. | diagnosis;basophil activation test; gelatin; provocation test. |
| Weins AB, Scharffetter-Kochanek K, Weiss JM, Elsharkawi-Welt K. | 2016 | ‡ Particular features in the diagnosis and management of α-Gal syndrome. No abstract available |
Allergo Journal International. 2016 Dec 1;25(8):251-5. | Europe; diagnosis; management |
| Weiss J, Grilley Olson J, Deal AM, Chera B, Weissler M, Murphy BA, Hayes DN, Gilbert J. | 2016 | Using the galactose-alpha-1,3-galactose enzyme-linked immunosorbent assay to predict anaphylaxis in response to cetuximab. BACKGROUND: Cetuximab is a monoclonal antibody against epidermal growth factor receptor with activity against head and neck cancer and colorectal cancer. Anaphylaxis in response to cetuximab is a significant clinical problem in the Southeastern United States with a grade 3/4 infusion reaction rate of 14%. Previous retrospective data have suggested that the presence of preformed immunoglobulin E antibodies against galactose‐α‐1,3‐galactose in serum can predict anaphylaxis in response to cetuximab. METHODS: Sixty patients were prospectively screened as part of the entry criteria for a phase 2 study of neoadjuvant carboplatin, nab‐paclitaxel, and cetuximab. Patients were recruited at 2 academic medical centers known to have high anaphylaxis rates: the University of North Carolina and Vanderbilt. Only patients with a negative laboratory result were treated on the clinical protocol. RESULTS: No patient experienced anaphylaxis; the negative predictive value was thus 100%. Other than smoking history, the demographics were similar for assay‐positive subjects and assay‐negative subjects. CONCLUSIONS: Subjects with a negative test result can be safely treated with cetuximab. Further research is required regarding the optimal cutoff for positivity and the positive predictive value. |
Cancer. 2016 Jun 1;122(11):1697-701. | |
| Welllins AM. | 2020 | Tick Associated Syndrome: The Alpha-Gal Meat Allergy, Identification,Treatment and Prevention The incidence of tick-borne diseases has increased in the US and the world, becoming a significant public health challenge.Health care providers need to increase their awareness of tick-borne diseases to include clinical manifestations, treatment andprevention. Tick borne diseases include those transmitted by the lone star tick (Amblyomma americanum) which includeEhrlichiosis, Rocky Mountain Spotted Fever (RMSF), Spotted Fever Rickettsiosis, Southern Tick Associated Rash Illness(STARI), Tularemia, Heartland Virus as well as transmitting the alpha gal meat allergy [1].The alpha gal epitope is notnaturally present in humans (or apes) but is present in all other mammals. Exposure to lone star tick bites are associated witha delayed allergic reaction to mammalian meat due to development of antibodies to Galactose-alpha-1, 3-galactose orcommonly known as alpha gal [1]. Although Lyme disease is the predominant tick- borne disease in the US which istransmitted by the Black Legged tick (Ixodes scalpularis), the alpha gal meat allergy sensitization caused by the lone star tickis increasing. This is attributed to the increased number of lone star ticks and their expansion into new geographic locations.It is important to educate the public on signs of this allergy, treatment and how to mitigate exposure to tick bites [2,3]. |
JNOH. 2020 Mar 9.1(3): 66-73 | Nursing; revew article. |
| Wen L, Zhou J, Yin J, Sun JL, Sun Y, Wu K, Katial R. | 2015 | Delayed Anaphylaxis to Red Meat Associated With Specific IgE Antibodies to Galactose. A novel delayed anaphylactic reaction to red meat, associated with tick bites and IgE antibodies against galactose-α-1, 3-galactose (α-gal), was reported in 2009 in the US, Australia and Europe. In this case, serum specific IgE to galactose-α-1, 3-galactose (>100 kU/L) and IgE to multiple non-primate mammalian proteins were positive. However, the pathogenesis of this disease remains unclear. We report the first case in Asia of delayed anaphylactic reaction to red meat, which was induced by bites from the hard tick, Hematophagous ixodidae. We confirmed the increased concentration of IgE reactive epitopes in non-primate mammalian organs, which may be rich in α-gal proteins in lymphatic and endothelial tissues. All confirmed ticks associated with this disorder in the literature and in our case belonged to the hard tick family. We hypothesize that hard tick saliva is enriched with blood-type substances, such as oligosaccharides, from the non-primate mammal victim's blood after days to weeks of blood sucking, which sensitizes humans through the injection route while blood sucking. |
Allergy, asthma & immunology research. 2015 Jan 1;7(1):92-4. | |
| Wen S, Unuma K, Chinuki Y, Hikino H, Uemura K | 2021 | Fatal anaphylaxis due to alpha-gal syndrome after initial cetuximab administration: The first forensic case report. Cetuximab is mainly used for the treatment of advanced and metastatic colorectal cancer. Owing to the oligosaccharide galactose-α-1,3-galactose (α-gal) in its heavy chain, cetuximab can induce severe IgE-dependent anaphylaxis. α-Gal is also the antigen responsible for α-gal syndrome, known as mammalian meat allergy. Patients with α-gal syndrome may suffer from cetuximab-induced anaphylaxis at the first administration because of developed α-gal-specific IgE antibodies. A male patient in his 50 s with metastatic colon cancer was receiving chemotherapy involving scheduled cetuximab administration. However, he died soon after the first administration. Forensic autopsy confirmed rectal cancer, metastatic rectal cancer in the liver, and renal cancer. Laboratory blood tests revealed the presence of cetuximab- and beef-specific IgE antibodies before cetuximab administration and an extremely high level of tryptase after administration. Thus, we determined that the death was caused by cetuximab-induced anaphylaxis due to the preexisting α-gal syndrome. To the best of our knowledge, this is the first autopsy case report in forensic medicine of fatal anaphylaxis after initial cetuximab administration. |
Legal Medicine. 2021 Jul 1;51:101878. | Pharmacology; pharmacy; pharmaceutical; drug; cancer; oncology; monoclonal antibody; cetuximab; death; mortality; fatality; Asia; Japan |
| Werfel SJ, Cooke SK, Sampson HA. | 1997 | Clinical reactivity to beef in children allergic to cow's milk. Background: Cow's milk is one of the most common food allergens in children. Limited information is available on the prevalence of reactivity to a related food source, beef. The purposes of this study were to examine the prevalence of symptomatic sensitivity to beef in a selected pediatric population and to determine the frequency of concomitant reactivity to cow's milk and beef. Methods: Children referred for assessment of atopic dermatitis and possible food hypersensitivity were evaluated for symptomatic reactivity to beef by double-blind placebo-controlled food challenges (DBPCFCs) and subsequent open feedings of beef. Sodium dodecyl-sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), immunoblot, and immunodot blot analyses were performed with patients' sera on preparations of beef extracts subjected to different cooking conditions: raw (no heating), medium, and well-cooked. Results: Eleven of 335 children referred for evaluation of atopic dermatitis and possible food hypersensitivity were found to have symptomatic sensitivity to beef; eight were also sensitive to milk, as demonstrated in previous DBPCFCs. Eight patients reacted to beef during DBPCFC, and three tolerated beef in a DBPCFC and well-cooked beef in an open challenge but reacted to ingestion of less well-cooked beef. SDS-PAGE of raw beef revealed at least 24 protein fractions. Several protein bands in raw beef appeared to denature with heating. Bovine serum albumin and bovine gamma globulin were heat-labile in the beef extract, but six protein fractions persisted even after heating the beef extract for 2 hours at 85° C. IgE from patients reacting to rare and well-cooked beef bound up to six of these heat-resistant fractions, but IgE from patients reacting only to rare beef failed to bind any of these fractions with one exception. In addition, patients reacting to rare and well-cooked beef had specific IgE to a 17.8 kd fraction, which was only weakly recognized by one patient reacting only to rare beef. Conclusions: Specific IgE antibodies to heat-labile beef proteins might explain why some patients can tolerate well-cooked beef but not medium-rare and rare beef. Patients reacting only to rare beef may not need to maintain a complete beef elimination diet. |
Journal of Allergy and Clinical Immunology. 1997 Mar 1;99(3):293-300. | Milk allergy; beef allergy |
| Westman M, Asarnoj A, Ballardini N, Andersson N, Kiewiet MG, Borres MP, Apostolovic D, Kull I, Bergström A, Melén E, van Hage M. | 2021 | ALPHA-GAL SENSITIZATION AMONG YOUNG ADULTS IS ASSOCIATED WITH MALE SEX AND POLYSENSITIZATION. Galactose-α-1,3-galactose (α-Gal) syndrome (AGS) is characterized by delayed severe allergic reactions after consumption of mammalian meat or mammalian-derived products and is caused by immunoglobulin E (IgE) antibodies against the carbohydrate α-Gal.1,2 AGS is most common at middle age, and the route of sensitization appears to be through tick bites.2,3 The prevalence of IgE reactivity to α-Gal differs, 1%-25% depending on region, being more frequent in areas where ticks are common.2 Atopy has been suggested as a risk factor for α-Gal sensitization.3 Here, we explored the prevalence of IgE to α-Gal and mammalian meat allergy among young adults in the general population and elucidated the impact of sensitization to other food or airborne allergens, tick bites, and sex on IgE reactivity to α-Gal. |
The Journal of Allergy and Clinical Immunology: In Practice. 2021 Oct 20. | Europe; Sweden; age; adolescence; gender atopy; polysensitization |
| Wickner PG, Commins SP. | 2014 | The First 4 Central American Cases Of Delayed Meat Allergy With Galactose-Alpha-1,3-Galactose Positivity Clustered Among Field Biologists In Panama. RATIONALE: Serological positivity to galactose-alpha-1,3-galactose has been associated with delayed meat anaphylaxis and tick bite exposure. This entity has been reported in Australia, North America and Europe. Here we report the first 4 Central American cases of delayed meat anaphylaxis clustered among field biologists in Panama. METHODS: Subjects describing a history of urticaria, food allergy, or anaphylaxis were enrolled in IRB HSR#13298. Total and sIgE antibody analyses were performed on the sera of these patients. Alpha-gal sIgE antibodies were measured using our modification of the ImmunoCAP assay with streptavidin on the solid phase. RESULTS: Within this group of subjects reactions ranged from hives and joint swelling to respiratory distress requiring emergency room visit after an unknown number of tick bites. Alpha-gal sIgE ranged from 6.31 – 174IU/mL and total IgE was 34-261IU/mL (GM 5 94.2). CONCLUSIONS: Tick bites are common among international and local biologists working near the Panama Canal. In the forested and aquatic areas surrounding the canal, an estimated 15-20 tick species are found, at a density of 8500 ticks per 300 m2 of forest. Human bites are dominated by the Amblyomma cajennense species. We report 4 cases of delayed meat allergy among field biologists. This group represents a unique cohort in which the natural history of sensitization to alpha-gal can be studied. |
Journal of Allergy and Clinical Immunology. 2014 Feb 1;133(2):AB212. | Latin America; Central America; Panama; vector; tick; Amblyomma cajennense |
| Wilkinson H, Thomsson KA, Rebelo AL, Hilliard M, Pandit A, Rudd PM, Karlsson NG, Saldova R | 2021 | The O-Glycome of Human Nigrostriatal Tissue and Its Alteration in Parkinson’s Disease. O-Glycosylation changes in misfolded proteins are of particular interest in understanding neurodegenerative conditions such as Parkinson’s disease (PD) and incidental Lewy body disease (ILBD). This work outlines optimizations of a microwave-assisted nonreductive release to limit glycan degradation and employs this methodology to analyze O-glycosylation on the human striatum and substantia nigra tissue in PD, ILBD, and healthy controls, working alongside well-established reductive release approaches. A total of 70 O-glycans were identified, with ILBD presenting significantly decreased levels of mannose-core (p = 0.017) and glucuronylated structures (p = 0.039) in the striatum and PD presenting an increase in sialylation (p < 0.001) and a decrease in sulfation (p = 0.001). Significant increases in sialylation (p = 0.038) in PD were also observed in the substantia nigra. This is the first study to profile the whole nigrostriatal O-glycome in healthy, PD, and ILBD tissues, outlining disease biomarkers alongside benefits of employing orthogonal techniques for O-glycan analysis. Note: although this paper does not suggest a link between PD and anti-gal, it was included in this database because of the finding of alpha-gal in the brain. |
Journal of Proteome Research. 2021 Jun 30. | Brain |
| Wilson J, Ailsworth S, Workman L, Patel J, Keshavarz B, Nelson M, Platts-Mills T, Susi A, Nylund C. | 2023 | Prevalence and National Sensitization Patterns of Alpha-Gal IgE Among Military Personnel. Rationale: IgE antibodies to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal) are causally-related to a syndrome of mammalian meat allergy that is linked to tick bites and is common in parts of the southeastern USA. There has been limited surveillance of alpha-gal sensitization nationally and in the military population. Methods: Here we surveyed baseline alpha-gal IgE prevalence in serum samples from 3000 service members who presented to one of 10 military bases in the central/eastern USA. Serum was collected from 2002-2007 at the time personnel presented to the base and was bio-banked in the Department of Defense Serum Repository. Alpha-gal IgE was assayed by ImmunoCAP (cut-off 0.1 kU/L) and related to home of record at time of enlistment. Results: Of the cohort, 2456 subjects were male (81.9%) and median age was 19 years (IQR18-22). Home of record spanned all 50 states, with a median of 36 recruits per state (range 3-261). Overall prevalence of alpha-gal IgE was 6.0%. Focusing on the 35 states with at least 20 personnel, the highest prevalence rates were in Arkansas (36%), Oklahoma (35%) and Missouri (29%). States with intermediate prevalence included Kentucky (14%), Mississippi (13%), North Carolina (12%), Tennessee (10%), Alabama (10%), Minnesota (9%) and Virginia (7%). There were no cases from Utah, West Virginia, Colorado or Michigan and less than 2% in Wisconsin, Massachusetts, Washington, Illinois and New York. Conclusions: Baseline prevalence of alpha-gal IgE among military personnel was 6.0%. There were significant regional differences, with an overall pattern consistent with the known range of the lone star tick (Amblyomma americanum). |
Journal of Allergy and Clinical Immunology. 2023 Feb 1;151(2):AB94. | occupational medicine, military, epidemiology, prevalance |
| Wilson J, Drago F, Workman L, Taylor A, Platts-Mills T, McNamara C. | 2022 | Alpha-Gal sensitization, mammalian meat consumption and allergic symptoms in adults from central Virginia at-risk for cardiovascular disease. Rationale: Studying adults in central Virginia at-risk for cardiovascular disease we previously reported a high prevalence of α-Gal sensitization (26%) and, using high-sensitivity intravascular ultrasound imaging, an association between α-Gal IgE and coronary artery disease (CAD) severity. Here we sought to characterize diet and allergic symptoms in prospectively recruited at-risk subjects, hypothesizing that most sensitized subjects lacked allergic symptoms and routinely consumed mammalian meat. Methods: Adults deemed to be at-risk for CAD by their primary providers were referred for coronary angiography in this University of Virginia IRB-approved investigation. Consented individuals provided a blood sample and dietary/allergic history was obtained by questionnaire. Total IgE and α-Gal IgE were assayed with ImmunoCAP 250. Results: Of 113 subjects, the majority were men (69%), median age was 62, 104 (92%) reported at least weekly consumption of mammalian meat, 92 (81%) had evidence of CAD and 38 (34%) were α-Gal IgE positive (cut-off of 0.1 kUA/L). Demographics, co-morbid allergic disease and CAD severity were similar among sensitized and non-sensitized subjects. Among the sensitized, α-Gal IgE levels ranged from 0.1-18.1 kUA/L (median 0.74 kUA/L) and 87% reported routine consumption of both mammalian meat and dairy. Among 7 subjects with α-Gal IgE ≥ class 3 (3.5 kUA/L), all consumed dairy, 6 routinely consumed mammalian meat and none reported history of hives or anaphylaxis. Conclusions: Alpha-Gal sensitization is common in adults at-risk for CAD in central Virginia, but most of these patients do not have overt allergic symptoms and routinely consume mammalian meat and dairy. Studies using high-sensitivity CAD imaging are ongoing. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB207. | Cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Wilson J, Keshavarz B, James H, Retterer M, Schuyler A, Knoedler A, Workman L, Chico ME, Rönmark E, Heymann P, Perzanowski M. | 2021 | α-Gal specific-IgE prevalence and levels in Ecuador and Kenya: relation to diet, parasites and IgG4. Background: IgE to α-Gal is a cause of mammalian meat allergy and has been linked to tick bites in North America, Australia and Eurasia. Reports from the developing world indicate that α-Gal sensitization is prevalent but has been little investigated. Objective: To seek evidence for the cause(s) of α-Gal sensitization and lack of reported meat allergy among children in less developed settings in Ecuador and Kenya.Methods: IgE to α-Gal and total IgE were assessed in children from Ecuador (n=599) and Kenya (n=254) and compared to children with (n=42) and without known (n=63) red meat allergy from the Southeastern USA. Information on diet, potential risk factors and helminth infections were available for children from Ecuador. IgG4 to α-Gal and antibodies to regionally-representative parasites were assessed in a subset of children. Results: In Ecuador (32%) and Kenya (54%) α-Gal specific-IgE was prevalent, but levels were lower than children with meat allergy from the USA. Sensitization was associated with rural living, antibody markers of Ascaris exposure and total IgE, but not active infections with Ascaris or Trichuris species. In Ecuador 87.5% reported consuming beef ≥1x per week, including 83.9% of those who had α-Gal specific-IgE. Levels of α-Gal specific-IgG4 were not high in Ecuador, but were greater than in children from the USA. Conclusion: These results suggest that in areas of the developing world with endemic parasitism that α-Gal sensitization is: i) common, ii) associated with Ascaris exposure, and iii) distinguished by a low percentage of specific/total IgE compared to individuals with meat allergy in the USA. |
Journal of Allergy and Clinical Immunology. 2021 Feb 1. | South America; Africa; Ecuador; Kenya; prevalence; helminths; total IgE |
| Wilson J, Keshavarz B, Straesser M, Kim M, Workman L, McGowan E, Platts-Mills T. | 2020 | Additional insights into the connection between tick bites and the α-Gal syndrome in the United States. Rationale: IgE to galactose-α-1,3-galactose (α-Gal) is causal in the syndrome of delayed anaphylaxis to mammalian meat. Sensitization to the oligosaccharide has been linked with tick bites, particularly Amblyomma americanum (lone star tick) in the United States, although many questions remain. Methods: IgE to α-Gal and IgE to preparations of whole body adult tick extract (WBE) from A. americanum, and two other dominant ticks of North America, were measured with ImmunoCAP using the streptavidin technique in sera from 159 α-Gal syndrome cases and 20 controls. Correlations were determined by Spearman’s rank test. Results were related to an epidemiological investigation into the distribution of the syndrome. Results: There was a moderate association between IgE to A. americanum WBE and α-Gal specific-IgE (Rs=0.33, p<0.001). Interestingly, the strength of correlation between α-Gal specific-IgE and IgE to Ixodes scapularis WBE was strong (Rs=0.75, p<0.001), while the relationship between α-Gal specific-IgE and IgE to Dermacentor variabilis WBE was less striking (Rs=0.26, p<0.001). In Western blots α-Gal was most consistently identified in I. scapularis. Cases of α-Gal syndrome were abundant in areas where A. americanum is endemic but were not common in areas where I. scapularis is prevalent, e.g. – the northeastern USA. Conclusions: Adult I. scapularis WBE contains α-Gal and can be recognized by IgE from subjects with the α-Gal syndrome; nonetheless, the epidemiology indicates that I. scapularis is not a dominant cause of sensitization. These results further support the connection between α-Gal and tick bites but raise additional questions about the species-specific factors that contribute to α-Gal specific-IgE induction. |
Journal of Allergy and Clinical Immunology. 2020 Feb 1;145(2):AB145. | vectors of sensitization; ectoparasites; Ixodes; Amblyomma |
| Wilson J, Platts-Mills T, Richards R. | 2022 | S68 Alpha-Gal Syndrome Complicating the Management of Suspected Pancreatic Exocrine Insufficiency. IgE antibodies to the oligosaccharide galactose-α-1,3-galactose (α-gal) are an important cause of allergic reactions to mammalian meat and other mammal-derived products. The symptoms of α-gal syndrome (AGS) can involve urticaria or anaphylaxis, but increasingly we are aware that GI tract symptoms, including diarrhea, are also a major feature of AGS. Pancreatic exocrine insufficiency (PEI) is a common cause of diarrhea and treatment involves the use of pancreatic replacement enzymes (PRE). PRE are porcine derived and contain α-gal. Patients receiving PRE who are α-gal IgE positive are at risk for allergic reactions and GI symptoms due to α-gal sensitivity. Here we reviewed patients with suspected PEI and concomitant α-gal IgE sensitization in the practice of one gastroenterologist in Virginia. |
Official journal of the American College of Gastroenterology| ACG. 2022 Oct 1;117(10S):e49. | gastroenterology, pancreatic exocrine insufficiency, pancreatic enzymes, pharmacology, Creon, Zenpep |
| Wilson J, Schuyler A, Workman L, Perzanowski M, James H, Commins S, Heymann P, Platts-Mills T. | 2017 | ‡ OR074 Comparison of galactose-a-1,3-galactose specific IgE responses in children from rural Kenya and central Virginia. Introduction: Galactose-α-1,3-galactose (α-gal) is a carbohydrate allergen that has been implicated in delayed reactions to red meat in North America, Europe, Asia and Australia. Interestingly, the prevalence of IgE sensitization to α-gal in parts of rural Africa is higher than in regions where reactions to red meat are commonly reported. Possible explanations for this discrepancy relate to differences in the absolute or relative quantity of α-gal specific IgE (sIgE) or to the presence α-gal specific blocking antibodies. Methods: We compared sIgE titers in a random cohort of children in central Virginia (n=143) with one in rural Kenya (n=131), as well as a group of children with documented α-gal allergy (n=57). Sera were tested using ImmunoCAP for α-gal sIgE (cut-off > 0.35 kU/L) and total IgE. A subset of sera was assessed for specific IgG4 to α-gal using beef thyroglobulin. Results: Of randomly selected children α-gal sIgE was detected in 23.8% from Virginia and 77.1% from rural Kenya. Whereas sensitized children in Kenya had higher levels of α-gal sIgE than unselected children in Virginia, the fraction of sIgE as a function of total IgE was significantly less. Specific IgG4 to α-gal was not elevated in Kenyan children compared to control children from the USA. Conclusion: These results indicate that α-gal responses in rural Kenya are distinguished by a low percentage of specific/total IgE, but not blocking antibodies. This finding is consistent with the premise that the manifestation of 'α-gal syndrome' relates to the ratio of α-gal sIgE versus total IgE. |
Annals of Allergy, Asthma & Immunology. 2017 Nov 1;119(5):S10. | Africa; Kenya; diagnosis; prevalence; sIgE/total IgE ration |
| Wilson JM, Erickson L, Levin M, Ailsworth SM, Commins SP, Platts‐Mills TA. | 2024 | Tick bites, IgE to galactose‐alpha‐1, 3‐galactose and urticarial or anaphylactic reactions to mammalian meat: The alpha‐gal syndrome. |
Allergy. 2024 Jan 9. | Review article |
| Wilson JM, Keshavarz B, Retterer M, Workman LJ, Schuyler AJ, McGowan EC, Lane C, Kandeel A, Purser J, Ronmark E, LaRussa J. | 2020 | A dynamic relationship between two regional causes of IgE-mediated anaphylaxis: α-Gal syndrome and imported fire ant. Background: A syndrome of mammalian meat allergy relating to IgE specific for galactose-α-1,3-galactose (α-Gal) was first reported ten years ago in the southeastern United States and has been related to bites of the lone star tick (Amblyomma americanum). Objective: Here we investigated the epidemiology of the “α-Gal syndrome” in the USA and sought additional evidence for the connection to tick bites. Methods: A survey of allergists was conducted using a snowball approach. A second tier of the survey included questions about anaphylaxis to imported fire ants (IFA). History of tick bites and tick-related febrile illness were assessed as part of a case-control study in Virginia. Antibody assays were conducted on sera from subjects reporting allergic reactions to mammalian meat or IFA. Results: In North America the α-Gal syndrome is recognized across the Southeast, Midwest and Coastal Atlantic with many providers in this area each managing over 100 cases. The distribution of cases generally conformed to the reported range of Amblyomma americanum, although within this range there was an inverse relationship between α-Gal cases and cases of IFA anaphylaxis that were closely related to the territory of IFA. The connection between tick bites and α-Gal sensitization was further supported by questionnaire and serologic results of cases. Conclusions: The α-Gal syndrome is commonly acquired in adulthood as a consequence of tick bites and has a regional distribution that largely conforms to the territory of the lone star tick. The epidemiology of the syndrome is expected to be dynamic and shifting north because of climate change and ecologic competition from IFA. |
Journal of Allergy and Clinical Immunology. 2020 Jun 6. | Tick galactose-α-1,3-galactose mammalian meat allergy α-Gal syndrome IgE anaphylaxis imported fire ant |
| Wilson JM, McNamara CA, Platts-Mills TA. | 2019 | * IgE, alpha-Gal and atherosclerosis. Emerging evidence suggests a link between allergic disease and cardiovascular disease. The idea that there could be a connection between ‘allergies’ and heart disease is not readily apparent. Nonetheless, over the past 20 years research in mice and humans has linked hematopoietic cells and soluble factors that mediate allergic disease with coronary artery disease (CAD). Specifically, mast cells and elevated levels of the Immunoglobulin E (IgE) isotype [4] have been associated with the presence and/or severity of CAD. However, despite these associations, no specific allergens or IgE responses to specific allergens, have been implicated in CAD. It was on this backdrop that a team of allergists and cardiologists collaborated to investigate the hypothesis that specific IgE to a novel oligosaccharide allergen present in mammalian meat could be a risk factor for CAD. |
Aging. 2019; 11(7): 1900-1902. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Wilson JM, Nguyen AT, Schuyler AJ, Commins SP, Taylor AM, Platts-Mills TA, McNamara CA. | 2018 | IgE Sensitization to the Food Allergen Galactose-a-1,3-Galactose is Associated with Coronary Atherosclerosis. RATIONALE: The oligosaccharide galactose-a-1,3-galactose (a-Gal) is the target of IgE in cases of delayed anaphylaxis to red meat. Sensitization to a-Gal is more prevalent in the community than cases of delayed anaphylaxis and is particularly common in the southeastern United States, a region with high incidence of cardiovascular disease. Additionally, recent reports have linked mast cells and elevated total IgE with coronary artery disease. We sought to test the hypothesis that sensitization to a-Gal represents an independent risk factor for coronary atherosclerosis. METHODS: Total IgE and specific IgE to a-Gal (cut-off >_0.1kU/L) were assayed on sera from 118 subjects who had symptoms suggestive of possible coronary heart disease and underwent coronary imaging with intravascular ultrasound (IVUS). . RESULTS: Of the cohort 26% had detectable titers of IgE to a-Gal. There were no significant differences in traditional risk factors such as obesity, hypertension, diabetes or cholesterol levels in sensitized and nonsensitized subjects. Atheroma burden was higher in the sensitized group. Focusing on subjects less than 65 years old (n570) the association was stronger, and lesions in the sensitized group were more calcified and necrotic but less fibrous. Regression analysis accounting for age, diabetes, HTN and statin use supported a significant association between between aGal sensitization and atheroma burden (p50.009). . CONCLUSIONS: a-Gal is an oligosaccharide that is present in mammalian foods, i.e – red meat and dairy, which are common in a Western diet and have been associated with coronary artery disease. IgE sensitization to a-Gal represents a novel, and potentially modifiable, risk factor for coronary atherosclerosis. |
Journal of Allergy and Clinical Immunology. 2018 Feb 1;141(2):AB146. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Wilson JM, Nguyen AT, Schuyler AJ, Commins SP, Taylor AM, Platts-Mills TA, McNamara CA. | 2018 | IgE to the Mammalian Oligosaccharide Galactose--1,3-Galactose Is Associated With Increased Atheroma Volume and Plaques With Unstable Characteristics: Brief Report. Objective— Emerging evidence suggests a link between coronary artery disease and type 2 immunity. We sought to test the hypothesis that IgE sensitization to the mammalian oligosaccharide galactose-α-1,3-galactose (α-Gal)—the target allergen of delayed anaphylaxis to red meat—is associated with coronary artery disease. Approach and Results— Total IgE and specific IgE to α-Gal were assayed on sera from 118 subjects who presented for cardiac catheterization and underwent intravascular ultrasound. IgE to α-Gal was detected in 26%, and atheroma burden was higher in sensitized subjects (P=0.02). Because α-Gal sensitization relates to an environmental exposure that could be a risk factor for early-onset coronary artery disease (ie, tick bites), we age stratified the cohort. In subjects ≤65 years of age, the strength of the association with atheroma burden was stronger (P<0.001), and plaques in the sensitized group had less stable features based on intravascular ultrasound. To address the specificity of the association with IgE to α-Gal, IgE to inhalants and peanut were assayed and were not associated with coronary artery disease. Total IgE and α-Gal–specific IgE were strongly associated with each other, but the strength of the relationship with atheroma burden was stronger for α-Gal–specific IgE. This association was significant when adjusted for sex, diabetes mellitus, hypertension, statin use, and total IgE (regression coefficient, 12.2; SE, 5.2; P=0.02). Conclusions— Increased atheroma burden and plaques with more unstable features were associated with IgE to α-Gal—an effect most pronounced in subjects ≤65 years of age. IgE sensitization to α-Gal may represent a novel, and potentially modifiable, risk factor for coronary atherosclerosis. |
Arteriosclerosis, thrombosis, and vascular biology. 2018 Jul;38(7):1665-9. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Wilson JM, Nguyen AT, Schuyler AJ, Workman L, Commins SP, Taylor AM, Mcnamara CA, Platts-Mills TA. | 2019 | Investigation of increased prevalence of IgE specific for galactose alpha-1,3-galactose in patients with coronary artery disease. |
ALLERGY 2019 Aug 1; 74: 595-595. | cardiac; cardiovascular; cardiology; atherosclerosis; CAD coronary artery disease |
| Wilson JM, Platts-Mills TA. | 2020 | α-Gal and other recent findings that have informed our understanding of anaphylaxis. Objective: To summarize the current understanding of anaphylaxis, with an emphasis on major findings that have been reported within the last 10 years. Data Sources: Queries relating to anaphylaxis, immunoglobulin E (IgE), and mast cells were conducted with PubMed and Google Scholar, searching for primary articles and review papers. . Study Selections: We focused on articles written in English and which were reported in major allergy and immunology journals. . Results: Anaphylaxis represents an extreme manifestation of a form of allergic immunity that appears to have evolved to protect against “toxic” threats that present at skin and mucosal barriers. The factors that have contributed to a rise in anaphylaxis are increasingly appreciated to relate to changes in hygiene and microbial ecology that have occurred with industrialization. Induction of allergen-specific IgG4 is often part of the allergic response and is associated with protection against anaphylaxis. The recognition of the α-Gal syndrome suggests that carbohydrates can be epitopes that are relevant to anaphylaxis and that IgE-mediated reactions do not always occur “immediately.” . Conclusion: Our understanding of anaphylaxis has advanced significantly over the past 10 years. It is anticipated that ongoing research will build on this foundation to further advance our knowledge of anaphylaxis and also translate into clinically meaningful therapies. . |
Annals of Allergy, Asthma & Immunology. 2020 Feb 1;124(2):135-42. | |
| Wilson JM, Platts-Mills TAE. | 2018 | The oligosaccharide galactose-α-1, 3-galactose and the α-Gal syndrome: insights from an epitope that is causal in immunoglobulin E-mediated immediate and delayed anaphylaxis. Galactose-α-1,3-galactose (α-Gal) is an oligosaccharide that was first described as a cause of immunoglobulin E-mediated anaphylaxis in cases of first-in-man reactions to the monoclonal antibody cetuximab. Soon thereafter, immunoglobulin E antibodies to this epitope were linked with anaphylactic episodes to mammalian meat, which had a characteristic delay of ~3-6 hours. The ‘α-Gal syndrome’ is now recognised globally as a significant form of food allergy, albeit with regional variation, which reflects that sensitisation relates to bites from certain species of hard tick. The α-Gal epitope is present in organs and muscles from most mammals (with the exception of humans, apes, and Old World monkeys) as a glycan conjugated to both proteins and lipids. There are a number of unusual features that distinguish α-Gal from other traditional food allergies, including the fact that the oligosaccharide can be causal in both immediate and delayed allergic responses, and that co-factors, such as alcohol or exercise, often relate to the instigation and/or severity of clinical reactions. In this narrative review, the authors focus on the novelty of α-Gal’s intrinsic lipid form; consider aspects of glycolipid digestion, absorption, and processing; and explain how this ‘glycolipid hypothesis’ may explain several of the clinical features of α-Gal syndrome. This review draws on pioneering studies of the biochemistry of α-Gal, contemporary understanding of lipid metabolism, and comparisons to other clinically important oligosaccharides. |
Eur Med J. 2018;3:89-98. | biochemistry; glycolipid |
| Wilson JM, Platts-Mills TAE. | 2019 | ‡ IgE to galactose-alpha-1,3-galactose and the alpha-Gal syndrome: Insights from basophil activation testing. Editorial No abstract available |
Journal of Allergy and Clinical Immunology. 2019 Jan 1;143(1):101-3. | Prevalence; diagnosis; basophil activation test |
| Wilson JM, Platts-Mills TAE. | 2018 | Meat allergy and allergens. IgE-mediated hypersensitivity to ingested animal products, including both mammalian and avian sources, is increasingly appreciated as an important form of food allergy. Traditionally described largely in children, it is now clear that allergy to meat (and animal viscera) impacts both children and adults and represents a heterogeneous group of allergic disorders with multiple distinct syndromes. The recognition of entities such as pork-cat syndrome and delayed anaphylaxis to red meat, i.e- the a-Gal syndrome, have shed light on fundamental, and in some cases newly appreciated, features of allergic disease. These include insights into routes of exposure and mechanisms of sensitization, as well as the realization that IgE-mediated reactions can be delayed by several hours. Here we review mammalian and avian meat allergy with an emphasis on the molecular allergens and pathways that contribute to disease, as well as the role of in vitro IgE testing in diagnosis and management. |
Clinical microbiology reviews. 2008 Apr 1;21(2):360-79. | Review article; meat allergy |
| Wilson JM, Platts-Mills TAE. | 2019 | § Red meat allergy in children and adults. Purpose of review: To highlight recent advances in our understanding of the clinical features, prevalence, and pathophysiology of red meat allergy. Recent findings: Allergic reactions to red (i.e. mammalian) meat have historically been considered rare and described primarily in young atopic children. It is now clear that red meat allergy is not uncommon in some parts of the world in other age groups. Strikingly, the majority of these cases relate to specific IgE to galactose-α-1,3-galactose, an oligosaccharide of nonprimate mammals. The mechanism of sensitization in this syndrome relates to bites of certain hard ticks and the clinical reactions often have a delay of 3 to 6 h. An additional form of red meat allergy relates to inhalant sensitization to mammalian proteins. The best characterized example involves cat-sensitized patients with specific IgE to cat serum albumin who can react to ingested pork because of cross-sensitization to pork serum albumin. Summary: Red meat allergy is more common than previously appreciated and relates to at least three different forms that are distinguished by mechanisms of sensitization and have characteristic clinical and immunologic features. |
Gastroenterology. 2007 Oct 1;133(4):1342-63. | Key review article |
| Wilson JM, Schuyler AJ, Schroeder N, Platts-Mills TA. | 2017 | Galactose-α-1,3-galactose: atypical food allergen or model IgE hypersensitivity? Purpose of Review: Galactose-α-1,3-galactose (α-gal) is a carbohydrate allergen with several unique characteristics. In this article, we discuss some recent advances in our understanding of the ‘alpha-gal syndrome,’ highlight data supporting the role of ticks in pathogenesis, and speculate on immune mechanisms that lead to sensitization. Recent Findings: First described as the target of IgE in individuals suffering immediate hypersensitivity reactions to the novel anti-EGF monoclonal antibody cetuximab, it is now clear that α-gal sensitization is associated with mammalian meat allergy as well as reactions to other mammalian products. Unlike traditional IgE-mediated food allergies, reactions to α-gal often do not manifest until several hours following an exposure, although co-factors can influence the presentation. Multiple pieces of evidence, including recent work with a mouse model, point to the fact that sensitization is mediated by exposure to certain hard ticks and increasingly we are aware of its globally widespread impact. Summary: The oligosaccharide α-gal represents a novel allergen with several unusual clinical features. It has been recognized now on multiple continents and its clinical presentation can be quite variable. Moreover, efforts to delineate the mechanisms leading to α-gal sensitization may have ramifications for our broader understanding of type 2 immunity. |
Current allergy and asthma reports. 2017 Jan 1;17(1):8. | Review article; th2; type 2 immunity |
| Wilson JM, Schuyler AJ, Tripathi A, Erwin EA, Commins SP, Platts-Mills TA. | 2016 | IgG4 Component Allergens Are Preferentially Increased in Eosinophilic Esophagitis As Compared to Patients with Milk Anaphylaxis or Galactose-Alpha-1,3-Galactose Allergy. Rationale: Incidence of food allergy is increasing, including diseases with apparently unique pathophysiologic pathways such as eosinophilic esophagitis (EoE), milk anaphylaxis and galactose-alpha-1,3-galactose (alpha-gal) allergy. The role of IgE in these diseases has been well studied, though the contribution of other antibody subtypes, including IgG4, is less clear. Methods: Here we assessed IgG4 levels to relevant component allergens from sera banked at the University of Virginia in randomly selected patients carrying diagnoses of EoE, milk anaphylaxis and alpha-gal meat allergy. IgG4 and IgE levels were measured with ImmunoCap technology using commercial assays or biotinylated antigen coupled to streptavidin immunosorbent. Results: IgG4 geometric mean levels to milk component allergens Bos d 4 (alpha-lactalbumin) and Bos d 5 (beta-lactoglobulin) were >10 fold higher in EoE patients than milk anaphylaxis or non-allergic controls. This also correlated with a pronounced shift in the IgE/IgG4 ratio between EoE and milk anaphylaxis. Similar to the trend seen in milk anaphylaxis but contrary to EoE, alpha-gal patients had marked relative increase in IgE versus IgG4 levels to the relevant allergen galactose-alpha-1,3-galactose. Conclusions: Levels of IgG4 to relevant allergen are uniquely elevated in EoE as compared to other food allergies, including milk anaphylaxis and alpha-gal, where IgE is the dominant response. This preliminary work using component-specific testing builds on prior studies demonstrating that IgG4 is preferentially elevated in EoE. It also highlights that despite a delayed clinical response alpha-gal shares an IgE-to-IgG4 signature similar to other immediate hypersensitivity reactions. |
Journal of Allergy and Clinical Immunology. 2016 Feb 1;137(2):AB199. | |
| Wilson JM, Schuyler AJ, Workman L, Gupta M, James HR, Posthumus J, McGowan EC, Commins SP, Platts-Mills TA. | 2019 | Investigation into the alpha-Gal Syndrome: Characteristics of 261 Children and Adults Reporting Red Meat Allergy. Background: Red meat allergy has historically been understood as a rare disease of atopic children, but the discovery of the “α-Gal syndrome,” which relates to IgE to the oligosaccharide galactose-α-1,3-galactose (α-Gal), has challenged that notion. Objective: To describe the clinical and immunologic characteristics of a large group of subjects with self-reported allergy to mammalian meat. Methods: This was an observational study of 261 children and adults (range, 5-82 years) who presented for evaluation for allergic reactions to mammalian meat. Results were based on serum assays and a detailed questionnaire. Results: α-Gal specific IgE ≥ 0.35 IU/mL was detected in 245 subjects and symptom onset occurred ≥2 hours after eating mammalian meat in 211 (81%). Component testing supported a diagnosis of α-Gal syndrome in 95%, pork-cat syndrome in 1.9%, and primary beef allergy in 1.1%. Urticaria was reported by 93%, anaphylaxis by 60%, and gastrointestinal symptoms by 64%. Levels of IgE and IgG specific to α-Gal were similar in subjects who reported early- or delayed-onset symptoms, and in those with and without anaphylaxis. Levels of α-Gal specific IgE and severity of reactions were similar among those with and without traditional atopy, and among children (n = 35) and adults (n = 226). Blood group B trended toward being under-represented among α-Gal-sensitized subjects; however, α-Gal specific IgE titers were high in symptomatic cases with B-antigen. Conclusions: The α-Gal syndrome is a regionally common form of food allergy that has a characteristic but not universal delay in symptom onset, includes gastrointestinal symptoms, can develop at any time in life, and is equally common in otherwise nonatopic individuals. |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 Sep 1;7(7):2348-58. | Pediatric |
| Wilson JM, Schuyler AJ, Workman L, Hayley J, Posthumus J, McGowan EC, Commins SP, Platts-Mills TA. | 2019 | Investigation into the α-Gal syndrome: Characteristics of a large cohort sensitized to galactose-α-1, 3-galactose (α-Gal). RATIONALE: Galactose-a-1,3-galactose (a-Gal) is an oligosaccharide that is causal in a syndrome of IgE-mediated delayed anaphylaxis to mammalian meat. Here we describe clinic and serologic features of a large cohort of children and adults who reported histories of urticaria or anaphylaxis to mammalian meat. METHODS: This observational study consisted of 408 subjects. Most reported episodes of anaphylaxis or urticaria, often relating to mammalian meat; 36 were enrolled as asymptomatic controls. Subjects had blood drawn for serologic assays and completed a detailed questionnaire. . RESULTS: Of the cohort, specific IgE (sIgE) to a-Gal >_0.35 IU/mL was detected in 311. Of these, 212 were considered ‘classic’ a-Gal syndrome on the basis of histories of reactions to mammalian meat with onset >_ 2hrs after ingestion. These classic cases were mostly adults (82%) with a mean age of symptom onset of 42 years. Titers of sIgE to a-Gal were similar regardless of inhalant sensitization status and were not associated with reaction severity, but were higher in subjects with a-Gal syndrome than sensitized subjects who were asymptomatic. B-antigen blood group was under-represented in subjects with classic a-Gal syndrome, however amongst the classic cases subjects with the B- antigen had higher relative titers of a-Gal sIgE than subjects without B antigen. . CONCLUSIONS: The a-Gal syndrome represents a food allergy to an oligosaccharide present in non-primate mammals as glycoproteins and glycolipids and has several distinguishing features. The syndrome occurs commonly in subjects without traditional atopy, has a characteristic delay in symptom onset and is affected by ABO status |
The Journal of Allergy and Clinical Immunology: In Practice. 2019 Sep 1;7(7):2348-58. | |
| Wilson JM, TAE PM, Keshavarz B. | 2021 | Reply to: The antibody response to the glycan α-Gal correlates with COVID-19 symptoms. To the Editor:We read with interest two recent papers which discussed possibleconnections between the immune response to galactose‐α‐1,3‐galactose (α‐Gal) and coronavirus disease 2019 (COVID‐19)... |
Journal of Medical Virology. 2021 Apr 14. | Coronavirus; covid-19; vaccine; vaccination; Urra |
| Wolaver W, Thakrar S, Thomas K, Thakrar H, Schwartz L, Zuelzer W, Butterworth IV J, Hoelting K. | 2021 | Demystifying α-gal syndrome: identification and risk management in the perioperative setting. Purpose of review: α-Gal syndrome is among a vexing perioperative consideration for anesthesiologists. Commonly referred to as ‘red meat allergy’, α-Gal syndrome is precipitated by a lone star tick bite resulting in the formation of immunoglobulin E (IgE) antibodies against the tick salivary glycoproteins and noncatarrhine mammalian tissue. Recent findings: Up to 20% of the population in the southeastern United States may test positive for IgE antibodies to α-Gal. Increasingly, recognition of α-Gal syndrome as an immune response to red meat consumption and certain drugs, many of which may be administered within the perioperative period, has led to greater awareness of the insidious nature of its presentation – from mild urticaria and gastrointestinal symptoms to severe anaphylaxis. Summary: With the increasing prevalence and identification of α-Gal syndrome, a safe and tailored perioperative process is needed to integrate a pathway that involves multidisciplinary communication, robust information sharing platform, and a structured peri-procedure management. |
Current Opinion in Anesthesiology. 2021 Oct 11. | Anesthesia; perioperative; hospital; ER; drugs; medication; medical products |
| Wölbing F, Fischer J, Köberle M, Kaesler S, Biedermann T. | 2013 | About the role and underlying mechanisms of cofactors in anaphylaxis. Anaphylaxis is the systemic and most severe presentation of type I allergy. A number of conditions were identified that modulate the onset of anaphylaxis such as co‐ or augmentation factors, which significantly lower the allergen dose necessary for triggering anaphylaxis. Next to physical exercise or alcohol consumption, co‐administration of nonsteroidal anti‐inflammatory drugs (NSAID ) or concomitant infectious diseases are well‐documented cofactors of anaphylaxis. Registries for anaphylaxis document a role for cofactors in about 30% of anaphylactic reactions. Some disease entities such as ‘wheat‐dependent exercise‐induced anaphylaxis’ (WDEIA ) are explicitly characterized by elicitation of anaphylaxis only in the presence of at least one such cofactor. Using WDEIA as a model disease, studies demonstrated that exercise increases skin prick test reactivity to and bioavailability of the allergen. Additional data indicate that alcohol consumption and NSAID administration display similar effects. Modulation of the cellular activation threshold is another mechanism underlying cofactor‐induced anaphylaxis, most likely also functional when infectious diseases orchestrate elicitation of anaphylaxis. Cofactors are increasingly accepted to play a fundamental role in eliciting anaphylaxis. Consequently, to improve patient management modalities, a better understanding of the underlying mechanisms is warranted. This review aims to update clinicians and clinical scientists on recent developments. |
Allergy. 2013 Sep;68(9):1085-92. | Wolbing; cofactor |
| Wolfe RC, Blunt J. | 2021 | Perioperative Considerations for the Emerging Alpha-gal Allergy Alpha-gal syndrome is a constellation of symptoms resultant to an immune-mediated hypersensitivity reaction to the oligosaccharide galactose-alpha-1,3-galactose (alpha-gal). This type 1 allergic reaction has been diagnosed in an increasing number of patients worldwide, including patients in the United States, Australia, Spain, Sweden, France, and Japan. 1 ,2 It was first identified during clinical trials of the monoclonal antibody, cetuximab, where a disproportionate number of study participants in the southeastern United States experienced anaphylactic reactions compared to other regions of the US (22% vs 1.2%). 3 The presence of immunoglobulin E (IgE) antibodies to alpha-gal was implicated in these reactions. The development of alpha-gal specific IgE antibodies was subsequently discovered to be triggered by bites from the lone star tick. Between 2010 and 2018, greater than 34,000 Americans tested positive for alpha-gal IgE antibodies, with most reported cases occurring across the Midwest and southeastern states. |
Journal of PeriAnesthesia Nursing. 2021 Aug 1;36(4):435-7. | Perioperative; hospital; medical product; EMR; drug; surgery; pharmacy; pharmaceutical; anesthesia; nursing |
| Wolver SE, Sun DR, Commins SP, Schwartz LB. | 2013 | A Peculiar Cause of Anaphylaxis: No More steak? In recent years, a newly recognized allergic disease has been uncovered, and seemingly idiopathic causes of anaphylaxis now have an explanation. Individuals bitten by the lone star tick may develop IgE antibodies to the carbohydrate galactose-alpha-1,3-galactose (alpha-gal). Upon exposure of sensitized subjects to mammalian meat containing alpha-gal on glycoproteins or glycolipids, delayed anaphylaxis may ensue, often three to six hours after ingestion.1 Many of these individuals have negative allergy skin prick tests to meat, further obscuring the diagnosis. With the recent development of IgE alpha-gal tests, the clinical diagnosis can be confirmed in the laboratory. |
Journal of general internal medicine. 2013 Feb 1;28(2):322-5. | |
| Wong CW, Laylani NA, Davila-Siliezar P, Lee AG. | 2024 | Alpha-gal-related bilateral orbital inflammatory syndrome in a strict vegan. |
Canadian Journal of Ophthalmology. 2024 Mar 19. | ophthalmology |
| Wong XL, Sebaratnam DF. | 2018 | Mammalian meat allergy. Mammalian meat allergy is an allergic reaction mediated by IgE antibodies directed against the mammalian oligosaccharide epitope galactose-alpha-1,3-galactose. Clinically, it is characterized by a range of symptoms including urticaria, angioedema, gastroenteritis, and anaphylaxis hours following ingestion of red meat. It is an emergent allergy in tick endemic areas across the world. As a recently described disease with a cutaneous presentation, dermatologists should be familiar with this entity and recognize it as a differential diagnosis for urticarial and anaphylaxis reactions. |
World Allergy Organization Journal. 2013 Dec 1;6(1):1-7. | |
| Wu A, Patel M, Ramesh M. | 2024 | MAKING TIME FOR TICKS: INCORPORATING TELEMEDICINE INTO A NOVEL PROTOCOL FOR IMMUNOTHERAPY OF ALPHA-GAL SYNDROME. |
Annals of Allergy, Asthma & Immunology. 2024 Nov 1;133(6):S130. | treatment; desensitization; telemedicine |
| Wuerdeman MF, Harrison JM. | 2014 | A Case of Tick-Bite-Induced Red Meat Allergy. Delayed hypersensitivity disorders and food allergies are often challenging for the clinician and patient alike. A recent discovery of an IgE antibody specific to galactose-α-1,3-galactose, which is a carbohydrate abundantly expressed on cells and tissues of beef, pork, and lamb, adds one more tool to aid the clinician in making the appropriate diagnosis. A link has been discovered between the bite of the Lone Star Tick (Amblyomma americanum) and the development of sensitivity to galactose-α-1,3-galactose. With a high prevalence of Lone Star Tick populations inhabiting major U.S. Army Installations, and the type of duty required by our Service members, it could potentially affect susceptible individuals. We describe a case of an active duty soldier who went 4 years searching for this elusive diagnosis and connection and discuss why it should remain in the differential diagnosis when treating military health care beneficiaries. |
Frontiers in immunology. 2019 May 17;10:1056. | |
| Wuhrer M, Grimm C, Dennis RD, Idris MA, Geyer R. | 2004 | The parasitic trematode Fasciola hepatica exhibits mammalian-type glycolipids as well as Gal (β1-6) Gal-terminating glycolipids that account for cestode serological cross-reactivity. Neutral glycosphingolipids from sheep-derived Fasciola hepatica liver flukes were isolated and characterized both structurally and serologically. After HPLC fractionation, glycolipids were analyzed by linkage analysis, enzymatic cleavage, and MALDI-TOF as well as electrospray ionization mass spectrometry. Obtained results revealed the presence of two types of neutral glycolipids. The first group represented mammalian-type species comprising globo- and isoglobotriaosylceramides (Gal(α1-4)Gal(β1-4)Glc(1-1)ceramide and Gal(α1-3)Gal(β1-4)Glc(1-1)ceramide, respectively) as well as Forssman antigen (GalNAc(α1-3)GalNAc(β1-3/4)Gal(α1-4/3)Gal(β1-4)Glc(1-1)ceramide). Applying Helix pomatia agglutinin, recognizing terminal α-linked GalNAc, to cryosections of adult flukes, the latter glycolipid could be localized to the F. hepatica gut. As Forssman antigen from the parasite and sheep host led to identical MALDI-TOF MS profiles, this glycolipid might be acquired from the definitive host. As a second group, highly antigenic glycolipids were structurally characterized as Gal(β1-6)Gal(β1-4)Glc(1-1)ceramide, Gal(β1-6)Gal(α1-3/4)Gal(β1-4)Glc(1-1)ceramide and Gal(β1-6)Gal(β1-6)Gal(α1-3/4)Gal(β1-4)Glc(1-1)ceramide, the latter two structures of which exhibited both isoglobo- or globo-series core structures. Terminal Gal(β1-6)Gal1-motifs have previously been shown to represent antigenic epitopes of neogala-series glycosphingolipids from tape worms. Using human Echinococcus granulosus infection sera, Gal(β1-6)Gal-terminating glycolipids could be allocated to the gut in adult liver fluke cryosections. Corresponding neogala-reactive antibodies in F. hepatica infection serum were detected by their binding to E. granulosus and Taenia crassiceps neogala-glycosphingolipids. These antibodies might contribute to the known serological cross-reactivity between F. hepatica and parasitic cestode infections. |
Glycobiology. 2004 Feb 1;14(2):115-26. | Parasite; trematode; fasciola hepatica; sheep live fluke |
| Xiong Q, Wan AT, Tsui SK. | 2020 | A Mini-review of the Genomes and Allergens of Mites and Ticks. Mites and ticks are associated with many human diseases including allergic diseases and scabies. With the recent advances in the high throughput DNA sequencing technology, many mitochondrial nuclear genomes of these species have been sequenced and the resulting genomic resources will certainly provide novel insights for the future investigation of the functionally important proteins and peptides in these species. In this mini-review, the current situation of mite and tick genomes is described and the future perspectives for the application of the genomic resources are discussed, especially including the novel identification and structural analysis of allergens. |
Current Protein and Peptide Science. 2020 Feb 1;21(2):114-23. | |
| Yamada S, Matsubara K, Chinuki Y, Hori M, Masaki T. | 2019 | EARLY CHILDHOOD-ONSET PORK-CAT SYNDROME DUE TO SENSITIZATION BY BOTH CATS AND DOGS-A CASE REPORT. We present a case of early childhood-onset pork-cat syndrome possibly due to sensitization by both cats and dogs. A 6-year-old girl was referred to our hospital because of repetitive episodes of urticaria when she consumed pork meat. The patient lived with a dog and the ground floor of her house was a veterinary clinic run by her veterinarian parents. Blood tests demonstrated high specific IgE (≥50UA/ml) against cat dander, dog dander, pork, Sus s 1, Fel d 2, Can f 1, Can f 2, and Can f 3. The skin prick test was positive for raw pork and beef. Western blotting analysis detected hot spots on 67-kDa proteins in pork meat and cat dander extract. Cross-reactivity between these two proteins was confirmed by an inhibition test. Furthermore, crossreactivity between pork meat and dog dander extract was also noted. Taken together, the diagnosis of porkcat syndrome was made, and both cats and dogs were suggested to have led to the sensitization. The patient was advised to only eat well-cooked pork, and has been followed thereafter without additional reactions. The previously reported cases of this syndrome developed during adolescence and young adulthood because a considerable period from the sensitization to the development cross-reactivity with pork meat is required. To our best knowledge, this is the youngest reported case of pork-cat syndrome among English and Japanese literatures. The nomenclature of this syndrome as pet animal-meat syndrome improves the understanding of the underlying pathogenesis of cross-reactivity between animal albumins and meat albumins. |
Allergy. 2019;68(9):1141-7. | |
| Yang CX, Baker LM, McLeod-Morin A. | 2024 | Trending ticks: using Google Trends data to understand tickborne disease prevention. |
Frontiers in Public Health. 2024 Jun 13;12:1410713. | |
| Yang YS, Byun YS, Kim JH, Kim HO, Park CW. | 2015 | Food hypersensitivity in adult patients with atopic dermatitis in Korea. Background: It is known that atopic dermatitis (AD ) is associated with food or environmental allergens and increased levels of serum IgE. However, the role of hypersensitivity to food antigens in adult patients remains controversial. Aim: To evaluate the association between food hypersensitivity and AD in 126 adult Korean participants. Methods: Patients with AD were assessed for a previous history of food hypersensitivity that aggravated the symptoms of AD . Blood samples were taken from the patients to measure food allergen‐specific IgE. Based on history and laboratory results, open oral food challenge (OFC ) tests were performed. Results: Of 126 participants, 33 (26.2%) claimed to have experienced previous food hypersensitivity. Both pork and wheat (n = 5 each) were the main foods mentioned, followed by beef (n = 4) and shellfish (n = 3). We found that 20 participants (15.9%) had raised levels of food‐specific IgE, with beef (n = 7), pork (n = 6), milk (n = 5) and wheat (n = 5) being the most common (some patients had more than one). However, when the open OFC tests were conducted in 48 participants with self‐reported food hypersensitivity or raised levels of food‐specific IgE, only one showed a positive reaction; this participant had a previous history of pork consumption exacerbating AD. Conclusions: Although some participants claimed to have a history of AD aggravation related to food intake, when an open OFC test was conducted, few of them had positive results. Our study result indicates that there is a positive reaction rate of only 0.79% for adults. We therefore conclude that adults are less sensitive than children with regard to the association between AD and food hypersensitivity. |
Clinical and experimental dermatology. 2015 Jan;40(1):6-10. | Asia; Korea; prevalence |
| Yans MW, Branca AS, Hahn NG, Crawley SE, Figurskey AC, Hobson KR, Banfield MG, Borden JH. | 2022 | Development of a Simple Trap That Captures Ticks (Acari) on Their Dorsal Surface. We tested two versions of a trap that captures climbing ticks on their dorsum. A prototype based on a decades old model had three components, a truncated pyramidal base with steep sloping walls, downward facing sticky-tape extending beyond and spanning the boundary of the flat upper surface, on which ticks become dorsally immobilized, and a reservoir for gaseous CO2 emission from dry ice that rests on the flat upper surface. A preoperational trap was made of thermoformed plastic and differed from the prototype by its circular structure, a central depression suitable for future housing of a biotic CO2 generator and supplemental volatile lures and a transparent sticky ceiling that enables ticks to exhibit a phototactic response and allows users to see captured ticks without disturbing the traps. Field testing of the prototype in Florida and both trap types in Oklahoma and North Carolina achieved high catches of lone star ticks, Amblyomma americanum (L.) (Acari: Ixodidae), e.g. mean catches of >70 ticks (adults plus nymphs) in 4 h in both the prototype and preoperational traps in North Carolina, and significantly higher yields of ticks than on dry ice baited 1 m2 white sheets. |
Journal of Medical Entomology. 2022 Jan 22. | tick; lone star tick; tick trap |
| Yavuz ST, Sahiner UM, Buyuktiryaki B, Soyer OU, Tuncer A, Sekerel BE, Kalayci O, Sackesen C. Phenotypes of IgE-mediated food allergy in Turkish children. | 2011 | Phenotypes of IgE-mediated food allergy in Turkish children. Data on food allergy‐related comorbid diseases and the knowledge on factors associating specific food types with specific allergic outcomes are limited. The aim of this study was to determine the clinical spectrum of IgE-dependent food allergy and the specific food-related phenotypes in a group of children with IgE-mediated food allergy. Children diagnosed with IgE-mediated food allergy were included in a cross-sectional study. IgE-mediated food allergy was diagnosed in the presence of specific IgE or skin-prick test and a consistent and clear-cut history of food-related symptoms or positive open provocation test. Egg (57.8%), cow's milk (55.9%), hazelnut (21.9%), peanut (11.7%), walnut (7.6%), lentil (7.0%), wheat (5.7%), and beef (5.7%) were the most common food allergies in children with food allergy. The respiratory symptoms and pollen sensitization were more frequent in children with isolated tree nuts‐peanut allergy compared with those with egg or milk allergy (p < 0.001); whereas atopic dermatitis was more frequent in children with isolated egg allergy compared with those with isolated cow's milk and tree nuts‐peanut allergy (p < 0.001). Children with food allergy were 3.1 (p = 0.003) and 2.3 (p = 0.003) times more likely to have asthma in the presence of allergic rhinitis and tree nuts‐peanut allergy, respectively. Interestingly, children with atopic dermatitis were 0.5 (p = 0.005) times less likely to have asthma. Asthma (odds ratio [OR], 2.3; p = 0.002) and having multiple food allergies (OR, 5.4; p < 0.001) were significant risk factors for anaphylaxis. The phenotypes of IgE-mediated food allergy are highly heterogeneous and some clinical phenotypes may be associated with the specific type of food and the number of food allergies. |
Allergy and asthma proceedings. 2011; 32(6): 47. | Europe; Asia; Turkey; beef allergy; prevalence |
| Yi CH, Ruan CP, Wang H, Xu XY, Zhao YP, Fang M, Ji J, Gu X, Gao CF. | 2014 | Function characterization of a glyco-engineered anti-EGFR monoclonal antibody cetuximab in vitro. Aim: To evaluate the biochemical features and activities of a glyco-engineered form of the anti-human epidermal growth factor receptor monoclonal antibody (EGFR mAb) cetuximab in vitro. Methods: The genes encoding the Chinese hamster bisecting glycosylation enzyme (GnTIII) and anti-human EGFR mAb were cloned and coexpressed in CHO DG44 cells. The bisecting-glycosylated recombinant EGFR mAb (bisec-EGFR mAb) produced by these cells was characterized with regard to its glycan profile, antiproliferative activity, Fc receptor binding affinity and cell lysis capability. The content of galactose-α-1,3-galactose (α-Gal) in the bisec-EGFR mAb was measured using HPAEC-PAD. Results: The bisec-EGFR mAb had a higher content of bisecting N-acetylglucosamine residues. Compared to the wild type EGFR mAb, the bisec-EGFR mAb exhibited 3-fold higher cell lysis capability in the antibody-dependent cellular cytotoxicity assay, and 1.36-fold higher antiproliferative activity against the human epidermoid carcinoma line A431. Furthermore, the bisec-EGFR mAb had a higher binding affinity for human FcγRIa and FcγRIIIa-158F than the wild type EGFR mAb. Moreover, α-Gal, which was responsible for cetuximab-induced hypersensitivity reactions, was not detected in the bisec-EGFR mAb. Conclusion: The glyco-engineered EGFR mAb with more bisecting modifications and lower α-Gal content than the approved therapeutic antibody Erbitux shows improved functionality in vitro, and requires in vivo validations. |
Acta Pharmacologica Sinica. 2014 Nov;35(11):1439-46. | |
| Yilmaz B, Portugal S, Tran TM, Gozzelino R, Ramos S, Gomes J, Regalado A, Cowan PJ, d’Apice AJ, Chong AS, Doumbo OK. | 2014 | Gut microbiota elicits a protective immune response against malaria transmission. Glycosylation processes are under high natural selection pressure, presumably because these can modulate resistance to infection. Here, we asked whether inactivation of the UDP-galactose:β-galactoside-α1-3-galactosyltransferase (α1,3GT) gene, which ablated the expression of the Galα1-3Galβ1-4GlcNAc-R (α-gal) glycan and allowed for the production of anti-α-gal antibodies (Abs) in humans, confers protection against Plasmodium spp. infection, the causative agent of malaria and a major driving force in human evolution. We demonstrate that both Plasmodium spp. and the human gut pathobiont E. coli O86:B7 express α-gal and that anti-α-gal Abs are associated with protection against malaria transmission in humans as well as in α1,3GT-deficient mice, which produce protective anti-α-gal Abs when colonized by E. coli O86:B7. Anti-α-gal Abs target Plasmodium sporozoites for complement-mediated cytotoxicity in the skin, immediately after inoculation by Anopheles mosquitoes. Vaccination against α-gal confers sterile protection against malaria in mice, suggesting that a similar approach may reduce malaria transmission in humans. Relevant excerpt: "The salivary glands of noninfected mosquitoes express low levels of α-gal, as detected by western blot (Figure 1) and immunostaining (data not shown)." |
Cell. 2014 Dec 4;159(6):1277-89. | Mosquito; anopheles |
| Young I, Prematunge C, Pussegoda K, Corrin T, Waddell L. | 2021 | Tick exposures and alpha-gal syndrome: a systematic review of the evidence. Alpha-gal syndrome (AGS) refers to a delayed allergic reaction to galactose-α-1,3-galactose (α-Gal) that occurs following the consumption of mammalian meat or exposure to other animal-based foods and products. Increasing evidence suggests that bites from certain tick species can lead to AGS through sensitization of a person’s α-Gal specific IgE levels. This systematic review aimed to summarize the published evidence on this topic to understand post-tick exposure AGS epidemiology and health outcomes. A structured search for literature in eight bibliographic databases was conducted in January, 2020. Grey literature and verification searches were also performed. The exposure of interest was tick bites, and the outcome of interest was AGS. All primary research study designs were eligible for inclusion. References were screened for relevance, and data extraction and risk-of-bias assessment were conducted on relevant studies by two independent reviewers. Data were descriptively and narratively summarized. Of 1390 references screened, 102 relevant articles (103 unique studies) were identified (published from 2009 to 2020). Most studies (76.7 %) were case report or series. These 79 studies reported on 236 post-tick exposure AGS cases from 20 different countries, mostly the United States (33.5 %), Spain (19.5 %), Sweden (18.6 %), and France (12.7 %). The mean case age was 51.3 (SD = 16.7, range 5–85, n = 229), while 68.1 % were male (n = 226). The most commonly reported symptom was urticaria (71.2 %); 51.7 % of cases reported anaphylaxis. Twenty-one observational studies were reported, mostly (95.2 %) among clinical allergy patients. The proportion of AGS cases that recalled tick bites was highly variable across these studies. Three challenge studies evaluating tick exposures and α-Gal levels in α-Gal deficient mice were identified. The existing evidence suggests tick bites lead to α-Gal-specific IgE sensitization, which can cause AGS, but further research is needed to clarify if AGS is only attributable to certain tick species and whether other vectors may trigger AGS. Additional research is needed on risk factors for AGS development, evaluation of diagnostic immunoassays, and the epidemiology and distribution of AGS in different populations. Climate change will likely lead to future cases of AGS in new regions worldwide due to the predicted alteration of suitable tick habitats. |
Ticks and Tick-borne Diseases. 2021 Jan 27:101674. | vectors; ticks |
| Yücel E, Sipahi Cimen S, Varol S, Suleyman A, Ozdemir C, Tamay ZU. | 2019 | Red meat desensitization in a child with delayed anaphylaxis due to alpha-Gal allergy. Letter to the editor. No abstract available. |
Yucel; Asia; Europe; Turkey; desensitization | |
| Yücel E, Tamay Z. | 2020 | Tick Bite-Associated New Disease: Alpha-Gal Allergy/Kene Isırığı ile İlişkili Yeni Bir Hastalık: Alpha-Gal Allerjisi In recent years, two distinct clinical conditions have been defined due to immunoglobulin E (IgE) antibodies induced by tick bite against Alpha gal, an oligosaccharide found in mammalian meat. The first one is late-onset (after 3-6 hours) IgE-mediated systemic hypersensitivity reactions after red meat consumption, while the second is immediate anaphylaxis during the first minutes of cetuximab infusion. As well as infectious diseases associated with tick bites that can be seen in our country, Alpha gal allergy should be kept in mind, and the awareness of physicians should be increased. |
Cocuk Enfeksiyon Dergisi. 2020 Mar 1;14(1):1-4. | Yucel; Asia; Europe; Turkey |
| Yuile A, Fanuli C, van Nunen S, Diakos C, Clarke S, Steiner C, MacMillan R, Oatley M, Pavlakis N. | 2020 | Increased rates of cetuximab reactions in tick prevalent regions and a proposed protocol for risk mitigation Background: Cetuximab is an anti‐epidermal growth factor receptor mouse‐human chimeric monoclonal antibody used to treat advanced colorectal cancers. Initial data suggest that severe infusion reactions occurred in 4.5%, many on first exposure. The majority of those with anaphylactic reactions possess predeveloped IgE antibodies to galactose‐alpha‐1,3‐galactose. It is thought that the vector for preexposure to alpha‐gal is antigen inoculation via tick bites. This retrospective study reviews the experience of two community cancer centers in high tick exposure areas in Sydney with cetuximab anaphylaxis and proposes a protocol to avoid this. Method: Severe cetuximab infusion reactions occurring in the Northern Cancer Institute Frenchs Forest and St Leonards clinics, Sydney, from May 2014 to February 2019 were recorded. Area of residence was then compared to areas of known high tick prevalence. Results: A total of 87 patients received cetuximab in this period. Six patients (6.9%) experienced at least a grade 3 reaction, three females, age range 41–72 years (median 57.5 years). All were receiving cetuximab for metastatic colorectal cancer and their anaphylaxis occurred with the first infusion in all cases. Conclusion: These cases support the existing theory of increased rates of cetuximab anaphylaxis in areas of high tick prevalence. Given this, we recommend the following protocol for patients being considered for cetuximab therapy: known mammalian meat allergy as an absolute contraindication; all patients receiving cetuximab should have RAST (ImmunoCAP®) testing for alpha‐gal specific‐IgE‐specific antibodies before first infusion and those who test positive to be considered alternate therapy. |
Asia‐Pacific Journal of Clinical Oncology. 2020 Sep 24. | Phamacy; pharmaceutical; biologic; monoclonal antibody; cetuximab |
| Zafar S, Wolff A, Schutzer S, McGintee E, Torre A. | 2022 | Are gelatin-containing vaccines safe to give in alpha-gal sensitized patients?. Rationale: Alpha-gal syndrome is a recently discovered disorder of sensitization to the carbohydrate galactose-α-1,3-galactose (alpha-gal) following a bite from the Lone Star tick (Amblyomma americanum). It can result in an IgE-mediated hypersensitivity reaction to non-primate mammalian meat, typically developing 3-8 hours following red meat ingestion. Alpha-gal can also be found in gelatin products, which gives rise to the question of whether gelatin-containing vaccines can be safely administered to patients sensitized to alpha-gal. Methods: The VAERS database was utilized to study the incidence of hypersensitivity reactions to gelatin-containing vaccines in reference to geographic location from 2000-2020, under the assumption that states endemic to the Lone Star Tick would have more patients sensitized to alpha-gal. Results: There were 90 reactions to the MMR vaccine; 49 were from states endemic to the Lone Star Tick. There were 44 reactions to the Varivax vaccine with 36 from states endemic to the Lone Star Tick. There were 34 reactions to the Zostavax vaccine with 17 from states endemic to the Lone Star Tick. None of the vaccination reactions in states endemic to the Lone Star Tick held statistical significance. Conclusions: Our results did not reveal increased hypersensitivity reactions in states endemic to the Lone Star Tick. Under the hypothesis that there are more patients sensitized to alpha-gal in states endemic to the Lone Star Tick, it can be inferred that gelatin-containing vaccines do not hold increased risk in alpha-gal sensitized patients. This may be due to the trace amounts of gelatin contained in these vaccines, however requires further investigation. |
Journal of Allergy and Clinical Immunology. 2022 Feb 1;149(2):AB99. | vaccine |
| Zamorano B, Mailhol C, Atik H, Sakr Y, Trouche-Estival B, Apoil PA. | 2022 | Sensitization and allergy to alpha-galactose: Mechanisms and clinical presentation. Humoral immunity to gal-α1,3-gal, or alpha-galactose (AG) xenoantigen develops early in life in the form of anti-AG IgG, IgA and IgM, usually present at high concentrations in all humans. Sensitization to AG happens only after subcutaneous inoculation of AG-containing molecules present in tick bites. AG-specific IgE are more reliably detected through in vitro dosage of anti-nBos d TG (bovine thyroglobulin) IgE than by prick tests with beef extract or by prick-to-prick tests with red meat. Clinical allergy to AG must be suspected in patients with delayed anaphylaxis after mammalian meat consumption, and can be more rapid and severe if offal was present in the meal. A study of 34 AG-allergic patients from Toulouse (Southwest France) confirms that the presence of cofactors (e.g. physical exercise, NSAID, meat-cooking method) is more important for the occurrence of severe symptoms than the degree of sensitization (i.e. the concentration of nBos d TG-specific IgE). |
Revue Française d'Allergologie. 2022 Sep 23. | France; cofactors |
| Zappe A, Rosenlöcher J, Kohla G, Hinderlich S, Parr MK. | 2021 | Purification and Characterization of Antibodies Directed against the α-Gal Epitope The α-Gal epitope is an immunogen trisaccharide structure consisting of N-acetylglucosamine (GlcNAc)β1,4-galactose (Gal)α1,3-Gal. It is presented as part of complex-type glycans on glycoproteins or glycolipids on cell surfaces of non-primate mammalians. About 1% of all antibodies in human sera are specific toward α1,3-Gal and are therefore named as anti-α-Gal antibodies. This work comprises the purification and characterization of anti-α-Gal antibodies from human immunoglobulin G (IgG). A synthetically manufactured α Gal epitope affinity resin was used to enrich anti-α-Gal antibodies. Selectivity experiments with purified antibodies were carried out using enzyme-linked immunosorbent assays (ELISA), Western blotting, and erythrocyte agglutination. Furthermore, binding affinities toward α-Gal were determined by surface plasmon resonance (SPR) and the IgG distribution of anti α Gal antibodies (83% IgG2, 14% IgG1, 2% IgG3, 1% IgG4) was calculated applying ELISA and immunodiffusion. A range of isoelectric points from pH 6 to pH 8 was observed in 2D gel electrophoresis. Glycan profiling of anti α Gal antibodies revealed complex biantennary structures with high fucosylation grades (86%). Additionally, low amounts of bisecting GlcNAc (15%) and sialic acids (13%) were detected. The purification of anti-α-Gal antibodies from human IgG was successful, and their use as detection antibodies for α Gal-containing structures was evaluated. |
BioChem. 2021 Sep;1(2):81-97. | anti-gal; monoclonal antibody; biologic; detection |
| Zappe A, Rosenlöcher J, Parr MK, Kohla G. | 2022 | Purification and proof of specificity of anti-galactose antibodies towards the antigenic α-galactose epitope. |
Poster | |
| Zazueta Aldapa ID, Espinoza Escobar L. | 2010 | Sensibilizacion alergenica en niños con asma y rinitis alergica, del hospital general de Culiacan Note: documents high rates of allergy to pork ( 13.79%) and beef (8.62%) among Mexican children, according to Gonzales-González VA, Díaz AM, Fernández K, Rivera MF. Prevalence of food allergens sensitization and food allergies in a group of allergic Honduran children. Allergy, Asthma & Clinical Immunology. 2018 Dec 1;14(1):23. |
Archivos de salud en Sinaloa. 2010;4(2):49-53. | North America; Mexico; prevalence |
| Zhan M, Chen S, Xu T, Yin J, Li H, Pan Z, Cui N, Wen L. | 2024 | Alpha-gal syndrome. |
Chinese Medical Journal. 2024:10-97. | Asia; China |
| Zhan M, Yin J, Xu T, Wen L. | 2024 | Alpha-Gal Syndrome: An Underrated Serious Disease and a Potential Future Challenge. |
Global Challenges. 2024:2300331. | Asia; China; review |
| Zhang D, Ye J, Xu T, Xiong B. | 2013 | Treatment related severe and fatal adverse events with cetuximab in colorectal cancer patients: a meta-analysis. |
Journal of Chemotherapy. 2013 Jun 1;25(3):170-5. | cetuximab |
| Zhang H, Zhang F, Yuan R. | 2018 | Applications of natural polymer-based hydrogels in the food industry. | InHydrogels Based on Natural Polymers 2020 Jan 1 (pp. 357-410). Elsevier. | carrageenan |
| Zhang X, Norris DE, Rasgon JL. | 2011 | Distribution and molecular characterization of Wolbachia endosymbionts and filarial nematodes in Maryland populations of the lone star tick (Amblyomma americanum). The lone star tick Amblyomma americanum is host to a wide diversity of endosymbiotic bacteria. We identified a novel Wolbachia symbiont infecting A. americanum. Multilocus sequence typing phylogenetically placed the endosymbiont in the increasingly diverse F supergroup. We assayed a total of 1031 ticks (119 females, 78 males and 834 nymphs in 89 pools) from 16 Maryland populations for infection. Infection frequencies in the natural populations were approximately 5% in females and <2% (minimum infection rate) in nymphs; infection was not detected in males. Infected populations were only observed in southern Maryland, suggesting the possibility that Wolbachia is currently invading Maryland A. americanum populations. Because F supergroup Wolbachia have been detected previously in filarial nematodes, tick samples were assayed for nematodes by PCR. Filarial nematodes were detected in 70% and 9% of Wolbachia-positive and Wolbachia-negative tick samples, respectively. While nematodes were more common in Wolbachia-positive tick samples, the lack of a strict infection concordance (Wolbachia-positive, nematode-negative and Wolbachia-negative, nematode-positive ticks) suggests that Wolbachia prevalence in ticks is not due to nematode infection. Supporting this hypothesis, phylogenetic analysis indicated that the nematodes were likely a novel species within the genus Acanthocheilonema, which has been previously shown to be Wolbachia-free. |
FEMS microbiology ecology. 2011 Jul 1;77(1):50-6. | Tick endosymbionts; wolbachia; nemotode; lone star tick; Amblyomma americanum |
| Zhao W. | 2024 | Allergy in Perioperative Setting. |
Allergy Medicine. 2024 Aug 31:100009. | Perioperative; drug; medical products; medical devices |
| Zhong Z, Zhong T, Peng Y, Zhou X, Wang Z, Tang H, Wang J. | 2021 | Symbiont-regulated serotonin biosynthesis modulates tick feeding activity. Ticks are obligate hematophagous arthropods. Blood feeding ensures that ticks obtain nutrients essential for their survival, development, and reproduction while providing routes for pathogen transmission. However, the effectors that determine tick feeding activities remain poorly understood. Here, we demonstrate that reduced abundance of the symbiont Coxiella (CHI) in Haemaphysalis longicornis decreases blood intake. Providing tetracycline-treated ticks with the CHI-derived tryptophan precursor chorismate, tryptophan, or 5-hydroxytryptamine (5-HT; serotonin) restores the feeding defect. Mechanistically, CHI-derived chorismate increases tick 5-HT biosynthesis by stimulating the expression of aromatic amino acid decarboxylase (AAAD), which catalyzes the decarboxylation of 5-hydroxytryptophan (5-HTP) to 5-HT. The increased level of 5-HT in the synganglion and midgut promotes tick feeding. Inhibition of CHI chorismate biosynthesis by treating the colonized tick with the herbicide glyphosate suppresses blood-feeding behavior. Taken together, our results demonstrate an important function of the endosymbiont Coxiella in the regulation of tick 5-HT biosynthesis and feeding. |
Cell Host & Microbe. 2021 Sep 14. | Tick endosymbionts; coxiella; Haemaphysalis longicornis |
| Zhou JY, Cobb BA. | 2021 | Glycans in Immunologic Health and Disease. The surfaces of all living organisms and most secreted proteins share a common feature: They are glycosylated. As the outermost-facing molecules, glycans participate in nearly all immunological processes, including driving host-pathogen interactions, immunological recognition and activation, and differentiation between self and nonself through a complex array of pathways and mechanisms. These fundamental immunologic roles are further cast into sharp relief in inflammatory, autoimmune, and cancer disease states in which immune regulation goes awry. Here, we review the broad impact of glycans on the immune system and discuss the changes and clinical opportunities associated with the onset of immunologic disease. |
Annual Review of Immunology. 2021 Feb 12;39. | glycan; glycosylation |
| Zhou W, Tahir F, Wang JC, Woodson M, Sherman MB, Karim S, Neelakanta G, Sultana H. | 2020 | Discovery of Exosomes From Tick Saliva and Salivary Glands Reveals Therapeutic Roles for CXCL12 and IL-8 in Wound Healing at the Tick–Human Skin Interface. Ticks secrete various anti-coagulatory, anti-vasoconstrictory, anti-inflammatory, and anti-platelet aggregation factors in their saliva at the bite site during feeding to evade host immunological surveillance and responses. For the first time, we report successful isolation of exosomes (small membrane-bound extracellular signaling vesicles) from saliva and salivary glands of partially fed or unfed ixodid ticks. Our data showed a novel role of these in vivo exosomes in the inhibition of wound healing via downregulation of C-X-C motif chemokine ligand 12 (CXCL12) and upregulation of interleukin-8 (IL8). Cryo-electron microscopy (cryo-EM) analysis revealed that tick saliva and salivary glands are composed of heterogeneous populations of in vivo exosomes with sizes ranging from 30 to 200 nm. Enriched amounts of tick CD63 ortholog protein and heat shock protein 70 (HSP70) were evident in these exosomes. Treatment of human skin keratinocytes (HaCaT cells) with exosomes derived from tick saliva/salivary glands or ISE6 cells dramatically delayed cell migration, wound healing, and repair process. Wound healing is a highly dynamic process with several individualized processes including secretion of cytokines. Cytokine array profiling followed by immunoblotting and quantitative-PCR analysis revealed that HaCaT cells treated with exosomes derived from tick saliva/salivary glands or ISE6 cells showed enhanced IL-8 levels and reduced CXCL12 loads. Inhibition of IL-8 or CXCL12 further delayed exosome-mediated cell migration, wound healing, and repair process, suggesting a skin barrier protection role for these chemokines at the tick bite site. In contrast, exogenous treatment of CXCL12 protein completely restored this delay and enhanced the repair process. Taken together, our study provides novel insights on how tick salivary exosomes secreted in saliva can delay wound healing at the bite site to facilitate successful blood feeding. |
Frontiers in Cell and Developmental Biology. 2020 Jul 16;8:554. | |
| Zia H, Sturgill JL, Maskey AP, Mccoy M, Hadid W, Rana HY. | 2024 | Tick Borne Disease, Ehrlichosis as Risk Factor for Alpha-gal Syndrome: A Case Report. |
C32. ALL THAT WHEEZES (AND THEN SOME): CASE STUDIES. 2024 May:A5293-. | tick-borne disease; Ehrlichiosis |
| Ziganshina MM, Shilova NV, Khasbiullina NR, Terentyeva AV, Dolgopolova EL, Nokel AY, Yarotskaya EL, Shmakov RG, Bovin NV, Sukhikh GT. | 2022 | Repertoire of glycan‐binding placenta‐associated antibodies in healthy pregnancy and in preeclampsia. A possible mechanism of the immune tolerance in pregnancy is production of blocking antibodies which reside in placenta and protect foetal allogeneic cells from the mother's immune system. Their epitope specificity, as well as the nature of the biomolecules masked by them, is unknown. For better understanding of this phenomenon, we attempted to characterize the specificity of antibodies isolated from placentas of women with healthy pregnancy and pre-eclampsia (PE). It was found that: (1) the repertoire of placental antibodies is significantly less variable and qualitatively different from the peripheral blood; (2) with PE, the repertoire of placental antibodies is narrower than in healthy pregnancy; (3) some antibodies are found almost exclusively in the placenta, and some – only in the placenta of healthy women. |
Scandinavian Journal of Immunology. 2022 Mar 14:e13157. | placenta; gynecology; obstetrics |
| Zurbano-Azqueta L, Antón-Casas E, Duque-Gómez S, Jiménez-Gómez I, Fernández-Pellón L, López-Gutiérrez J. | 2021 | Alpha-gal syndrome. Allergy to red meat and gelatin. Introduction: Alpha-gal syndrome is a potentially severe food allergy caused by the presence of alpha-gal-specific IgE. The aim of this study is to describe our series of 13 patients. Material and methods: This work is a retrospective study of patients diagnosed in 2016 and 2017. Skin tests were performed with commercial extract and gelaspan as well as specific IgE determination for alpha-gal and different types of meat. Results: Thirteen patients diagnosed with alpha-gal syndrome were analyzed; 9 of them had anaphylaxis, 6 of whom had been diagnosed with idiopathic anaphylaxis. All had a positive skin test with gelaspan, though this was not true with the commercial extracts, whose results were less conclusive. Conclusions: We believe that a diagnosis of idiopathic anaphylaxis may prevent the identification of patients with alpha-gal syndrome. The gelaspan skin test is more useful than commercial extracts. |
Revista Clínica Española (English Edition). 2021 Oct 14. | Europe; Spain; gelaspan; diagnosis; medical product; plasma volume expander; gelatin |
| Zvara J, Smith AL, Mazzeffi MA, Kleiman AM, Tanaka K, Smith AR, Wilson JM, McNeil JS. | 2024 | Alpha-Gal Syndrome and Cardiac Surgery. |
Journal of Cardiothoracic and Vascular Anesthesia. 2024 Jul 22. | perioperative; cardiac; cardio; cardiology; cardiothoracisc; surgery |
| Zychowski D, Alvarez C, Rodgers HA, Giandomenico D, Boyce RM, Nelson AE, Commins S. | 2023 | 1809. Seroprevalence of Tick-borne Diseases including Alpha-gal Allergy and Associations with Musculoskelatal Symptoms in a Population-based Cohort in Central North Carolina. Background: The incidence of ehrlichiosis, spotted fever rickettsioses (SFR), and Alpha-gal syndrome (AGS) is high in North Carolina (NC). Post-infectious sequelae secondary to ehrlichiosis or SFR are uncommon, however patients often attribute persistent musculoskeletal symptoms, including arthralgia, to prior tick-borne exposure. It is uncertain if these symptoms represent long-term complications from SFR or ehrlichiosis, or non-anaphylactic AGS via the development of IgE to galactose alpha-1,3-galactose (alpha-gal IgE). Utilizing a population-based cohort, we sought to examine the potential association between prior exposure to Ehrlichia, Rickettsia and alpha-gal, and chronic musculoskeletal symptoms. Methods: A total of 488 Individuals from the 2017–2018 Johnston County Osteoarthritis study – a longitudinal, probability-based cohort – completed questionnaires regarding health status and environmental exposures, underwent physical assessment, and had serological testing for Rickettsia, Ehrlichia chaffeensis, and alpha-gal IgE. Multivariable models were used to estimate associations of interest for this cross-sectional study. Results: The overall weighted point prevalence for Ehrlichia IgG was 8.6% (95% CI: 5.9–11.3%), Rickettsia IgG was 17.1% (95% CI: 12.6–21.5), and alpha-gal IgE > 0.1 IU/mL was 19.6% (95% CI: 15.3–23.😎 in Johnston County, NC. Only one individual had antibodies to Rickettsia, Ehrlichia, and alpha-gal IgE > 0.1 IU/mL. Forty percent of participants had detectable alpha-gal IgE > 0 IU/mL, while only 2.5% self-reported a diagnosis of alpha-gal allergy to red meat. Only alpha-gal IgE was associated with knee pain, aching and stiffness (PAS) (IDR 1.3, 95% CI: 1.09-1.56). Antibodies to Rickettsia, Ehrlichia, and alpha-gal were not associated with symptomatic radiographic knee osteoarthritis (OA). Conclusion: Despite only 17% of individuals recalling a tick bite in the past 5 years, 52% had either i) alpha-gal IgE > 0 IU/mL; ii) positive Rickettsia IgG antibodies; and/or iii) positive Ehrlichia IgG antibodies, together, suggesting high levels of tick exposure. Positive Ehrlichia or Rickettsia tick-borne serologies did not predict OA or PAS within this population. Further investigation into extraintestinal manifestations of AGS is needed. |
InOpen Forum Infectious Diseases 2023 Dec (Vol. 10, No. Supplement_2, pp. ofad500-1638). Oxford University Press. | rheumatology; musculoskeletal; arthralgia; arthritis; join pain; knee pain |
| Zychowski DL, Alvarez C, Abernathy H, Giandomenico D, Choudhary SK, Vorobiov JM, Boyce RM, Nelson AE, Commins SP. | 2024 | Tick-Borne Disease Infections and Chronic Musculoskeletal Pain. Key Points Question What is the seroprevalence of Rickettsia, Ehrlichia, and Galactose-α-1,3-galactose (α-gal) antibodies, and is exposure to these tick-borne diseases (TBDs) associated with chronic musculoskeletal symptoms? Findings In this cross-sectional study of 488 individuals, the weighted point prevalence was approximately 9% for Ehrlichia IgG, 17% for Rickettsia IgG, and 20% for α-gal IgE. Antibodies to these TBDs were not associated with symptomatic radiographic knee osteoarthritis, but individuals with elevated α-gal IgE levels reported higher rates of knee pain, aching, or stiffness. Meaning Findings from this study suggest that Ehrlichia or Rickettsia seropositivity was not associated with musculoskeletal symptoms but further investigation into the pathogenesis of α-gal syndrome is needed. |
JAMA Network Open. 2024 Jan 2;7(1):e2351418-. | rheumatology; musculoskeletal; arthralgia; arthritis; join pain; knee pain |
| Rochlin I, Ninivaggi DV, Benach JL. | 2019 | Malaria and Lyme disease-the largest vector-borne US epidemics in the last 100 years: success and failure of public health. |
BMC Public Health. 2019 Jun 24;19(1):804. | tick control |
| AUTHORS | DATE | TITLE & ABSTRACT | PUBLICATION/LINK | KEYWORDS |
All the information on alphagalinformation.org is provided in good faith, but we, the creators and authors of the Alpha-gal Information website offer no representation or warranty, explicit or implied, of the accuracy, adequacy, validity, reliability, availability, or completeness of any information on this site. Under no circumstances should we have any liability for any loss or damage incurred by you as a result of relying on information provided here. We are not physicians or medical professionals, researchers, or experts of any kind. Information provided in this website may contain errors and should be confirmed by a physician. Information provided here is not medical advice. It should not be relied upon for decisions about diagnosis, treatment, diet, food choice, nutrition, or any other health or medical decisions. For advice about health or medical decisions including, but not limited to, diagnosis, treatment, diet, and health care consult a physician.
READ FULL DISCLAIMER>